ID: 1162562519

View in Genome Browser
Species Human (GRCh38)
Location 19:11425894-11425916
Sequence CTGAGTAAGGGGAAGGCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 466
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 423}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162562519 Original CRISPR CTGAGTAAGGGGAAGGCTGG AGG Intronic
901602059 1:10430317-10430339 CTGAGCAGGGGGCTGGCTGGAGG + Exonic
902387311 1:16083303-16083325 CTGAGGAAGGGGCTGGCAGGGGG - Intergenic
902580587 1:17405072-17405094 CTCAGCCAGGGGCAGGCTGGGGG + Intergenic
902640173 1:17762046-17762068 TTGAGTAAGGTGAAGGTTAGGGG - Intronic
902737391 1:18410244-18410266 CAGTGTAATGGGAAGGCTTGGGG + Intergenic
903779322 1:25811253-25811275 CTTAGGAAGGGGCAGCCTGGTGG + Intronic
904115779 1:28160765-28160787 ATCAGTAAGGGGAGTGCTGGTGG + Intronic
904758847 1:32786630-32786652 CTGCTTCAGGGGAAGGCTTGTGG + Intronic
905273615 1:36802860-36802882 GTGAGGAAAGGGAAGCCTGGAGG - Intronic
905489366 1:38331680-38331702 CTGAGGAGGAGGAAGGCAGGTGG - Intergenic
907293362 1:53433033-53433055 CCGAGTGAGGGCAAGGATGGGGG - Intergenic
907791270 1:57667005-57667027 TTGAGCAAGGAGAAGGATGGTGG - Intronic
909067415 1:70952061-70952083 CTGAGTAATGAGTGGGCTGGTGG + Intronic
909441092 1:75697173-75697195 CTGAGTAAGAGGACTGCTTGAGG + Intergenic
910684660 1:89904028-89904050 CTGAGTAGGGGGAAGTTAGGTGG - Intronic
911252027 1:95587208-95587230 CTGTGTAAGGGGAAAACTGTTGG - Intergenic
913567329 1:120085550-120085572 CTGAGAAAGAGAAAGGCTGTTGG - Intergenic
913630805 1:120707996-120708018 CTGAGAAAGAGAAAGGCTGTTGG + Intergenic
913665979 1:121049225-121049247 CTGAGGAAAGGGAAGGCTTCAGG - Intergenic
914017377 1:143832501-143832523 CTGAGGAAAGGGAAGGCTTCAGG - Intergenic
914288077 1:146246256-146246278 CTGAGAAAGAGAAAGGCTGTTGG - Intergenic
914422679 1:147543455-147543477 CTGAGTATGGGAAAAGCTGAAGG + Intronic
914549113 1:148697002-148697024 CTGAGAAAGAGAAAGGCTGTTGG - Intergenic
914617569 1:149374717-149374739 CTGAGAAAGAGAAAGGCTGTTGG + Intergenic
914655988 1:149741033-149741055 CTGAGGAAAGGGAAGGCTTCAGG - Intergenic
914880588 1:151543643-151543665 CTGGGTAAGTGGAACGATGGAGG + Intronic
914944742 1:152053820-152053842 CAGGGTAGGGGGAAGGCTGGCGG - Intergenic
915366808 1:155321344-155321366 GGGAGTAAGGGGTAGGCTGGAGG + Intronic
915592513 1:156878762-156878784 CTGAGGCAGGGGCAGGCTTGGGG + Intronic
916470347 1:165117484-165117506 CTGAGAGAGGGAACGGCTGGTGG + Intergenic
916506857 1:165436092-165436114 CTCTGTGAGGGGAAAGCTGGAGG - Intronic
919801054 1:201354918-201354940 TTGGGTATGGGGCAGGCTGGGGG - Intergenic
920045816 1:203131673-203131695 CTGAGTTAGGGAAAGGCTGCTGG + Intronic
920502327 1:206493192-206493214 CTGGGTAGGGGGAGTGCTGGAGG - Intronic
920503018 1:206497363-206497385 CTGGTTTATGGGAAGGCTGGAGG - Intronic
920573073 1:207032741-207032763 CTGAGTCAGTGGCAGGGTGGGGG - Exonic
921931087 1:220754865-220754887 CTGAGGAAGTAGAAAGCTGGAGG + Intronic
922794635 1:228333967-228333989 CTGACTGATGGGCAGGCTGGAGG + Intronic
922860829 1:228814939-228814961 CTCAGAAAGGGGAGGGCGGGAGG - Intergenic
1062879485 10:966555-966577 CCGAGGAAGCCGAAGGCTGGTGG + Intergenic
1065151983 10:22831466-22831488 CCAGGGAAGGGGAAGGCTGGGGG + Intergenic
1065463796 10:25997803-25997825 CTGAGAGAGGGGAAGAATGGGGG + Intronic
1065518759 10:26551670-26551692 CTGAGTAAGGGGTAGGAAGCAGG - Intronic
1065570801 10:27069550-27069572 CTTGGGAAGGCGAAGGCTGGTGG - Intronic
1066284861 10:33955719-33955741 CTTAGAAATGGGAAGGCTTGGGG - Intergenic
1066618899 10:37323662-37323684 ATGAGTAAGAGCAAAGCTGGAGG - Intronic
1067450892 10:46381237-46381259 CAAGGCAAGGGGAAGGCTGGTGG + Exonic
1067451445 10:46384458-46384480 CTGAGTAAGGACAAGTGTGGGGG - Intronic
1067586351 10:47478514-47478536 CAAGGCAAGGGGAAGGCTGGTGG - Exonic
1067799255 10:49347740-49347762 CTGAGTAAGTGGTAGTCTGGTGG - Intergenic
1069862555 10:71480714-71480736 CTGAGTGCAGAGAAGGCTGGAGG + Intronic
1069997744 10:72353457-72353479 TTGAGAAAGCGGAACGCTGGTGG - Intronic
1070833931 10:79436336-79436358 CTGAGTAAGGGGAAAGGATGAGG - Intronic
1070959721 10:80490158-80490180 CAGAGTGAGGGGATGGATGGTGG + Intronic
1071107359 10:82113976-82113998 GGGAGTAGGGAGAAGGCTGGTGG - Intronic
1071667761 10:87577115-87577137 CTGAGTAGGGGGCAGGTTTGAGG + Intergenic
1072744819 10:97932681-97932703 GTGAGTGAGAGGAAGGATGGAGG + Intronic
1073150114 10:101305704-101305726 CTGAGGAAGGGGACGGGAGGGGG - Intergenic
1073514800 10:104066683-104066705 GGGAGTAACAGGAAGGCTGGAGG + Intronic
1074853122 10:117454550-117454572 CTGGGGAAGGGGATGGCTGTGGG + Intergenic
1075131571 10:119744312-119744334 TTTAGCAAGGGGAAGGATGGAGG - Intronic
1075401255 10:122163246-122163268 AGGACTAAGGGGATGGCTGGAGG - Intronic
1075711070 10:124530726-124530748 CTGAGGAATGGGCAGGCTTGTGG - Intronic
1077243613 11:1524977-1524999 CTGGGGAAGGGGAAGGAAGGTGG + Intergenic
1080572045 11:33565521-33565543 CTCAGGAAGGGGAAGCCAGGAGG + Intronic
1081652339 11:44832758-44832780 CTGAACAAGGAGAAGGCTGCAGG - Intronic
1081964173 11:47159550-47159572 AAGAGTAAGGGGGAGGCGGGTGG + Intronic
1083436648 11:62647680-62647702 CTGAATGTGGGGAATGCTGGGGG - Exonic
1084022639 11:66426727-66426749 CTGTGTAAAAGGAAGGGTGGAGG + Intergenic
1084499300 11:69525391-69525413 CAGATTATGGGGAAGTCTGGCGG - Intergenic
1084644332 11:70445885-70445907 CAGAGGGAGGGGAAAGCTGGTGG + Intergenic
1085254238 11:75163502-75163524 CTGAGAGAGGGGCAGGATGGTGG + Intronic
1087267372 11:96075647-96075669 CTGAGCTAGGGGAAGTCGGGTGG + Intronic
1087915907 11:103810556-103810578 CTGAGTATGAGGAAGACTGAAGG - Intergenic
1089183977 11:116602515-116602537 CTGAAAAAGGGGCAGGATGGAGG - Intergenic
1089257303 11:117200627-117200649 AGGAGGAAGGGGAAGGATGGTGG + Intronic
1089792688 11:120956032-120956054 CTGAGGTAGGCTAAGGCTGGAGG + Intronic
1089810153 11:121125135-121125157 CTGATTAAGGCAAAGGCCGGGGG - Intronic
1090146854 11:124334009-124334031 CTCAGTGAGGAGGAGGCTGGTGG - Intergenic
1090157999 11:124461711-124461733 CTGATTAAGGTGAAGGCCTGGGG - Intergenic
1090806157 11:130203601-130203623 CTGAGCATGGGGAAGGCATGAGG - Intronic
1091667577 12:2430540-2430562 CTGAGTCAGGGGTGGGCAGGTGG - Intronic
1091799182 12:3313947-3313969 CTGAGTAATGGGAAGGGTGGAGG - Intergenic
1092040790 12:5382443-5382465 ATGTGTAAGGGCAAGGATGGAGG + Intergenic
1092971916 12:13704299-13704321 ATGAGAAAGGGAAAGGATGGAGG + Intronic
1093647787 12:21608384-21608406 ATGAATGAGGGGAAGCCTGGAGG + Intergenic
1094493374 12:30975191-30975213 CTGGGTAAGGTGCAGGGTGGAGG + Intronic
1096216144 12:49798408-49798430 CTCAGGGAGGGGGAGGCTGGTGG + Exonic
1096242492 12:49966930-49966952 CTAAGTGTGGAGAAGGCTGGGGG - Intergenic
1097180197 12:57167450-57167472 CTGAGTCAGGGGGAAGCAGGTGG - Exonic
1097235341 12:57535708-57535730 CTGGGTGGGGGGAAGACTGGAGG - Intronic
1097243582 12:57592572-57592594 CTTGGTATGGGGAAGGCTGATGG + Intronic
1098524657 12:71472698-71472720 CTGAGAAAGGATAGGGCTGGGGG + Intronic
1099212416 12:79808248-79808270 CAGAGTAAGGGGAAAGTGGGAGG - Intronic
1100121621 12:91375267-91375289 CTGGGCAAAGGGAAGGCGGGTGG + Intergenic
1100799497 12:98216454-98216476 ATGAGTAAGGGGTGGGATGGGGG - Intergenic
1101498987 12:105283722-105283744 CTGTGTAAGGGTAAGAGTGGAGG + Intronic
1102029002 12:109729342-109729364 CTGGGTGAGGGGCATGCTGGGGG + Intronic
1102565543 12:113794991-113795013 CTGAATAGGGGGAAGGAGGGAGG + Intergenic
1102704694 12:114870828-114870850 CTGAGCAATGGGAAGACAGGAGG - Intergenic
1102988423 12:117297376-117297398 TTGGGTAAGTGGAAGGATGGTGG + Intronic
1103611032 12:122124297-122124319 CTGAGGAGGGGGACGGCTGAGGG - Intronic
1103611046 12:122124331-122124353 CTGAGGAGGGGGACGGCTGAGGG - Intronic
1103649402 12:122421939-122421961 CGGAGACCGGGGAAGGCTGGAGG - Intronic
1103962342 12:124617041-124617063 GTGAGTAAGGGTGAGGCGGGAGG - Intergenic
1104676354 12:130714719-130714741 CGGTGTGAGGGGAAGGCCGGCGG - Intronic
1104727283 12:131085792-131085814 CTGAGAGAGGGCCAGGCTGGAGG + Intronic
1105332711 13:19432911-19432933 CTGAGTTAGAGGAAGGCTTGTGG + Intronic
1105878976 13:24586866-24586888 CTGAGTTAGAGGAAGGCTTGTGG - Intergenic
1105920861 13:24962184-24962206 CTGAGTTAGAGGAAGGCTTGTGG + Intergenic
1106075528 13:26457631-26457653 CTTAGTGACGGGAAGGATGGTGG - Intergenic
1106649947 13:31679435-31679457 CCCAGTAATGGGATGGCTGGGGG + Intergenic
1106753354 13:32797039-32797061 CTGGGTAAGAGGAAGGCCTGGGG + Intergenic
1108561147 13:51645523-51645545 GAGAGAAAAGGGAAGGCTGGGGG - Intronic
1108766113 13:53631436-53631458 CTCAGGAAGGTGGAGGCTGGTGG - Intergenic
1110469438 13:75842252-75842274 GTGAGTAAGGGGAAGAGTAGAGG - Intronic
1110479660 13:75959542-75959564 CTGAGTCAGGGGAAGGAGGCTGG + Intergenic
1110849909 13:80233073-80233095 CCAGGTATGGGGAAGGCTGGAGG - Intergenic
1113222788 13:108124345-108124367 CAGTGTGAGGGGAAGGCTGGTGG - Intergenic
1113373181 13:109741003-109741025 CTGAGTGTGTGGACGGCTGGTGG + Intergenic
1115199836 14:30841091-30841113 GTGAGCAACGGGAAGGTTGGTGG - Intergenic
1115427963 14:33282728-33282750 CTGAATAGGGGATAGGCTGGTGG + Intronic
1115441597 14:33442123-33442145 CTCAGTAGGGTGAAGACTGGGGG + Intronic
1116056580 14:39871646-39871668 TTTGATAAGGGGAAGGCTGGAGG + Intergenic
1117340497 14:54787781-54787803 CTGAGGAAGGATAAGGCTGGTGG - Intronic
1117558718 14:56912876-56912898 CAGAGTCAGGGGAAGGATGAGGG + Intergenic
1117665586 14:58052884-58052906 CTGAGTTAGGGGAAGAGTAGGGG - Intronic
1118289239 14:64504647-64504669 GAGAGGGAGGGGAAGGCTGGCGG + Intronic
1119686113 14:76632672-76632694 CTGAGGAGAGGGAAGGTTGGAGG + Intergenic
1121239259 14:92416243-92416265 CAGAGTGAGGGAGAGGCTGGTGG + Intronic
1122203296 14:100135684-100135706 CTGGGGAAGGGGAAGGCTACAGG - Intronic
1122805365 14:104253672-104253694 CTGAGGGAGTGGAGGGCTGGGGG + Intergenic
1122931197 14:104933698-104933720 CTGAGTGAGGGAAGGGCGGGAGG + Exonic
1122931224 14:104933766-104933788 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1122931268 14:104933869-104933891 CTGAGTGAGGGGAGGGCGGGAGG + Exonic
1122931307 14:104933971-104933993 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1125695577 15:41634592-41634614 CTCAGTAAGGGGAAGGAAAGGGG - Intronic
1126695113 15:51319172-51319194 CTGATTAAGGGAAAGGGTGTAGG - Intronic
1127691099 15:61398599-61398621 CTGAGGAAGAGAAAGGTTGGTGG + Intergenic
1127717666 15:61665414-61665436 CTGATTAGGGTGAAGCCTGGTGG + Intergenic
1128250895 15:66163707-66163729 CTGAGTTATGGGAAGGCGGGCGG + Intronic
1128478799 15:68019777-68019799 GTGAGTATGGGGAAGTCTTGGGG + Intergenic
1128714228 15:69895455-69895477 CTGAGCAAGAGGAAGGATGGAGG - Intergenic
1129293771 15:74588142-74588164 CTGAGTGGGAGGATGGCTGGAGG + Intronic
1129698399 15:77753716-77753738 CTGAGGGAGGAGAGGGCTGGAGG + Intronic
1129833332 15:78684805-78684827 ATGACTATGAGGAAGGCTGGAGG + Intronic
1130361103 15:83187231-83187253 CTGAGGAAGAGTAAGTCTGGGGG - Intronic
1131511317 15:93050974-93050996 CTGAGTATGCGGAGGGCTGCGGG + Intronic
1132777710 16:1604927-1604949 ATGAGGCAGGGGAAGGGTGGGGG + Intronic
1132834497 16:1945973-1945995 CTGAGTTAGTGGGTGGCTGGGGG + Intronic
1134360669 16:13528231-13528253 CTGAGCAAGGGGAAAGGTGAGGG - Intergenic
1134601999 16:15541007-15541029 CTGAGATAGGGGCAGTCTGGTGG - Intronic
1135629368 16:24023780-24023802 ATGGGTAAGTGGAAGGTTGGGGG - Intronic
1136174216 16:28506422-28506444 CTGAGAATGGGGCCGGCTGGAGG - Intronic
1136525374 16:30826214-30826236 CAGAGTAAGGGGTTGGGTGGTGG - Intergenic
1137004285 16:35258450-35258472 ATGAGCAAGGGGAATGCTGATGG - Intergenic
1137027218 16:35489058-35489080 ATGAGCAAGGGGACGGCTGATGG - Intergenic
1137989730 16:53141851-53141873 TTTATTAAGAGGAAGGCTGGTGG + Intronic
1138039022 16:53642290-53642312 CTGAGTAGGCGGATGGCTTGAGG - Intronic
1140469416 16:75206037-75206059 CTGGGTAGGGGCCAGGCTGGGGG - Intronic
1140472368 16:75222902-75222924 CTGGGTAGGGGCCAGGCTGGGGG + Intronic
1140999426 16:80294760-80294782 CTTTGTAAGAGGAAGGCAGGAGG - Intergenic
1141137302 16:81474638-81474660 CTGTGGAAGGGGAATGATGGGGG + Intronic
1141816206 16:86410883-86410905 CAGAGCAAGGGGATGACTGGAGG + Intergenic
1142572352 17:883244-883266 GCCAGTAAGGGAAAGGCTGGGGG + Intronic
1143858303 17:9869216-9869238 TTGGGTGAGGGTAAGGCTGGAGG - Intronic
1143921053 17:10331325-10331347 CTCAGAAACGGGCAGGCTGGGGG - Intronic
1145795913 17:27655285-27655307 CAGCGGAAGGGTAAGGCTGGAGG - Intergenic
1145844692 17:28028492-28028514 CTTAGGAAGGCCAAGGCTGGAGG + Intergenic
1147315696 17:39619083-39619105 GTGTGGAAGGGGAAAGCTGGAGG - Intergenic
1147542810 17:41375085-41375107 CTGAGAATCAGGAAGGCTGGTGG - Intronic
1147734699 17:42628378-42628400 CATAGTTTGGGGAAGGCTGGTGG - Intergenic
1148063669 17:44853417-44853439 CTCAGCTTGGGGAAGGCTGGGGG + Intronic
1148125211 17:45233194-45233216 CCGAGAACAGGGAAGGCTGGTGG - Intronic
1148444794 17:47731040-47731062 TGGAGGAAGAGGAAGGCTGGGGG - Intergenic
1148472824 17:47906121-47906143 CTGACTAAGGGGGAGGCCAGAGG + Intronic
1148759936 17:49994409-49994431 GAGAGGAAGGGGAAGGCTGTGGG - Intronic
1149990148 17:61378611-61378633 CTGGGCAGGGAGAAGGCTGGTGG - Intronic
1152664097 17:81557413-81557435 CAGAGTAAGGGAAATGCTGGTGG + Exonic
1153540225 18:6146080-6146102 CTGGGTGAGGGGAAGGGTGGCGG + Intronic
1154021609 18:10668373-10668395 AAGAATAAGGGGCAGGCTGGTGG + Intronic
1155022866 18:21912551-21912573 CTCTGTATTGGGAAGGCTGGAGG + Intergenic
1156675664 18:39524712-39524734 CTGAGTAAGGGGAGGGGAGAAGG - Intergenic
1158139156 18:54238982-54239004 ATGAGTAAGGGGAAGGAATGAGG - Intergenic
1158169595 18:54582468-54582490 CTGACTAAGTGTAAGTCTGGGGG - Intergenic
1158371175 18:56806276-56806298 CTGAGCATGGCGAAGGCAGGAGG - Intronic
1158702169 18:59758012-59758034 CTGGGTGAGGAGAAGGTTGGAGG - Intergenic
1160523560 18:79522625-79522647 CTGAGGTGAGGGAAGGCTGGGGG - Intronic
1161698194 19:5782015-5782037 CTGGGGAAGGGGTAGGCTGAAGG + Intergenic
1162403168 19:10458114-10458136 CTCAGTAGGGGCAGGGCTGGAGG + Intronic
1162433837 19:10644818-10644840 CTGAGAGAGGGGAGGCCTGGGGG - Intergenic
1162562519 19:11425894-11425916 CTGAGTAAGGGGAAGGCTGGAGG + Intronic
1163647512 19:18498200-18498222 CTGAGAATGGGGGAGGCTGCAGG + Intronic
1165108307 19:33487216-33487238 CTGGGTGAGTGGAAGGCAGGGGG + Intronic
1165412397 19:35670211-35670233 CTGAGTGAGGAGGAGGTTGGGGG + Intronic
1165452179 19:35890059-35890081 AAAAGTAAGGGGAGGGCTGGTGG + Intronic
1165637573 19:37355102-37355124 CTGAGAAAGGGGAAGGAAGGAGG - Intronic
1166296691 19:41893378-41893400 CTGAGGGAGGAGGAGGCTGGGGG + Intronic
1166296803 19:41893648-41893670 CTGAGGGAGGAGGAGGCTGGGGG + Intronic
1166571834 19:43802125-43802147 CTGAGGGAGGAGGAGGCTGGGGG - Intronic
1166683627 19:44782137-44782159 TTGAGGGAGGGGAGGGCTGGGGG + Intronic
1166695932 19:44851419-44851441 CTGAGAAAGGAGGGGGCTGGGGG - Intronic
1166875181 19:45892595-45892617 CTGAGGAAGGAGCAGGGTGGGGG - Intronic
1167259706 19:48451393-48451415 CTCAGCAAGAGGAAGGGTGGCGG + Intronic
1167286115 19:48599675-48599697 CTGAGGGAGGAGAGGGCTGGGGG + Intergenic
1167337818 19:48897465-48897487 CTGAGATAGGGGCAGGATGGGGG - Intronic
1167668980 19:50838943-50838965 CTGAGGGAGGAGGAGGCTGGGGG + Intergenic
1167752149 19:51387716-51387738 CTGAGCAAGGAATAGGCTGGAGG + Intronic
1167799011 19:51728374-51728396 CTGAGTAAGGGACAAACTGGAGG + Intergenic
1168668868 19:58226325-58226347 TTGAGTCAGAGGCAGGCTGGAGG + Intergenic
925185940 2:1846489-1846511 CTGGGGGAGGGAAAGGCTGGGGG + Intronic
925591167 2:5511448-5511470 CTGAATAAGGGGTAGACTAGAGG - Intergenic
926033918 2:9618924-9618946 AGGACTAAGGGGAAGGGTGGAGG - Intronic
926036346 2:9638728-9638750 ATGACTAAGGGGAAGGAGGGCGG - Intergenic
927104225 2:19810125-19810147 CTGGGAAAGGGCAAGGCTGGAGG + Intergenic
927333744 2:21896343-21896365 CTGGGGAGGGGGAAGGTTGGGGG + Intergenic
927522496 2:23707874-23707896 CTGAGAAAAGGGAAGCCAGGAGG + Exonic
927692743 2:25219683-25219705 CTAAGGCAGGGGAAGGCTGAGGG + Intergenic
927705879 2:25296336-25296358 CTGTGTAAGGGGCGGGCAGGAGG + Intronic
927812219 2:26186437-26186459 CTGAGGAAGAGGAAGTCTTGAGG + Intronic
928174363 2:29024022-29024044 CTAGGTCAGGGGAAGGGTGGGGG + Intronic
928915314 2:36464377-36464399 CTGGGAAATGGGAAGGCAGGAGG - Intronic
929451752 2:42042626-42042648 CTGAGTAGGAGGGAGGCAGGAGG + Intergenic
929456384 2:42069055-42069077 CTGAGTGCGGGGAGGGCTGGTGG - Intergenic
929505137 2:42522491-42522513 CTGGCTTAGGGAAAGGCTGGAGG + Intronic
929522791 2:42669942-42669964 ATGAGTTAGTGGAAGGCTTGTGG + Intronic
929668814 2:43853470-43853492 CTGAGGAAGGGCATGGCTGCTGG + Intronic
929851926 2:45599356-45599378 CTGTCTAAGGGAAGGGCTGGGGG - Intronic
932201184 2:69829803-69829825 CTGCGCTCGGGGAAGGCTGGCGG + Exonic
932219223 2:69987147-69987169 CTGAGTGAGGGGAAGGCATTGGG + Intergenic
932433104 2:71687042-71687064 CCGAGTAAGGAGAAGGCAGGGGG - Intergenic
933763574 2:85692412-85692434 CTGAGTTAGGGTAGGGCTGGGGG + Intronic
933766935 2:85716011-85716033 CTAAGGAAGAGTAAGGCTGGAGG + Intergenic
934553541 2:95276172-95276194 CTGGGTAAGAGGGAGCCTGGGGG - Intronic
934780442 2:96966414-96966436 CTGAGAAAGGCTAACGCTGGGGG - Intronic
935223809 2:101036503-101036525 GTGGGTAAGGGGGACGCTGGGGG + Intronic
936517658 2:113192600-113192622 TTGAGCCTGGGGAAGGCTGGAGG + Intronic
936835391 2:116703594-116703616 GTGAGTAGAGGGAAGGGTGGAGG - Intergenic
937070198 2:119057407-119057429 CTGAGGGCAGGGAAGGCTGGGGG - Intergenic
937299408 2:120830081-120830103 CTGAGTGAGTGGGAGTCTGGTGG + Intronic
937345216 2:121121163-121121185 CTGTGGAAGGGGAGGGCAGGGGG + Intergenic
937875726 2:126824006-126824028 CTGAGCATGGGGAGGCCTGGGGG - Intergenic
938231295 2:129662184-129662206 CTGAGTAAATGGATGGCAGGTGG + Intergenic
940847476 2:158657178-158657200 CTGAGTAAGAGGAAAGTAGGTGG - Intronic
941945914 2:171097030-171097052 CTGAGTAAGCACAAAGCTGGAGG + Intronic
942079239 2:172384903-172384925 TTGGGAAAGGGGAAGGCTCGGGG + Intergenic
942345316 2:174996770-174996792 GTCAGCAAGGGGAAAGCTGGAGG - Intronic
944481894 2:200165715-200165737 GTGAGAAAGGGGAAGGTTTGAGG - Intergenic
944721649 2:202428698-202428720 ATGTGTAAGAGAAAGGCTGGAGG - Intronic
945363165 2:208916915-208916937 CTGAGCAAAGGGATGGCTTGTGG - Intergenic
945695935 2:213104845-213104867 CTGAGTATGGGAATGGCTGAAGG - Intronic
946073773 2:217056641-217056663 CTGAGTAAGGGCAGTGCAGGAGG + Intergenic
946669187 2:222084559-222084581 ATGAGCAAGGGGAAGAGTGGAGG - Intergenic
947624770 2:231612742-231612764 TTCAGTAAGAGGAAGGCTGGGGG - Intergenic
947672442 2:231946808-231946830 CTGACTGAGGGGCAGTCTGGAGG - Intergenic
948098219 2:235353282-235353304 CTGGGAAGGGGGCAGGCTGGTGG + Intergenic
948853601 2:240719985-240720007 CTGAGGAGGGTGAAGCCTGGGGG - Intronic
948892556 2:240914600-240914622 CTGAGTGAGGGGTGGGATGGAGG - Intergenic
1168975481 20:1962508-1962530 CAGACAAAGGGGAAGCCTGGGGG + Intergenic
1169091588 20:2864284-2864306 CTGGGTGAGGGCAAGGCTGGGGG + Exonic
1169149064 20:3275099-3275121 CTGAGTAAGGCAAAGTCAGGAGG + Intronic
1172418240 20:34789701-34789723 GGGAGTGAGGGGAAGGGTGGAGG + Intronic
1172903609 20:38352348-38352370 CTCAGTAAAGGCATGGCTGGTGG - Intronic
1174074162 20:47920392-47920414 CTCAATAAGGGAAAGGCTGGGGG + Intergenic
1174074716 20:47925399-47925421 CTGTGTGTGGGGCAGGCTGGAGG + Intergenic
1174197412 20:48783336-48783358 CTGAGCAAGTGGAAGAATGGAGG + Intronic
1174657631 20:52184869-52184891 CTTTGTGAGGGCAAGGCTGGAGG - Intronic
1175676942 20:60954250-60954272 CCAAGTAATGGCAAGGCTGGAGG + Intergenic
1175920691 20:62449348-62449370 CTGAGCCAGGGTGAGGCTGGGGG - Intergenic
1175946232 20:62560129-62560151 CAGAGCAGGGGGCAGGCTGGGGG - Intronic
1176142508 20:63551057-63551079 CTGAGGATGGTGAAGCCTGGGGG - Intronic
1176740314 21:10595631-10595653 CTGAGTTAGAGGAAGACTTGTGG - Intronic
1177921627 21:27159731-27159753 GGGAGTAAGGGCAAGGTTGGTGG - Intergenic
1178083677 21:29091947-29091969 CTGAGCATGGGGAGGGCTAGGGG + Intronic
1178480328 21:32974644-32974666 TTGGGGAAGGGGAAGGCTGAAGG + Intergenic
1179099087 21:38340819-38340841 CTCAGTTAGGGAAAGGCTGGAGG - Intergenic
1179626661 21:42653178-42653200 CCTAGTTAGGGGAAGGCTGTGGG + Intergenic
1181780706 22:25190896-25190918 CTGTGTAAGGGGAAGAATGAGGG + Intronic
1181964894 22:26649550-26649572 CTGTGCAAGGGGCAGCCTGGAGG + Intergenic
1182350088 22:29694524-29694546 ATGTGCAAGGGGAAGGCTGGTGG - Intronic
1182680729 22:32077416-32077438 GAGAGTAGGGGGAAGGATGGAGG - Intronic
1182711313 22:32325118-32325140 CTGAGTGAGGGGAGCACTGGTGG - Intergenic
1183427632 22:37747905-37747927 CTGAGCAAGGGTAAGGCTGCCGG + Intronic
1183972659 22:41489606-41489628 CAGAGTAAGGGAAATGCAGGAGG - Intronic
1184398831 22:44261897-44261919 CTGAGTGAGGGGAGCACTGGTGG - Intronic
1184877068 22:47282725-47282747 CAGAGTAAGCTGGAGGCTGGGGG - Intergenic
1184992248 22:48178692-48178714 GTGACCAAGGGGGAGGCTGGAGG - Intergenic
949121258 3:387323-387345 CAGAGGGAAGGGAAGGCTGGTGG + Intronic
949493033 3:4607550-4607572 CTGACTAAATGGAAGACTGGAGG + Intronic
950007020 3:9697976-9697998 CTGAGAGAGGGGAGGGCAGGAGG - Intronic
950043952 3:9937992-9938014 CTGAGGCAGGGGCAGGGTGGAGG - Intronic
950416906 3:12873981-12874003 GTGACTCTGGGGAAGGCTGGTGG + Intergenic
953456836 3:43049031-43049053 AAGAGTCAGGGGAAGGATGGAGG + Intronic
954590175 3:51776330-51776352 CTCAGTAGGGGTAAGGCTGCTGG - Intergenic
954840752 3:53509335-53509357 GTGAGTTAGGGGAAAGGTGGAGG + Intronic
955295335 3:57729748-57729770 CTGAGTCTGGGGAAGGGTTGTGG + Intergenic
955767141 3:62356743-62356765 ATGAGTAAGGAGAAGGATGGAGG + Intergenic
956728880 3:72178370-72178392 CTGGGGAAGGGGTAGGGTGGGGG + Intergenic
956816130 3:72910054-72910076 CTGAATCAGGGGAAGGGTGAAGG + Intronic
956963931 3:74436310-74436332 CTCAGTAAGGCTAAGGCTGAGGG + Intronic
959189079 3:103086562-103086584 CTGAGGGATGGGAAGGTTGGAGG - Intergenic
961021300 3:123509475-123509497 CACAGGAAGGGGAAGGTTGGAGG - Intronic
961222778 3:125212927-125212949 CTGGGTAGGGGCAGGGCTGGGGG + Intergenic
961530182 3:127535929-127535951 CTGAGTGTGGGGAAGACAGGAGG - Intergenic
961557615 3:127707296-127707318 CTGAGTATGTGGATGGCTGAGGG + Intronic
961599777 3:128051918-128051940 CTGAGTAGGGCGCGGGCTGGTGG - Intronic
963856522 3:150259322-150259344 GTAAGTAAGGGAGAGGCTGGAGG + Intergenic
965531496 3:169774488-169774510 CAGAGTCAGGTGAAGGCTGATGG + Exonic
965768186 3:172153525-172153547 CTGAGGAAGGAGCAGGCTGGGGG + Intronic
965819496 3:172670480-172670502 CTGACTATGAGGAAAGCTGGAGG + Intronic
967185759 3:186943243-186943265 TTGAGGCAGGGGAAGGCTGCAGG + Intronic
967895864 3:194396187-194396209 CTGAGTAAGGGGACAGCTCCAGG - Exonic
967951377 3:194843671-194843693 CTGAAAAAGGGAAACGCTGGTGG + Intergenic
968075980 3:195816356-195816378 CTGCGTAAGGAGAAGGGCGGAGG - Intergenic
968274339 3:197428385-197428407 CTGAGCAAGGAGAAGGGCGGTGG + Intergenic
968612802 4:1564701-1564723 CAGAGTGAGGGGCAGGATGGGGG + Intergenic
968918755 4:3511595-3511617 CTGAGAAAGGTCAAGGCTAGAGG - Exonic
969422530 4:7105596-7105618 CAGAGTCAGGGGAAGGCTCATGG - Intergenic
969512334 4:7625893-7625915 CTGTGTAAGGCCAAGGCAGGCGG + Intronic
969561334 4:7950249-7950271 GTGAGCAAGGGGATGGATGGTGG - Intergenic
969582548 4:8073529-8073551 CTGAGCAAGGGGAGGGGTGAGGG + Intronic
970210326 4:13703280-13703302 CAGTGTGTGGGGAAGGCTGGTGG - Intergenic
971307546 4:25496794-25496816 ATGAGAAAGGGGAAGGGTGGGGG - Intergenic
971405572 4:26319295-26319317 CGGAGGAAGGGGAAGCCAGGAGG - Intronic
972296233 4:37741742-37741764 CTGAGTGAAGGAAAGGCTGAAGG + Intergenic
972469503 4:39390162-39390184 CTGAGCAAATGGAAGGATGGAGG - Intergenic
973602899 4:52559636-52559658 TTGAGGAAGGGGAAGGGAGGTGG + Intergenic
974707546 4:65541046-65541068 ATGAGAAAGGGGAAGGAGGGAGG - Intronic
974794809 4:66734868-66734890 TTGACTAAGGGGAAAGCAGGGGG + Intergenic
975850098 4:78563395-78563417 ATGAATAAGGGGCAGGTTGGTGG - Intronic
976960965 4:90972714-90972736 TTGAGTAAGAAGAAAGCTGGAGG + Intronic
978752011 4:112260288-112260310 CTGAGAAAAGGGAAGGATGAAGG + Intronic
982211988 4:153045315-153045337 TTGCGTGAGAGGAAGGCTGGGGG - Intergenic
982277791 4:153654585-153654607 GTGGGTAAGGGGGAGGCGGGGGG - Intergenic
982745451 4:159101511-159101533 CAGAGGATGGGGAAGGCTGTGGG + Intergenic
987106515 5:14645060-14645082 CTGAGAAAGGGAACAGCTGGGGG + Intergenic
987343413 5:16957992-16958014 CTGAGTAAGGGGAAGTTTAGTGG + Intergenic
987788175 5:22528824-22528846 ATTAGTAAAGAGAAGGCTGGTGG - Intronic
988867853 5:35354923-35354945 CTGTCTTAGGGGAAGGGTGGAGG + Intergenic
990948429 5:61273411-61273433 ATGGGGGAGGGGAAGGCTGGAGG - Intergenic
992240157 5:74760665-74760687 CTGAGCAAAGGAAAGGTTGGTGG - Intronic
992426338 5:76661897-76661919 CAGAGCAAGGGGAAAGGTGGTGG + Intronic
995434840 5:112123789-112123811 ATGACTTAGGAGAAGGCTGGTGG - Intergenic
995440506 5:112186678-112186700 CTGAGTAATGGGTAGTGTGGCGG + Intronic
996766500 5:127039598-127039620 CTGGGGATGGGGAAGGATGGAGG + Intergenic
996854181 5:127986603-127986625 CTGACTTAGGGGAAGGCTGATGG + Intergenic
997177610 5:131796328-131796350 CTGAGTTGAGAGAAGGCTGGAGG - Intronic
997380824 5:133436333-133436355 CTGGGTAAGGGGGAGGCAGTGGG + Intronic
997626184 5:135332134-135332156 CTGAGTTCGAGGGAGGCTGGGGG + Intronic
998524399 5:142829088-142829110 TTGAGTCAGGGAAAGGCTGGTGG + Intronic
1000183326 5:158834387-158834409 GTGGGTATGAGGAAGGCTGGAGG - Intronic
1001058622 5:168469687-168469709 ATGAGTGAGGGGAGGGCTGTGGG + Intronic
1001084523 5:168691033-168691055 CTGAGGAAGGAAAAGGCTGCTGG - Intronic
1001317094 5:170651326-170651348 CTGTATCAGGGGAAGGCAGGTGG + Intronic
1002094119 5:176821075-176821097 CTGAGAAAGTGGCATGCTGGTGG - Intronic
1002289059 5:178187367-178187389 CTGTGCTCGGGGAAGGCTGGCGG - Intergenic
1003490813 6:6619975-6619997 ATGAGTATGTGGAAGGCTGGTGG + Intronic
1004051262 6:12081880-12081902 CAGGGTATGGGGAAGCCTGGAGG - Intronic
1006003880 6:30987571-30987593 GTGAGTGAGGCGAAGCCTGGTGG + Exonic
1006104930 6:31710733-31710755 CTGTGTATGGGGAGGGGTGGGGG + Intronic
1006456519 6:34134994-34135016 CTGAGTCAGGGCTTGGCTGGGGG + Intronic
1006669465 6:35720606-35720628 CTGAGTAAAGGGAAGGGAAGAGG + Intronic
1006699754 6:35962484-35962506 CTGAGGAAGGGGAGGGCAGAGGG - Intronic
1006750270 6:36372660-36372682 CTGAGCAATTGGAAGGGTGGAGG + Intronic
1007075147 6:39061505-39061527 CTGAGTAATGTGGAGCCTGGGGG + Intronic
1007224418 6:40302863-40302885 CTGTGTGAGGGGAGGGCTGGTGG + Intergenic
1007827758 6:44613908-44613930 CTGAGGAAGGGGAAGGTTTTGGG + Intergenic
1008005122 6:46402374-46402396 CTGAGCAACTGGAAGGCAGGAGG - Intronic
1008019064 6:46555232-46555254 CTCAGAAAGGGAAAGGCTTGTGG - Intronic
1008382682 6:50851631-50851653 CTGATTGCGCGGAAGGCTGGTGG + Intergenic
1010296972 6:74209882-74209904 CCCAGTAATGGGATGGCTGGAGG - Intergenic
1010741550 6:79511457-79511479 GTTAGTGAGGGGAAGGCAGGAGG + Intronic
1012258043 6:97056471-97056493 AGGAGTGACGGGAAGGCTGGTGG - Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013591851 6:111625562-111625584 CAGAGTAAGAGGCAGGCGGGCGG - Intergenic
1013983374 6:116160819-116160841 CCCAGTAATGGGATGGCTGGTGG - Intronic
1014321697 6:119937613-119937635 CAGAGAAAAGGGAATGCTGGTGG - Intergenic
1015187175 6:130431154-130431176 CAGGGCAAGGGGAAAGCTGGAGG - Intronic
1016981617 6:149860155-149860177 CGGAGACAGGGAAAGGCTGGGGG + Intronic
1017528396 6:155263365-155263387 CTGAGTTTGGAAAAGGCTGGCGG - Intronic
1017616765 6:156254295-156254317 CTGTGTCAGGGGCAGGCTGCAGG - Intergenic
1017837323 6:158190264-158190286 CTGAGCAAATGGAAGACTGGAGG - Intronic
1017841170 6:158224188-158224210 CTGAGGCAGGGGAGGGCTGGAGG - Intergenic
1018347977 6:162922300-162922322 CTGAGGAAAGGGAGGTCTGGAGG - Intronic
1018468789 6:164078707-164078729 CTGTCTCAGGGGAAGGCTGCTGG + Intergenic
1019361044 7:604336-604358 GTGTGGAGGGGGAAGGCTGGAGG - Intronic
1019870292 7:3754668-3754690 CTAAGTAAGGGGAAGGGGGGTGG + Intronic
1020952338 7:14696079-14696101 AGGAGGAAGGGGAAAGCTGGTGG - Intronic
1022027635 7:26463662-26463684 CACAGTAATGGGATGGCTGGGGG + Intergenic
1022109434 7:27219504-27219526 CTGAGTTGGGGGAAGGGGGGAGG + Intergenic
1022467343 7:30660720-30660742 CTCAGGAAGGGTAAAGCTGGAGG - Intronic
1022511222 7:30935880-30935902 CTGGGGAAGGGGAGGGTTGGTGG + Intergenic
1022785437 7:33632873-33632895 TTGAATGAGGGGATGGCTGGAGG + Intergenic
1023322750 7:39016996-39017018 CTTTGGGAGGGGAAGGCTGGAGG + Intronic
1024553342 7:50581973-50581995 CTGAGAGAGGGGAAGGGTAGTGG - Intergenic
1026212660 7:68319553-68319575 ATGAGGAAGGGGCAGGCTGCTGG - Intergenic
1026647624 7:72186028-72186050 CTAACTAAGAGGAAGGCCGGAGG + Intronic
1026714343 7:72774132-72774154 CTGAGGAAGGGAAGGACTGGGGG + Intronic
1026964088 7:74428246-74428268 CAGAGTCAGGGTGAGGCTGGGGG - Intergenic
1027005987 7:74693503-74693525 CTGAGGAAAGGGAATGATGGGGG - Intronic
1027224990 7:76238072-76238094 CTGAGGATGGGGAGGGCAGGGGG - Intronic
1027998213 7:85454528-85454550 CTGAACAATAGGAAGGCTGGGGG - Intergenic
1030109405 7:106013671-106013693 CTGGGTGAGGGGAAGGGTAGCGG - Intronic
1031608585 7:123798301-123798323 CTGAGCAAGTAGAAGGGTGGAGG - Intergenic
1031888132 7:127262019-127262041 CTGAGGCAGGTGCAGGCTGGTGG + Intergenic
1032296124 7:130639964-130639986 CTGAGAAAAGGGACGGCTGTTGG - Intronic
1032479757 7:132236854-132236876 GAGAGAAAGGAGAAGGCTGGGGG - Intronic
1035239710 7:157521579-157521601 CTGAGTGTGGCGAGGGCTGGTGG + Intergenic
1036620368 8:10421264-10421286 CTGAGGACAGGGAAGCCTGGGGG - Intronic
1037787501 8:21911641-21911663 GTGGGAGAGGGGAAGGCTGGGGG - Intronic
1037884769 8:22590134-22590156 CTGTGGAAGGTGGAGGCTGGCGG + Intronic
1039042986 8:33425592-33425614 CAGAGGAAGGGGGAGGGTGGAGG + Intronic
1040449229 8:47527304-47527326 CAGAGAAACAGGAAGGCTGGAGG - Intronic
1041424149 8:57701643-57701665 CAGAGGAAGGGGAAACCTGGAGG + Intergenic
1042227488 8:66525396-66525418 CCGAGTAAGGGGCTGGCTGAGGG - Intergenic
1042615822 8:70647872-70647894 CTCACTAAGGGAAACGCTGGAGG + Intronic
1043298694 8:78699978-78700000 CTCAGTAATGGGATTGCTGGGGG + Intronic
1043342978 8:79263948-79263970 CTGAGGAAGGAGAACGCGGGAGG + Intergenic
1045447583 8:102283325-102283347 CTTAGGAAGGGGAAGGCGGGGGG + Intronic
1046791432 8:118326364-118326386 CCAAGTTAGGGGAAGGCTTGGGG + Intronic
1046885681 8:119364408-119364430 CTGAGAAAGGGGAAAGGGGGAGG - Intergenic
1047377923 8:124321413-124321435 CTGAGCTTGGGGAAGCCTGGGGG - Intronic
1047442787 8:124893448-124893470 GTGAGTGTGGGGAAGGCTGGTGG + Intergenic
1049005624 8:139853704-139853726 CTGGGCCAGGGGCAGGCTGGGGG + Intronic
1049059040 8:140261778-140261800 ATGACTATGGGGAAGCCTGGTGG - Intronic
1050695899 9:8278858-8278880 CTGATTAAGGGGAAAGCTAGGGG + Intergenic
1052311624 9:27074804-27074826 CTGTGGCAGGGGATGGCTGGAGG + Intergenic
1052467176 9:28843606-28843628 CAGAGAAAGGGGAGGGATGGAGG + Intergenic
1053393277 9:37751441-37751463 CTGGGGAAGGGCAAGGCTGTGGG + Intronic
1053440077 9:38108838-38108860 CTGAGGAAGGGGAAAAATGGTGG + Intergenic
1055152583 9:73020465-73020487 CTGAGTTAGGGGATGGTTGAAGG + Intronic
1056135396 9:83625057-83625079 CTGAGTGAGGGGAAGCATGATGG + Intronic
1056798435 9:89674972-89674994 CTTAGAATGGGGAAGGCTGCTGG + Intergenic
1057147042 9:92765195-92765217 CTGAGTGTGGGGAAGGCCGCGGG - Intergenic
1057322851 9:94030608-94030630 CTAAGTAAGGGGACGGCGTGAGG - Intergenic
1057523590 9:95780217-95780239 CTGAGTAAGGGAGCTGCTGGTGG + Intergenic
1058549784 9:106102309-106102331 CTTGGGAAGGAGAAGGCTGGAGG - Intergenic
1059671908 9:116499939-116499961 CTGAATCAGGTAAAGGCTGGTGG - Intronic
1060557493 9:124516174-124516196 CTGAGGAATGGGAAGGCAGCTGG + Intergenic
1060634409 9:125189153-125189175 CTGAGGAAGGGGAAGGCGGTGGG - Intronic
1060756189 9:126215638-126215660 GTGAGTGAGGGGAAGGCCGGTGG - Intergenic
1061264893 9:129499172-129499194 CTGAGTAAGAGGTAGGCAGGTGG - Intergenic
1061988507 9:134144394-134144416 CTGAGAAAGGGGTTCGCTGGTGG + Intronic
1062452779 9:136622524-136622546 CTGAGTGAGCCGAGGGCTGGGGG + Intergenic
1185772611 X:2776245-2776267 TTTAGGAAGGGGAGGGCTGGGGG + Intronic
1186737410 X:12480191-12480213 CAGAATCAGAGGAAGGCTGGTGG + Intronic
1187913208 X:24129484-24129506 CTGAGGAAGGGGAGGGGTGCTGG + Intergenic
1188158744 X:26774973-26774995 CTCAGAAAGGGGAAGGTGGGAGG + Intergenic
1189186415 X:39059270-39059292 TTGTGTAAGGGGTAGGGTGGGGG + Intergenic
1189212864 X:39299493-39299515 ATGAGGAAGGGAGAGGCTGGTGG - Intergenic
1189473682 X:41333391-41333413 CGGAGTAAGGGGAAAGGAGGAGG - Exonic
1189612350 X:42750933-42750955 CTGAGAAAGGGGAAGCATTGAGG - Intergenic
1190213813 X:48467395-48467417 CTGAGGATGGGGAGTGCTGGAGG + Intronic
1190379661 X:49827722-49827744 CTGTCTGAGAGGAAGGCTGGTGG + Intergenic
1192044436 X:67657279-67657301 CTGAGTAAAGGTAAGGATAGGGG - Intronic
1192182030 X:68922115-68922137 CTGAGGAGGGGGTAGGGTGGTGG + Intergenic
1193130368 X:77913402-77913424 CGGGGCAAGGGGGAGGCTGGGGG + Intronic
1195066026 X:101239167-101239189 ATGAGTTTGGGGAAGGCAGGAGG - Intronic
1195235556 X:102894017-102894039 CAGAGTAAGAGGAATGCTGAGGG + Intergenic
1195355287 X:104033700-104033722 CTGAGGAAGGGGCAGGAAGGAGG + Intergenic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1200152008 X:153955774-153955796 CAGGGCAAGGGGAAGGCAGGAGG + Intronic
1200216002 X:154368550-154368572 CTGAGGAAGAGGAAGGTGGGTGG + Intronic
1201261643 Y:12164384-12164406 CAGAGTCAGGGGATTGCTGGAGG - Intergenic
1202598595 Y:26569505-26569527 CTGAGTTAGAGGAAGCCTTGTGG - Intergenic