ID: 1162562295

View in Genome Browser
Species Human (GRCh38)
Location 19:11423763-11423785
Sequence GTCTCCCCTCTCTGCCAGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 370}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162562295_1162562302 13 Left 1162562295 19:11423763-11423785 CCGACCTGGCAGAGAGGGGAGAC 0: 1
1: 0
2: 2
3: 39
4: 370
Right 1162562302 19:11423799-11423821 TTCACCGGCTTAGGCACCCCTGG 0: 1
1: 0
2: 0
3: 7
4: 58
1162562295_1162562301 4 Left 1162562295 19:11423763-11423785 CCGACCTGGCAGAGAGGGGAGAC 0: 1
1: 0
2: 2
3: 39
4: 370
Right 1162562301 19:11423790-11423812 TGTGTCGGTTTCACCGGCTTAGG 0: 1
1: 0
2: 0
3: 3
4: 38
1162562295_1162562307 25 Left 1162562295 19:11423763-11423785 CCGACCTGGCAGAGAGGGGAGAC 0: 1
1: 0
2: 2
3: 39
4: 370
Right 1162562307 19:11423811-11423833 GGCACCCCTGGGGCCCGTCTGGG 0: 1
1: 0
2: 2
3: 13
4: 179
1162562295_1162562303 14 Left 1162562295 19:11423763-11423785 CCGACCTGGCAGAGAGGGGAGAC 0: 1
1: 0
2: 2
3: 39
4: 370
Right 1162562303 19:11423800-11423822 TCACCGGCTTAGGCACCCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 80
1162562295_1162562300 -2 Left 1162562295 19:11423763-11423785 CCGACCTGGCAGAGAGGGGAGAC 0: 1
1: 0
2: 2
3: 39
4: 370
Right 1162562300 19:11423784-11423806 ACAGGGTGTGTCGGTTTCACCGG 0: 1
1: 0
2: 0
3: 4
4: 89
1162562295_1162562306 24 Left 1162562295 19:11423763-11423785 CCGACCTGGCAGAGAGGGGAGAC 0: 1
1: 0
2: 2
3: 39
4: 370
Right 1162562306 19:11423810-11423832 AGGCACCCCTGGGGCCCGTCTGG 0: 1
1: 0
2: 0
3: 19
4: 155
1162562295_1162562310 29 Left 1162562295 19:11423763-11423785 CCGACCTGGCAGAGAGGGGAGAC 0: 1
1: 0
2: 2
3: 39
4: 370
Right 1162562310 19:11423815-11423837 CCCCTGGGGCCCGTCTGGGGTGG 0: 1
1: 0
2: 2
3: 41
4: 455
1162562295_1162562308 26 Left 1162562295 19:11423763-11423785 CCGACCTGGCAGAGAGGGGAGAC 0: 1
1: 0
2: 2
3: 39
4: 370
Right 1162562308 19:11423812-11423834 GCACCCCTGGGGCCCGTCTGGGG 0: 1
1: 0
2: 1
3: 14
4: 194
1162562295_1162562304 15 Left 1162562295 19:11423763-11423785 CCGACCTGGCAGAGAGGGGAGAC 0: 1
1: 0
2: 2
3: 39
4: 370
Right 1162562304 19:11423801-11423823 CACCGGCTTAGGCACCCCTGGGG 0: 1
1: 0
2: 0
3: 4
4: 83
1162562295_1162562312 30 Left 1162562295 19:11423763-11423785 CCGACCTGGCAGAGAGGGGAGAC 0: 1
1: 0
2: 2
3: 39
4: 370
Right 1162562312 19:11423816-11423838 CCCTGGGGCCCGTCTGGGGTGGG 0: 1
1: 0
2: 17
3: 306
4: 1623

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162562295 Original CRISPR GTCTCCCCTCTCTGCCAGGT CGG (reversed) Intronic
900415994 1:2534927-2534949 GTCTCCACCCTCGGCCAGGGAGG + Intergenic
901934540 1:12618455-12618477 GGCTCCCCTCTCTGCAAGCCGGG + Intergenic
902393779 1:16121013-16121035 CTCTCCCCTCTCTGCCATCATGG - Intergenic
902545435 1:17186694-17186716 TTCTGCCCTCTCTGCAAGGAGGG - Intergenic
902647392 1:17809713-17809735 GTCTCCCATCACTCCCAGATGGG + Intronic
903154435 1:21434523-21434545 GGCTCACCTCAGTGCCAGGTGGG + Intergenic
903272464 1:22198627-22198649 GTCTCCCCTTTCATCCAGGCTGG + Intergenic
904044585 1:27602182-27602204 GTCTCCCCTCCCTCCCAGCTTGG - Intronic
905884200 1:41482941-41482963 CTCTCCCCTCTCAGACAGGCTGG + Intronic
905900082 1:41575571-41575593 GGCTCCCCTCTCTGGGAGGCAGG + Exonic
906299640 1:44672738-44672760 GTCTCCCCTGTCGCCCAGGCCGG - Intronic
906333075 1:44904045-44904067 GTCTGCCCTGTCTCCCAGGCTGG - Intronic
909174174 1:72334555-72334577 ATCTCACCTCTCTGTGAGGTGGG + Intergenic
909247098 1:73300023-73300045 GTCTCCCCACTCACCCAGGATGG - Intergenic
911147053 1:94562516-94562538 GTCTCCCGTCACCCCCAGGTGGG - Intergenic
912272713 1:108227303-108227325 GTCTCACCTCTGTGCCACATGGG - Intronic
912295507 1:108467019-108467041 GTCTCACCTCTGTGCCACATGGG + Intronic
912721091 1:112020759-112020781 GTCTCTCCCTTCTGCCGGGTGGG + Intergenic
912904512 1:113689775-113689797 GTCTCCCGTCACTTCCAGATGGG - Intergenic
913094112 1:115500101-115500123 GTCTCCCATCACTCCCAGATGGG - Intergenic
913247089 1:116879367-116879389 CTCTCCCCTCTCTCCCAGGAGGG - Intergenic
914748514 1:150516216-150516238 GTCTCCTCTCTCGCCCAGGCTGG - Intergenic
915195231 1:154184074-154184096 GTCTCCTCTGTCGCCCAGGTTGG + Intronic
915207350 1:154279970-154279992 GTCTCACCTCTCGCCCAGGCTGG - Intergenic
916319384 1:163486522-163486544 GTCTCGCCTCTCTGGCTGGTGGG + Intergenic
917090893 1:171352126-171352148 TTGCCCCATCTCTGCCAGGTTGG - Intergenic
917372140 1:174305413-174305435 GTCTCCCCTGTCACCCAGGTTGG + Intronic
918052460 1:180986571-180986593 GTCTCCTCTGTCACCCAGGTTGG + Intronic
918149056 1:181782621-181782643 TACTTCCCTCTCTGCCAGGCTGG + Intronic
919650294 1:200142391-200142413 GTTTCCCATCTTGGCCAGGTTGG + Intronic
919682764 1:200452759-200452781 GTCTCCTCTGTCGCCCAGGTTGG - Intergenic
919923598 1:202180564-202180586 GTCTCCCCACTCTGCTCGGCAGG - Intergenic
919936102 1:202251832-202251854 ATCTCCTCTCCCTTCCAGGTGGG - Intronic
920420845 1:205832337-205832359 TTCTCCCCTCTATGCCAGAGTGG + Intronic
921715027 1:218408961-218408983 GTCTCCCATCACTGCCAGATGGG - Intronic
921811716 1:219522302-219522324 GTCTCACCTTGCTGCCAGGCTGG - Intergenic
922543372 1:226435515-226435537 GGGTCTCCTCTCTGCCAGGTTGG + Intergenic
922928043 1:229367046-229367068 GTCTCCCTTTTCACCCAGGTTGG + Intergenic
923377349 1:233377828-233377850 GTCTCCCATCACTCCCAGATGGG - Intronic
923388030 1:233485022-233485044 GTCTCCTCTGTCTCCCAGGCTGG + Intergenic
924083800 1:240427233-240427255 GTCTCGCCTGTCTCCCAGGCTGG + Intronic
924267918 1:242301511-242301533 TCCTCCCCTCTCTACCAGGAAGG + Intronic
1063100206 10:2943862-2943884 TTCTCCCCTCTCTGCCAGGAAGG - Intergenic
1063276472 10:4573912-4573934 GTCTCCCCATTGTGCCTGGTGGG - Intergenic
1064116264 10:12579960-12579982 GTGTCCACTCTCAGCCAGGGTGG + Intronic
1064264285 10:13812380-13812402 GCTTCCTCTCTCTGCCATGTGGG + Intronic
1064332393 10:14406053-14406075 GTCACCTCACACTGCCAGGTTGG + Intronic
1064901868 10:20303842-20303864 GTCTCCCATCACTCCCAGATGGG + Intergenic
1066410790 10:35166944-35166966 GTTTACCATCTCTGCCAGGCTGG - Intronic
1067236839 10:44458356-44458378 CTCTCCCATCTCTCCCAGCTAGG - Intergenic
1067798428 10:49338154-49338176 GTCTTTCCTCTCTGCCACTTAGG + Intergenic
1068455261 10:57247045-57247067 TTCTCTGCTCTCTGCCAGGCGGG - Intergenic
1069118617 10:64539381-64539403 GTCTCCCTTCTCTGCAGGGTAGG - Intergenic
1069181701 10:65369017-65369039 CACTCCCCTCTGTACCAGGTAGG - Intergenic
1069715815 10:70520521-70520543 GGCTCACCACTCTGGCAGGTTGG + Intronic
1069772271 10:70907494-70907516 CTGTCCCCACCCTGCCAGGTGGG + Intergenic
1070220499 10:74438252-74438274 GTCTCCCCTGTCACCCAGGCTGG + Intronic
1070306038 10:75239714-75239736 CTGCCCCCTCTCTGCCTGGTGGG - Intergenic
1070882082 10:79859539-79859561 TTCTCCCCTCTCTGCACGGGCGG + Intergenic
1071278161 10:84075519-84075541 GGCCTCCCTCTCTTCCAGGTTGG - Intergenic
1072411154 10:95203242-95203264 GTCTCCCATCACTCCCAGATGGG + Intronic
1074338207 10:112599607-112599629 GTCTCACCTGTCTTCCAGGCAGG + Intronic
1074695384 10:116045909-116045931 GTAAGCCTTCTCTGCCAGGTGGG + Intergenic
1074716746 10:116226795-116226817 GTCTCCCATCCCTCCCAGGTAGG - Intronic
1075001939 10:118805189-118805211 GTCCCCGCTGTCTGCAAGGTTGG - Intergenic
1075152618 10:119948210-119948232 GTCTCGCCTGTCTCCCAGGCTGG + Intergenic
1076450464 10:130553782-130553804 GTCTCCCATCACCCCCAGGTGGG - Intergenic
1077186467 11:1237519-1237541 GGCTCCCCGCTCAGCCAGGGAGG + Intronic
1077329641 11:1978382-1978404 CTCTCCCCTGCCTGCCAGGATGG - Intronic
1077624574 11:3758753-3758775 CTCTCCCCTCCCTCCCAGGCTGG - Intronic
1077629118 11:3798671-3798693 GTCTCCTCTTTCTCCCAGGCTGG + Intronic
1077988643 11:7381434-7381456 GGTTTCCCTCTCTGCCAGTTAGG + Intronic
1078104709 11:8351322-8351344 GTCTCCCCACCCTGCGAGCTGGG + Intergenic
1078375210 11:10787641-10787663 GCCTCCCCTCCCTACCAGCTAGG + Intergenic
1078423149 11:11228699-11228721 GTCCCTCCTCTCTGCCTGGCTGG - Intergenic
1080048535 11:27835289-27835311 GTCTCCTCTGTCACCCAGGTTGG + Intergenic
1080528251 11:33148664-33148686 GTCTCCTCTGTCACCCAGGTTGG - Intronic
1080791850 11:35528267-35528289 ACCTCCCCTCTCTACCAGGACGG + Intronic
1081480614 11:43484982-43485004 GTCTCCCATCACTCCCAGATGGG + Intronic
1081791205 11:45787372-45787394 GTCTCCTATCACTCCCAGGTGGG - Intergenic
1082769908 11:57199826-57199848 GTCTCCCATCACCCCCAGGTGGG + Intergenic
1082826930 11:57586789-57586811 GTCTCCTCTGTCCCCCAGGTTGG - Intergenic
1083328500 11:61885853-61885875 GCCTCTCCCCTCTCCCAGGTGGG + Intronic
1085047247 11:73360709-73360731 GAATCCCCTCCCTGCCAGGGAGG - Intronic
1085454559 11:76658419-76658441 CTCTCTCCTCTCTCCCAGGCAGG - Exonic
1086872673 11:92057628-92057650 GTCTCCCCTCTCTGACAAGCTGG - Intergenic
1088750850 11:112841172-112841194 GTCATCCCTCTCTTCCAGGTGGG - Intergenic
1088906887 11:114161946-114161968 GTGGCCCCATTCTGCCAGGTGGG + Intronic
1089367648 11:117931067-117931089 CTCTTCCCTCTCTCCCAGGGAGG + Intergenic
1089991627 11:122866632-122866654 GTCTCATCTGTCTCCCAGGTTGG + Intronic
1090136988 11:124209447-124209469 GTATCTCCTCTCTGCTAGGCAGG + Intergenic
1090255191 11:125278969-125278991 GTCTCCCGGCTCAGCCAGGCTGG - Intronic
1202812620 11_KI270721v1_random:33561-33583 CTCTCCCCTGCCTGCCAGGATGG - Intergenic
1091408978 12:226806-226828 GCCGCCCCTCTCTACCACGTAGG + Intronic
1091444330 12:534971-534993 ATCTCCTCTCTCTGCCCTGTGGG + Intronic
1093401738 12:18754308-18754330 TTCTCCTCTCTCTGCCGGCTGGG + Intergenic
1094451287 12:30585406-30585428 CTCTCCCCTCTCTTACAGGTTGG - Intergenic
1094673444 12:32594379-32594401 GTCTCCCATCACTCCCAGATGGG + Intronic
1095381623 12:41601277-41601299 GTCTCCCATCACTCCCAGATGGG - Intergenic
1095762846 12:45859761-45859783 GTCTCCTCTTTCACCCAGGTTGG + Intronic
1095818532 12:46451097-46451119 GTCTCCCTTCTCTCCCAGCAAGG - Intergenic
1095968653 12:47886013-47886035 GGGTCCTCTCTCTGCCAGGTTGG + Intronic
1096573348 12:52537436-52537458 GACTCCCCTCTCTGTGATGTAGG - Intergenic
1101398240 12:104366821-104366843 GTCTCACCTCTCGCCCAGGCTGG + Intergenic
1102391062 12:112549037-112549059 GTCTCCCATCACTCCCAGATGGG - Intergenic
1102988534 12:117298174-117298196 GTCTCCCATCTCCCCCAGATGGG - Intronic
1103921309 12:124400673-124400695 ATCTCCCCTCTCTGGCCTGTAGG - Exonic
1103933164 12:124461118-124461140 GTTTCCCTTCTCCCCCAGGTTGG - Intronic
1104860628 12:131921565-131921587 GTCTCCCATCTTTTACAGGTGGG + Exonic
1106672879 13:31926413-31926435 GTCTGCTCTGTCTCCCAGGTTGG + Intergenic
1108376693 13:49820716-49820738 GTCTCCTCTCTCTGTCTGGAAGG + Intergenic
1109925500 13:69132496-69132518 GTCTCACCCTTCTGCCAGGCTGG - Intergenic
1111944148 13:94645969-94645991 GGCTCCCCTAGCTCCCAGGTGGG + Intergenic
1112865571 13:103892461-103892483 GTCTCCCATCACCCCCAGGTAGG + Intergenic
1113530338 13:111020120-111020142 GGCTCCTGACTCTGCCAGGTAGG - Intergenic
1113978297 13:114249133-114249155 GTCTCCCATCTCTCCCAGATGGG - Intronic
1118210353 14:63760586-63760608 GTCTCGCTTTTCTGCCAGGCTGG + Intergenic
1119038592 14:71251815-71251837 GTCTCCTCTGTCTCCCAGGTTGG - Intergenic
1120691245 14:87595724-87595746 CTCTCCCCTCTCTACCAGGAAGG - Intergenic
1121452750 14:94019891-94019913 GTCTCCGAGCTCTGCCAGGTGGG - Intergenic
1121669971 14:95701561-95701583 GTCTCCCCTGTCGCCCAGGCTGG - Intergenic
1122719904 14:103716105-103716127 GCCCCCGCTCTCTCCCAGGTTGG + Intronic
1125886529 15:43233916-43233938 CCCTCCCCTCTCTACCAGGAAGG + Intronic
1126114700 15:45198242-45198264 GTCTCCCCTGTCGCCCAGGCTGG - Intronic
1126436756 15:48645292-48645314 GCCTGCCCTCTCCGCCAGGCTGG + Intronic
1127432414 15:58923427-58923449 GTCACCCCTTTCTCCCAGTTGGG - Intronic
1128237750 15:66079275-66079297 GTCTCCCCTCCTTTCCTGGTGGG + Intronic
1128637712 15:69313864-69313886 TTGCCCCCTCTCTGCCAGCTGGG + Intronic
1129193817 15:73952723-73952745 TTCTCCCCTCCCTGCCTGGAAGG - Intergenic
1129241152 15:74252996-74253018 TTCTCCCATCTCTGCCACCTGGG + Intronic
1129880527 15:79003653-79003675 GCCTCCACTATCTGCCTGGTGGG + Intronic
1131436673 15:92428461-92428483 GTCTCCCCTCTCCCCAAGGAGGG + Intronic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1132859792 16:2064545-2064567 GGCTCCCCTCCCTGCAGGGTGGG + Intronic
1132875200 16:2134049-2134071 GGCTCCTCTGTCTGCCAGGCCGG - Intronic
1134519787 16:14913341-14913363 GGCTCCTCTGTCTGCCAGGCCGG + Intronic
1134538304 16:15044403-15044425 GTCTCATCTCTTTGCCAGGCTGG - Exonic
1134554144 16:15152894-15152916 GGCTCCTCTGTCTGCCAGGCCGG - Intergenic
1134707459 16:16311997-16312019 GGCTCCTCTGTCTGCCAGGCCGG + Intergenic
1134960084 16:18400128-18400150 GGCTCCTCTGTCTGCCAGGCCGG - Intergenic
1135508513 16:23060208-23060230 GTATCCCCTTTCTCCCAGCTGGG - Intergenic
1138042621 16:53690224-53690246 GTCTCCTCTGTCGCCCAGGTTGG + Intronic
1139287217 16:65826307-65826329 GCCACCCCTCTCTGCAAGGCAGG - Intergenic
1139353687 16:66354029-66354051 GTCTCCTCGCTCTGCCAGCCAGG + Intergenic
1139952821 16:70680272-70680294 GCCTCCCCTCTCTCCCAGCTGGG + Intronic
1142647991 17:1327794-1327816 GTCTCTGCTGTCTGCCAGGTGGG + Intergenic
1144310744 17:14011955-14011977 GTCTCCCGTGCCTGGCAGGTTGG - Intergenic
1146086964 17:29838675-29838697 GTGGCCCCTCTCTGCTAGGCAGG - Intronic
1146315991 17:31807249-31807271 GTCTCCCCTGTCACCCAGGTTGG + Intergenic
1146749943 17:35369205-35369227 GACTCCCCTCTGGCCCAGGTTGG - Intronic
1147209454 17:38863625-38863647 GTCTCCTCTGTCAGCCAGGCAGG + Intergenic
1148444765 17:47730864-47730886 GTCCCGCCCCTCTGCCAGCTTGG - Intergenic
1148553592 17:48564741-48564763 CCCTCCCTTCTCTGCCGGGTCGG - Intronic
1148896792 17:50843546-50843568 GTTTTCTCGCTCTGCCAGGTGGG - Intergenic
1149272066 17:54990469-54990491 GTCTCCCCTCACCCCCAGATGGG + Intronic
1150021263 17:61615790-61615812 TCCTCCCCTCTCTGACAGTTGGG - Intergenic
1150039180 17:61840325-61840347 GTCTCCCCTGTCACCCAGGATGG - Intronic
1150257126 17:63756267-63756289 TTCTCCCATCTCTGACAGGATGG + Exonic
1150365565 17:64580862-64580884 GACTCTCCTCTCTGCCAGCCTGG + Exonic
1151029796 17:70723331-70723353 GCCTCCTACCTCTGCCAGGTGGG - Intergenic
1151404588 17:73878202-73878224 CTCTCCTCTCTCAGCCAGGGAGG + Intergenic
1151475055 17:74340585-74340607 GGCTCCCCTCCCTGCAGGGTAGG - Intronic
1151767490 17:76139887-76139909 GCCTCCTCTACCTGCCAGGTGGG + Exonic
1152708069 17:81855656-81855678 GTCTCTGCTCTCTGCCAGCCAGG + Intronic
1152920052 17:83062087-83062109 GTCTCCCCTCTGGGGCAGGGAGG + Intergenic
1153013475 18:562265-562287 GTCTCCCTTCACTCCCAGATGGG + Intergenic
1153262525 18:3238365-3238387 GCCTCCCCCCTCCCCCAGGTCGG - Intergenic
1153622054 18:6988775-6988797 GTCTCCTCTGTCTCCCAGGTTGG - Intronic
1153768532 18:8397269-8397291 CTCTACCCTCCCTGCCAGGGCGG + Intronic
1154149862 18:11898096-11898118 GTCTCCCCTGTCACCCAGGCTGG + Intronic
1155221858 18:23692299-23692321 CTCTCTCGTCTCTCCCAGGTTGG + Intronic
1155607817 18:27628002-27628024 GTTTCCCCTCTCTGCTACGTTGG + Intergenic
1155991596 18:32284587-32284609 GTCCCCACTGTGTGCCAGGTAGG + Intronic
1156036236 18:32770630-32770652 CCCACCCCTGTCTGCCAGGTTGG - Exonic
1156484680 18:37457258-37457280 GTGGCCCCTCGCTGCCAGCTAGG + Intronic
1156536518 18:37869829-37869851 GTCTCCCATCACCCCCAGGTGGG - Intergenic
1157472536 18:48001056-48001078 GTCTCCCATCACTTCCAGATGGG + Intergenic
1157780273 18:50432223-50432245 GTCTCCCATCACTTCCAGATGGG + Intergenic
1159300677 18:66562297-66562319 GTCTCCCATCACTGCCAGGTGGG - Intronic
1159381951 18:67671501-67671523 GTCTCCCATCACTCCCAGATGGG - Intergenic
1160355090 18:78221093-78221115 CTCTCCGCTTCCTGCCAGGTTGG - Intergenic
1160919964 19:1514724-1514746 GTCTCGCCTGTCTCCCAGGCTGG - Intergenic
1161458036 19:4379757-4379779 GTGACCCCTCACTGCCAGGATGG + Intronic
1161852827 19:6746440-6746462 GTCACCACTGTCTGCAAGGTGGG - Exonic
1161955157 19:7489780-7489802 TCCTCCCCTCTCTACCAGGAAGG + Intronic
1162562295 19:11423763-11423785 GTCTCCCCTCTCTGCCAGGTCGG - Intronic
1163391120 19:17030521-17030543 GTCTCCCATCACCCCCAGGTAGG - Intergenic
1163542027 19:17917364-17917386 GTCTCCCATCACTCCCAGATGGG + Intergenic
1164761388 19:30730971-30730993 GCTTCCCCTCTCTATCAGGTGGG + Intergenic
1166938122 19:46347223-46347245 GTCCACCCTCCCTGCCAGGCGGG - Intronic
1167802463 19:51753454-51753476 GTCTCCCATCACTCCCAGATGGG + Intronic
1168507978 19:56952280-56952302 GTCTCCCATCACTCCCAGCTGGG - Intergenic
925165350 2:1712526-1712548 TTCTCCCCTTTCTGCCTGTTTGG - Intronic
925233366 2:2255462-2255484 TTCTCCCCTCCCTTCTAGGTGGG - Intronic
925801339 2:7604932-7604954 GTCTCCCATCACCCCCAGGTGGG - Intergenic
927882950 2:26701477-26701499 TCCTCCCCTGTCTGCCAGGAAGG + Intronic
928927605 2:36595341-36595363 GTTTCCCCTCTCCCCCAGATAGG - Intronic
930901446 2:56511715-56511737 TCCTCCCCTCTATGCCTGGTTGG - Intergenic
931597842 2:63969533-63969555 GTCTCCCATCTCCCCCAGATGGG + Intronic
932137297 2:69242538-69242560 GCCTCCCCTCTCGGCCAGCCTGG + Intronic
933652499 2:84860751-84860773 GTTTCTCCTCTCTGCCTTGTAGG + Intronic
933774469 2:85763925-85763947 GTCTCCCATGCCTGCCAGGCTGG + Intronic
933978055 2:87527802-87527824 GTCTCCCCTGTCACCCAGGCTGG - Intergenic
934552503 2:95270966-95270988 GGCAGCCCTCTCTGCCATGTTGG + Intergenic
934660667 2:96142020-96142042 GTCTCCCATCACTCCCAGATGGG - Intergenic
936315778 2:111423005-111423027 GTCTCCCCTGTCACCCAGGCTGG + Intergenic
937355040 2:121192882-121192904 GCCTCTCCACTCTGCCTGGTGGG - Intergenic
937850352 2:126626850-126626872 GTCTCCCATCACTCCCAGATGGG - Intergenic
938298286 2:130192123-130192145 CTTTCCCTTCTCTGGCAGGTGGG - Exonic
938458481 2:131482534-131482556 CTTTCCCTTCTCTGGCAGGTGGG + Exonic
938554697 2:132414415-132414437 CTTTTCCCTCTCTGACAGGTTGG - Intergenic
938684162 2:133720726-133720748 GTCTCCCATCACTCCCAGATGGG - Intergenic
939803188 2:146738708-146738730 GTCTCCTCTGTCTCCCAGGCTGG + Intergenic
939991802 2:148882747-148882769 GTCTCCCCATTCTGCCAGCCAGG + Intronic
940174971 2:150868871-150868893 TCCTCCCCTCTCTGCCAGAAAGG + Intergenic
940239761 2:151550235-151550257 GTCTCCTCTGTCTCCCAGGCTGG - Intronic
940920057 2:159296251-159296273 GCCTCCCCTCTGTGGTAGGTGGG - Intergenic
940990714 2:160093299-160093321 GTCTCCCATCACTGCCAGATGGG - Intergenic
943441588 2:187933367-187933389 TTTTCCCCTCTCTTCCAGTTGGG - Intergenic
943963237 2:194295375-194295397 GTCTCCTGTGTCTCCCAGGTTGG - Intergenic
944583678 2:201155159-201155181 GTCTCACATCTCTGACAGATGGG + Intronic
947546611 2:231014989-231015011 TGCTCCCCTCTCTCCCAAGTTGG - Intronic
948535769 2:238645497-238645519 GTCTCCCATCACTCCCAGATGGG + Intergenic
948623123 2:239249216-239249238 GTCTCCTCTGTCTGCCCCGTGGG - Intronic
1169607960 20:7344668-7344690 ATTTCCCCTTTCTGCCATGTAGG + Intergenic
1169709875 20:8549622-8549644 GTCTCCCCTGTCACCCAGGCTGG + Intronic
1170540448 20:17382339-17382361 GTTTCCCGTCTATGACAGGTGGG - Intronic
1170927725 20:20741226-20741248 GGCTCCCCTGCCTGCCAGTTGGG + Intergenic
1171748826 20:29027271-29027293 GTCTCCTCTGTCTCCCAGGCTGG - Intergenic
1172117826 20:32582853-32582875 CCCTCCCCACCCTGCCAGGTCGG - Intronic
1172904743 20:38360750-38360772 ATCTCCAAACTCTGCCAGGTAGG + Exonic
1173179491 20:40793776-40793798 GTCTCCCCTGTCATCCAGGCTGG + Intergenic
1173685290 20:44919150-44919172 GACTCCCCTTTGAGCCAGGTTGG + Intronic
1173969024 20:47136711-47136733 GTCTCCCCTGTCACCCAGGCTGG - Intronic
1175903398 20:62368645-62368667 CTCTCCCCCCTCCCCCAGGTGGG - Intergenic
1176024677 20:62979702-62979724 CTCTGCCCCCTCTGCCAGGAGGG + Intergenic
1176302723 21:5106232-5106254 GGCTCCCGCCTCTGCCTGGTGGG - Intergenic
1177296950 21:19187966-19187988 GTCTCCCATCACTCCCAGATGGG + Intergenic
1179405565 21:41122613-41122635 GTCTCCCATCTCCCCCAGATGGG - Intergenic
1179486498 21:41713932-41713954 GTCTCCCCGCTCCTCCAGGAAGG - Intergenic
1179854301 21:44155691-44155713 GGCTCCCGCCTCTGCCTGGTGGG + Intergenic
1179902115 21:44399743-44399765 GTCTGCCCTCTCTCCCTGGAGGG + Intronic
1180234806 21:46451718-46451740 GTCTCAGCGCTCTGCCAGGCAGG + Intergenic
1180830526 22:18903722-18903744 GTCTGCCAGGTCTGCCAGGTGGG - Intergenic
1181442385 22:22943332-22943354 GGCTCTCCTCTGTGCCAGGTGGG + Intergenic
1183160326 22:36108993-36109015 GTCTCCCATCACTCCCAGATGGG - Intergenic
1183213574 22:36465500-36465522 GTCTGGCCTCTCTGCCCGGGTGG - Intergenic
1183363808 22:37396725-37396747 GTCTGCCCTCTCCTCCAGGGTGG + Intronic
1183925613 22:41203843-41203865 GTCTCCCCTGTCGCCCAGGCTGG - Intergenic
1184297098 22:43531860-43531882 GCCGCCCCTCCCTGCAAGGTGGG - Intronic
1184580589 22:45413939-45413961 GTGCCTCCTCTTTGCCAGGTTGG - Exonic
1184914693 22:47561488-47561510 GTCTCTGCTCCCTGCCAGGACGG - Intergenic
1203280616 22_KI270734v1_random:128993-129015 GTCTGCCAGGTCTGCCAGGTGGG - Intergenic
949688961 3:6612690-6612712 GTCTCCCAACTCTGTCAGGTAGG - Intergenic
955066439 3:55537204-55537226 GTCTCCCCTCACAGCCATGCTGG + Intronic
956066611 3:65403205-65403227 GTAACTCCTCTGTGCCAGGTAGG - Intronic
956315700 3:67934099-67934121 GTCTCCCATCACTGCTAGATGGG - Intergenic
956438662 3:69259130-69259152 GTCTCCCATCACCCCCAGGTGGG - Intronic
956701376 3:71961952-71961974 TCCTCCCCTCTCTACCAGGAAGG + Intergenic
956772553 3:72538655-72538677 GTCTTCCCTTTCTGCCACCTCGG - Intergenic
959923106 3:111891471-111891493 GTCTCCCATCACTCCCAGATGGG + Intronic
961204354 3:125069048-125069070 GTCTCACCTCTCTGCCTGCTAGG - Intergenic
961225599 3:125242599-125242621 GTCTCACCCCTTTGCCAGGCTGG - Intronic
961493905 3:127276632-127276654 CTCTGTCCTCTCTTCCAGGTGGG + Intergenic
961633443 3:128318081-128318103 CTCTCCCCACTGTGCCAGATGGG - Intronic
961981789 3:131087267-131087289 GTCTCACCTCATTGCCAGGCTGG + Intronic
963880950 3:150527625-150527647 GTCTCCTGTCTCGGCCAGGCTGG + Intergenic
964323924 3:155526560-155526582 CTCTCACCTCCCTGCCATGTGGG - Intronic
965450511 3:168832707-168832729 GTCTCCCATCACTCCCAGATGGG + Intergenic
965547103 3:169927164-169927186 CTCGACCATCTCTGCCAGGTGGG + Exonic
966693534 3:182765356-182765378 CTCTTGCCTCTCTGCCTGGTGGG - Intergenic
966806781 3:183814026-183814048 GTCTGCTCTCTCGCCCAGGTTGG + Intergenic
968511540 4:997822-997844 GGCTCCCCTCGCTGCGAGGCTGG + Intronic
969351376 4:6599904-6599926 GTCTGGCTTCACTGCCAGGTGGG + Intronic
969536392 4:7758582-7758604 CTCACCCCTCTCTCCCCGGTAGG + Intergenic
970511715 4:16788067-16788089 CCCCCCCCTCTCTGCCAGATGGG + Intronic
970860829 4:20700625-20700647 GTCTGCGCTCTCTGCCAAGCCGG + Exonic
971542247 4:27833499-27833521 GTCTCCCCTGTCGCCCAGGCTGG - Intergenic
972362530 4:38341041-38341063 GTCTCCCATCACTCCCAGATGGG + Intergenic
972667805 4:41183999-41184021 GTCTCCCATCACTCCCAGATGGG - Intronic
972834080 4:42847676-42847698 GTCTCTTCTCTCGGCCAGGCTGG + Intergenic
973650768 4:52995195-52995217 GTCTCCCATCACTCCCAGATGGG - Intronic
973992238 4:56421243-56421265 GTCTCCCATCACTCCCAGATGGG + Intronic
974553868 4:63418167-63418189 GTCTCCCATCACTCCCAGATGGG - Intergenic
975349801 4:73332368-73332390 GTCTCCCATCACTCCCAGATGGG + Intergenic
976217602 4:82729780-82729802 TCCTCCCCTCTCTACCAGGAAGG + Intronic
976398972 4:84586389-84586411 GTCTCCCATCACCCCCAGGTGGG - Intronic
976787232 4:88835626-88835648 GTCTCCCATCTCCCCCAGATGGG - Intronic
976927257 4:90514724-90514746 GTCTCCTCTGTCACCCAGGTTGG - Intronic
977263893 4:94831944-94831966 GTCTCCCATCACTCCCAGGTGGG + Intronic
977534402 4:98240513-98240535 GTCTCCTCTGTCGGCCAGGCTGG + Intergenic
977617466 4:99102363-99102385 GTTTCCCCTCTCTTCTAGGCTGG + Intergenic
977910126 4:102524687-102524709 GTCTCCCGTCACTCCCAGATGGG - Intronic
980206995 4:129732866-129732888 GTCTCCCATCACTCCCAGATGGG - Intergenic
984311636 4:178068141-178068163 GTCTCCCATCACCCCCAGGTGGG - Intergenic
985518935 5:361680-361702 GTCTCCCCTCTCTTCCTACTGGG + Intronic
985703281 5:1386306-1386328 GTCTCTCTGCTCAGCCAGGTGGG + Intergenic
985707336 5:1409121-1409143 GGCTCCCCTCTCTTCCAGGGTGG - Exonic
986051495 5:4094456-4094478 GCCTCCCCTCGATTCCAGGTGGG - Intergenic
987513960 5:18881422-18881444 CTATCCCCTCCCTGCCAGGGAGG - Intergenic
987528579 5:19084658-19084680 GTCTCCCATCACTCCCAGTTGGG + Intergenic
987692837 5:21290492-21290514 GTCTCCTCTCTCTCTCAGGCTGG - Intergenic
989739482 5:44753460-44753482 CTCTCCCCTCTCTGAAAGTTGGG - Intergenic
991313637 5:65274636-65274658 ATATCTCCTCTCTGCCTGGTAGG - Intronic
991747460 5:69759232-69759254 GTCTCCTCTCTCTCCCAGGCTGG + Intergenic
991750269 5:69796094-69796116 GTCTCCTCTCTCTCCCAGGCTGG - Intergenic
991799038 5:70339089-70339111 GTCTCCTCTCTCTCTCAGGCTGG + Intergenic
991801843 5:70375894-70375916 GTCTCCTCTCTCTCCCAGGCTGG - Intergenic
991826810 5:70634451-70634473 GTCTCCTCTCTCTCCCAGGCTGG + Intergenic
991829558 5:70670945-70670967 GTCTCCTCTCTCTCCCAGGCTGG - Intergenic
991891396 5:71338515-71338537 GTCTCCTCTCTCTCCCAGGCTGG + Intergenic
992021821 5:72632309-72632331 GTCTCCCCCTTCTGCCTAGTTGG + Intergenic
993307840 5:86292688-86292710 GTCTCACCTCTGTGCCACATGGG + Intergenic
993918224 5:93768047-93768069 GTCTCCAATCTCATCCAGGTTGG - Intronic
994366951 5:98928264-98928286 GTCTCCTCTCGCGGCCCGGTCGG + Intronic
994819805 5:104634698-104634720 ATCTCCCATCTCTCCCAGATGGG - Intergenic
995998611 5:118330650-118330672 GTCTTCCCTCTGTGTCAGCTTGG + Intergenic
996716056 5:126589222-126589244 ATCTCCGCTCACTGCAAGGTCGG + Intronic
997435934 5:133875573-133875595 TCCTCCCCTCTCTACCAGGAAGG - Intergenic
1001522716 5:172406272-172406294 TCATCCCCTTTCTGCCAGGTAGG - Exonic
1001691496 5:173636026-173636048 GTCTCTCTTCTCAGCCAGATTGG + Intergenic
1002317772 5:178355026-178355048 GTCTCACCTGTCTCCCAGGCTGG - Intronic
1002550977 5:179991853-179991875 GTCTCCCATCTCTCCCAGATGGG - Intronic
1002841170 6:908676-908698 GTGTCCTTTCTCTGCCATGTGGG + Intergenic
1004148575 6:13092675-13092697 GTCTCCCATCACCGCCAGATGGG - Intronic
1004897308 6:20161254-20161276 GTCTCCCGTCACTCCCAGATGGG + Intronic
1004911802 6:20292924-20292946 GTCTCCCATCACTCCCAGATGGG - Intergenic
1005290955 6:24378346-24378368 CTCTCTGCTCTCTGCCAGTTTGG - Intergenic
1005372752 6:25152860-25152882 CTCTCCACTTTCCGCCAGGTGGG - Intergenic
1006568037 6:34976106-34976128 GTCTCCTCTGTCATCCAGGTTGG - Intronic
1006840356 6:37024831-37024853 GTCTCCCCTGCCTGCCAGACGGG + Intronic
1007110793 6:39312621-39312643 GTCTCACCTCCCTCACAGGTGGG - Intronic
1007346222 6:41231059-41231081 GTCTCCCATCACTCCCAGATGGG + Intronic
1007924841 6:45642633-45642655 GTCTCCCCCTTCTTCCTGGTGGG - Intronic
1009196763 6:60695681-60695703 GTATCCCCTCTCTTCCTGGCAGG - Intergenic
1009674149 6:66795138-66795160 GTCTCCCATCCCTCCCAGATGGG - Intergenic
1009948222 6:70364619-70364641 TTCTCCTCTCTCTGTCAGCTGGG + Intergenic
1011934585 6:92759517-92759539 GTCTCCCATCACTCCCAGATAGG + Intergenic
1012129205 6:95469958-95469980 GTCTCCAGTCACAGCCAGGTTGG + Intergenic
1015874610 6:137810070-137810092 GTCTCACCTGTCTCCCAGGCTGG - Intergenic
1016366459 6:143323761-143323783 GTCTTCACTCTGTGTCAGGTGGG - Intronic
1017692182 6:156977957-156977979 GTTTTCCCTCTCTGGCGGGTGGG + Intronic
1017757965 6:157545642-157545664 GTCTCCCCTGTCGCCCAGGCTGG - Intronic
1017910912 6:158792241-158792263 GTCTCCTCTGTCGCCCAGGTTGG + Intronic
1018276544 6:162138247-162138269 GTCTCTCCACTCTGTCTGGTGGG - Intronic
1018321066 6:162608973-162608995 GCCTCGCCTCTCTGCCAGTGAGG + Intronic
1018326623 6:162677029-162677051 GTCTCCTCTCTTGGCCAGGCTGG - Intronic
1018883037 6:167904236-167904258 GTCTGCTCTCTCTCCCAGTTTGG + Intronic
1019158431 6:170053759-170053781 ATCTCCCCTCTCTGCCTGGCTGG - Intergenic
1019794937 7:3042675-3042697 TTCTCCCCTTTCTGGTAGGTTGG + Intronic
1020193969 7:6022722-6022744 GACTCCCCGCTTTGCCTGGTTGG - Exonic
1021347785 7:19548806-19548828 GTCTCCCATCACTCCCAGATGGG - Intergenic
1022222136 7:28323871-28323893 GTCTCCCATCACTCCCAGATGGG - Intronic
1022303948 7:29128751-29128773 TTCTCTGCTCTCTGCCAGATGGG + Intronic
1023529130 7:41135595-41135617 GTCTGCCCACTCCGCCTGGTAGG + Intergenic
1024719878 7:52124040-52124062 TTCTCCCCTTTCTACCAGGAAGG + Intergenic
1026310135 7:69176097-69176119 GTCTCCCATCACTTCCAGATGGG + Intergenic
1026353656 7:69539116-69539138 GTCTCCCCTGTCACCCAGGCTGG + Intergenic
1026650863 7:72214912-72214934 GTCTCCCATCACTCCCAGATAGG + Intronic
1026919540 7:74144960-74144982 TTCTCCTCTCTCTGCTAGCTGGG - Intergenic
1027420485 7:78013315-78013337 CTCTCCCCTCCATTCCAGGTGGG + Intergenic
1031347316 7:120684893-120684915 GTCTCCCATCACTCCCAGATAGG + Intronic
1032679637 7:134168530-134168552 ATCTCCCTTCTCTGCCCTGTAGG - Intronic
1032707281 7:134432367-134432389 GTCTCCCATCACTCCCAGATGGG - Intergenic
1032903326 7:136335961-136335983 GTCTCCCATCACCCCCAGGTGGG + Intergenic
1033647183 7:143314664-143314686 GTCTCCCCATGTTGCCAGGTTGG + Intergenic
1034410903 7:150941687-150941709 CTCTCCCCTCCCTGCCATGTGGG - Intergenic
1034549451 7:151810983-151811005 GTCTGCCCTCTCCGCCACCTGGG - Intronic
1034729936 7:153378298-153378320 GTCTCCCATCGCTCCCAGATGGG - Intergenic
1035491610 7:159284452-159284474 GTCTCCCTTGGCTGGCAGGTGGG - Intergenic
1036538086 8:9671999-9672021 GTCTACACTCTCTGCCCGTTAGG + Intronic
1036638022 8:10564831-10564853 TTCTCTCCCCTCTGCCTGGTTGG - Intergenic
1037331914 8:17751267-17751289 GTCTCCTCTCTCACCCAGGATGG - Intronic
1037333209 8:17765035-17765057 GTCTCCCATCACTTCCAGATGGG - Intronic
1037906457 8:22718603-22718625 TTCTACCCGCTCGGCCAGGTGGG + Intronic
1038504506 8:28073030-28073052 GTCTCCACTCTCGCCCAGGCTGG + Intronic
1038829116 8:31037159-31037181 GTCTCCCATCACTCCCAGATAGG - Intronic
1039530722 8:38259413-38259435 GTCTCGCCTATCTGCCAGGCTGG + Intronic
1040905287 8:52463545-52463567 GTCTCCCATCGCTCCCAGATGGG - Intergenic
1042068721 8:64906973-64906995 GTCTCCCATCACCTCCAGGTGGG - Intergenic
1042175080 8:66030560-66030582 ATCTCCCCACTCTAGCAGGTGGG - Intronic
1045110278 8:98933898-98933920 GCCTGACCTCTCTGCCTGGTGGG - Intronic
1045724962 8:105161329-105161351 GTCTCCCATCACTCCCAGATAGG + Intronic
1046934141 8:119870191-119870213 GTCTCCTCTATCAGCCAGGCTGG - Intergenic
1047456470 8:125017519-125017541 GGCTCCCCTCTCACCCAGGACGG + Intronic
1047791187 8:128205481-128205503 GTCTCCCCTCACTCCCAGATGGG + Intergenic
1049254509 8:141606517-141606539 GTCTGCCCTCATTGCCAGGTAGG + Intergenic
1049564811 8:143332482-143332504 GTCTCCTGGCTCTGGCAGGTGGG - Intronic
1049598839 8:143497921-143497943 GAGTCCCCTCTCTGCCTGGCAGG + Intronic
1049617829 8:143583607-143583629 GCCACTCCTGTCTGCCAGGTGGG - Intronic
1052187302 9:25614157-25614179 ATGTCCACTCTCTGCCAGTTTGG - Intergenic
1053019441 9:34684844-34684866 CTTTCCCACCTCTGCCAGGTTGG + Intergenic
1054925499 9:70584831-70584853 CTGTTCCCTCTCTGCCATGTGGG + Intronic
1054998676 9:71423778-71423800 TTCTCCCTTCTCTACCAGGAAGG + Intronic
1055647026 9:78370964-78370986 TTCTCCACTCTCTGCCAAATAGG - Intergenic
1056641721 9:88377162-88377184 GTCTCGCCTGTCTCCCAGGCTGG - Intergenic
1057108794 9:92447325-92447347 GTCTCCCATCACCCCCAGGTGGG - Intronic
1059018942 9:110552578-110552600 GTCTCCCATCACTCCCAGATGGG - Intronic
1059115370 9:111596417-111596439 GTTTCCCATCTTTGCCAGGCTGG - Intronic
1061408162 9:130403940-130403962 TTCTCCCTTCTCTGCCTGGCAGG + Intronic
1061414686 9:130440245-130440267 GTCTCCTCTGTCTCCCAGGCTGG - Intergenic
1062088853 9:134663448-134663470 GCCTCCCAGCCCTGCCAGGTTGG - Intronic
1062477624 9:136736518-136736540 GTCTCCTCTCTCACCCAGGCTGG + Intergenic
1185928469 X:4173317-4173339 GTCTCCCATCACCCCCAGGTGGG + Intergenic
1189516494 X:41718024-41718046 CTCTCCCCTCTCTGGAGGGTTGG - Intronic
1193278523 X:79620670-79620692 GTCTCCCATCACCCCCAGGTGGG + Intergenic
1198930953 X:141859747-141859769 GTCTCCCCTATATCCCAGATAGG + Intronic
1199910585 X:152282539-152282561 GTCTGCCCTCTCTATCAGGAAGG + Intronic
1199936086 X:152574970-152574992 GTCTCTCCACTCTGCAAGGAAGG + Intergenic
1200074641 X:153545000-153545022 GTCTCCCCTCCCTGCAAGAAGGG + Intronic
1200208565 X:154335046-154335068 GTGTCCCCTCTATGGAAGGTAGG + Intergenic
1200228685 X:154433172-154433194 GCCGCCCCCCTCTGCCAAGTGGG - Intronic