ID: 1162562741

View in Genome Browser
Species Human (GRCh38)
Location 19:11426868-11426890
Sequence CACACGGAGGTGGCCAAGGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 216}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162562741_1162562752 29 Left 1162562741 19:11426868-11426890 CCTACCTTGGCCACCTCCGTGTG 0: 1
1: 0
2: 0
3: 16
4: 216
Right 1162562752 19:11426920-11426942 GGCGCAGGCTGTGCTGCAGCTGG 0: 1
1: 0
2: 3
3: 44
4: 358
1162562741_1162562746 8 Left 1162562741 19:11426868-11426890 CCTACCTTGGCCACCTCCGTGTG 0: 1
1: 0
2: 0
3: 16
4: 216
Right 1162562746 19:11426899-11426921 GCGCCTCCGCCATCTCCAGAAGG 0: 1
1: 0
2: 0
3: 8
4: 90
1162562741_1162562749 14 Left 1162562741 19:11426868-11426890 CCTACCTTGGCCACCTCCGTGTG 0: 1
1: 0
2: 0
3: 16
4: 216
Right 1162562749 19:11426905-11426927 CCGCCATCTCCAGAAGGCGCAGG 0: 1
1: 0
2: 2
3: 7
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162562741 Original CRISPR CACACGGAGGTGGCCAAGGT AGG (reversed) Exonic
900152357 1:1184186-1184208 CAGAAGGAGGTGGCCCAGGCCGG + Intronic
901659276 1:10788616-10788638 CACACCCAGGTGGCCAAGGATGG + Intronic
902618200 1:17635316-17635338 GACAGGGAGGGGGCCCAGGTAGG - Intronic
903085542 1:20854445-20854467 AGCACGCAGGAGGCCAAGGTGGG + Intronic
903537899 1:24079443-24079465 CACTCTGAGGAGGCCGAGGTGGG - Intronic
905225112 1:36473728-36473750 CAAAGGGAGGGGACCAAGGTGGG + Intronic
906538052 1:46562840-46562862 CACACTGTGGGGGCCAGGGTTGG + Exonic
907786419 1:57617314-57617336 CACACTGCAGTGGCCCAGGTTGG + Intronic
908885182 1:68780795-68780817 CACATGGAAGTTGCCAAGGCTGG - Intergenic
913617047 1:120571468-120571490 CACTTGGAGGTGGCCAATTTGGG - Intergenic
913937110 1:125065338-125065360 CACTCGGAGGGGGCCAAAATCGG - Intergenic
914573229 1:148939447-148939469 CACTTGGAGGTGGCCAATTTGGG + Intronic
914837279 1:151218023-151218045 CACTTGGGGGAGGCCAAGGTGGG - Intronic
916682388 1:167116385-167116407 CACAGACAGGTGGCAAAGGTTGG - Intronic
918499050 1:185173446-185173468 CACACTGGGGAGGCTAAGGTGGG + Intronic
920096560 1:203490209-203490231 CACTCTGGGGAGGCCAAGGTGGG - Exonic
920224679 1:204429916-204429938 CCCCCTGAGGTGGCCGAGGTGGG - Exonic
920387034 1:205576505-205576527 CTCTGGGAAGTGGCCAAGGTGGG + Intronic
921160735 1:212470502-212470524 CACCCACACGTGGCCAAGGTAGG - Intergenic
922038291 1:221871245-221871267 CACGTGGAGGTGGCCAGGGGAGG - Intergenic
923364017 1:233241578-233241600 CACATGGAGGTGGAAAAGATTGG - Intronic
1063651859 10:7946039-7946061 CCCACAGAGGAGGCCAAGGCAGG - Intronic
1068827784 10:61458687-61458709 CAGACTGAGATAGCCAAGGTGGG - Intergenic
1070558428 10:77547527-77547549 CACACAGAGGTGGGCCCGGTTGG - Intronic
1070767905 10:79067179-79067201 CACCCGGAGGCGGCCCAGGCGGG - Intergenic
1071177677 10:82945380-82945402 CACAGTGAGGAGACCAAGGTTGG + Intronic
1072921518 10:99581047-99581069 GACAAGGAGCTGGCCAAGGGAGG + Intergenic
1073124497 10:101141055-101141077 GACTCGCAGGTGGGCAAGGTAGG + Intergenic
1075202550 10:120417492-120417514 CACACGGAGGTCCCCCTGGTTGG - Intergenic
1077185462 11:1233677-1233699 TACAAGGAGGTGGCCAGGCTGGG + Intronic
1077245218 11:1533617-1533639 CACTTGGTGGTGGCAAAGGTGGG + Intergenic
1078270879 11:9793634-9793656 CACTTTGAGGAGGCCAAGGTGGG - Intronic
1078432280 11:11297493-11297515 CCCAGGGAGGTGGGCAAGGGAGG - Intronic
1079136743 11:17779747-17779769 CACACCGAGGGGGGCAAGGATGG + Intronic
1080773453 11:35363884-35363906 GACACGGAGGTGTACAAGGCAGG + Intronic
1084397370 11:68921343-68921365 AGCACCAAGGTGGCCAAGGTGGG - Intronic
1084794741 11:71497528-71497550 CTCAGGAAGGTGGCCAAGATGGG + Exonic
1086948696 11:92869319-92869341 CACCCGGACGTGTCCCAGGTGGG + Intronic
1091221819 11:133934290-133934312 GGCACGGAGTTGGCCATGGTGGG - Intronic
1092902643 12:13074417-13074439 CTCAAAGAGGGGGCCAAGGTGGG + Intronic
1092997983 12:13968472-13968494 CACACAGTGCTGGCCAGGGTGGG + Intronic
1095038968 12:37421862-37421884 CACTCGGAGGGGGCCAAAATTGG - Intergenic
1095211820 12:39503117-39503139 CACACACACGAGGCCAAGGTGGG + Intergenic
1097140123 12:56895321-56895343 CTCTGGGAGGAGGCCAAGGTGGG - Intergenic
1098100046 12:67005614-67005636 CACACAGCAGTGGCCATGGTTGG - Intergenic
1103507908 12:121453933-121453955 CAGACGGAGGTGGGAAAGGTGGG - Intronic
1104174540 12:126317192-126317214 CACACTTGGGAGGCCAAGGTGGG - Intergenic
1104641163 12:130468342-130468364 CTCAGGGAGGGGCCCAAGGTTGG - Intronic
1106500800 13:30327099-30327121 CACAAGCAGGTGTCCAAGGAAGG - Intergenic
1107866670 13:44709892-44709914 CACACTTGGGAGGCCAAGGTGGG + Intergenic
1107886098 13:44875212-44875234 CACACAGATGTGGCAAAGCTGGG - Intergenic
1112316115 13:98363335-98363357 CACACGGAAGGGGCAGAGGTAGG - Intronic
1113023837 13:105919008-105919030 CACACTGGGGGGGCCAAGGTGGG - Intergenic
1113711384 13:112467437-112467459 CCCACCGAGGTGGCCCACGTAGG - Intergenic
1115233996 14:31190766-31190788 CACACTTGGGAGGCCAAGGTGGG - Intronic
1117546014 14:56795210-56795232 CACTCCGAGGTGGCCGAGGCAGG + Intergenic
1120744798 14:88143623-88143645 CACACCCAGGTGCCCAAGCTGGG - Intergenic
1121217237 14:92257996-92258018 CACACTCAGGAGGCAAAGGTGGG + Intergenic
1122615571 14:103015651-103015673 CACATGGAGGTGGCAAATGCAGG + Intronic
1123494603 15:20813512-20813534 CACACAGTGGTGGCAAAGGCAGG - Intergenic
1123551098 15:21382605-21382627 CACACAGTGGTGGCAAAGGCAGG - Intergenic
1125450361 15:39801196-39801218 CAGACAAAGGTGCCCAAGGTAGG - Exonic
1125744820 15:41990955-41990977 CACACTGGGGTGACCAGGGTTGG - Intronic
1126947645 15:53841303-53841325 CACTGGGAGATGGCAAAGGTAGG - Intergenic
1127415494 15:58753067-58753089 CACTTTGAGGGGGCCAAGGTGGG - Intergenic
1127641449 15:60919404-60919426 CACTCGGAGGTGGCCTGTGTGGG - Intronic
1128159976 15:65417215-65417237 GTAAGGGAGGTGGCCAAGGTTGG - Intronic
1128260538 15:66229792-66229814 GACACAGAGCTGGCCAAGATGGG + Intronic
1128374960 15:67067564-67067586 CCCAAGCAGGTGGCCAAGGATGG - Intronic
1128720041 15:69941501-69941523 CGCCCGGAGGTGGCCACGGAGGG + Intergenic
1202959440 15_KI270727v1_random:109848-109870 CACACAGTGGTGGCAAAGGCAGG - Intergenic
1132996381 16:2825654-2825676 GCCACGGAGGTGGACAGGGTCGG + Intronic
1133041071 16:3059896-3059918 CCCAGGGAGGTGCCCAAGTTGGG - Exonic
1133254650 16:4509226-4509248 CACACGTAGGAGGATAAGGTGGG + Intronic
1134091716 16:11395114-11395136 CACACGGAGTTGGCCCTGGATGG + Intronic
1135221731 16:20620598-20620620 CACACTGTGGGGGCCGAGGTGGG - Intronic
1138928731 16:61625374-61625396 CACACTGAGATGACAAAGGTTGG - Intergenic
1139405320 16:66713129-66713151 GACAAGGAGGTGAACAAGGTAGG - Intergenic
1139511320 16:67430127-67430149 GACACGGGGGTGGGCAGGGTGGG + Intergenic
1139653919 16:68376223-68376245 CTCAGAGAGGTGGCCAAGGCAGG + Intronic
1141607810 16:85165177-85165199 CACAAGGATGTGGACATGGTTGG - Intergenic
1141981104 16:87550970-87550992 CACACGGAGGTGGAGGAGGCGGG - Intergenic
1142668683 17:1477389-1477411 CACAAGGAGGTGACCAGGGACGG - Intronic
1143010738 17:3864990-3865012 CACACAGAGCAGGCCAGGGTGGG + Intronic
1143043827 17:4060435-4060457 CACACTTAGGAGGCCAAGGCGGG + Intronic
1143363149 17:6387728-6387750 CACAGTGAGGTGACCATGGTGGG + Intergenic
1143745968 17:8994417-8994439 CACACGGGGGAGCCCAGGGTTGG + Intergenic
1145306208 17:21676666-21676688 CACTCGGAGGGGGCCCAGATTGG - Intergenic
1145306888 17:21680299-21680321 CACTTGGAGGTGGCCAAAATCGG - Intergenic
1145307115 17:21681464-21681486 CACTTGGAGGTGGCCAAAATCGG - Intergenic
1145307568 17:21683794-21683816 CACTTGGAGGTGGCCAAAATCGG - Intergenic
1145370086 17:22300610-22300632 CACCTGGAGGGGTCCAAGGTCGG + Intergenic
1145385863 17:22411190-22411212 CACCCGGAGGGGTCCAAAGTCGG + Intergenic
1145901074 17:28490885-28490907 CAGAAGGAGGTGACCAAGCTTGG + Exonic
1148257237 17:46145973-46145995 CACTTTGAGGGGGCCAAGGTGGG - Intronic
1151619582 17:75237760-75237782 CCCAGGGAGGTGGCCCAGGAAGG - Exonic
1152032409 17:77852654-77852676 CAGGCAGAGGTGGCGAAGGTGGG - Intergenic
1152805808 17:82355535-82355557 CACACGGTGGTGGCCAGGGGTGG - Intergenic
1154239109 18:12635998-12636020 CTCACTCAGGAGGCCAAGGTGGG - Intronic
1154325633 18:13388810-13388832 CGCACGGAAGCGGCCGAGGTTGG - Intronic
1154452000 18:14486029-14486051 CACACAGTGGTGGCAAAGGCAGG - Intergenic
1155201056 18:23518089-23518111 GACAAGGAGGAGACCAAGGTGGG - Intronic
1156393473 18:36675165-36675187 TGCACGGAGGTGGCCATGGAGGG - Intronic
1157556090 18:48613734-48613756 GACACAGATGTGGCCAAGCTTGG + Intronic
1158567551 18:58568035-58568057 CCCAGGGAGGTGGCCCAGGCTGG - Intronic
1160454970 18:78993549-78993571 CCCACGGACGTGGGCACGGTGGG - Exonic
1160506894 18:79432364-79432386 CACACGGAGGTGAGGACGGTCGG + Intronic
1161316382 19:3619469-3619491 GACCCGGAGGTGGGCCAGGTGGG + Intronic
1162422727 19:10574982-10575004 CACACTGGGGAGGCCAAAGTGGG + Exonic
1162562741 19:11426868-11426890 CACACGGAGGTGGCCAAGGTAGG - Exonic
1163110750 19:15159912-15159934 CAAAGGGAGATGGCCAAGGGTGG + Exonic
1163516948 19:17770560-17770582 CAGAAGGAGATGGACAAGGTGGG + Exonic
1163832782 19:19554960-19554982 CCCAGGTAGGTGGTCAAGGTGGG + Intergenic
1164156781 19:22602058-22602080 CAGAGGGAGGGGGCAAAGGTGGG - Intergenic
1164747447 19:30626843-30626865 AACACCGAGGTGGCCGGGGTGGG - Intronic
1166532972 19:43553477-43553499 CACACGGAACTGGCCAAGCTTGG + Exonic
1166791296 19:45400252-45400274 AACAGGGAGGTGGCCAGGGGTGG + Intronic
1167253038 19:48411044-48411066 CACATGGAGTTGGTCAAGGCTGG + Intronic
1167375454 19:49108513-49108535 CAAACTCAAGTGGCCAAGGTTGG - Intronic
1168649923 19:58086388-58086410 AACAGGGAGGTGGCCTTGGTGGG - Intronic
925306371 2:2850264-2850286 CACACGGGGGTGGGAAAGGCCGG - Intergenic
925757210 2:7145031-7145053 CACACGGTGGTGGGCAAGACAGG - Intergenic
926745469 2:16153374-16153396 CACACAGAAGTGGCCCAGGTAGG - Intergenic
928339680 2:30431719-30431741 AACACTTAGGAGGCCAAGGTGGG + Intergenic
928735016 2:34278324-34278346 CACACAGAGGGGGCCAGTGTGGG - Intergenic
931455462 2:62406693-62406715 CACCCAGAGGTGGCAGAGGTTGG + Intergenic
931976228 2:67646880-67646902 GACAAGGAAGTGGCCACGGTGGG - Intergenic
931984970 2:67732855-67732877 CAAAGGTAGGTGGCCAAGATTGG - Intergenic
933846753 2:86332937-86332959 GACAGGGAGCTGGCCCAGGTGGG + Intronic
936092796 2:109511860-109511882 CACACCCAGGAGGCCGAGGTGGG + Intergenic
937640634 2:124206839-124206861 TACAGGGAGATGACCAAGGTAGG + Intronic
937908345 2:127063566-127063588 CACAAGGAGATGAGCAAGGTAGG - Exonic
941653520 2:168119061-168119083 CACAGGGAGGAGGGCAAGGGTGG - Intronic
943960595 2:194257587-194257609 CACAGTGAGGAGGCCGAGGTGGG + Intergenic
944870166 2:203902823-203902845 CACACTGGGGGGGCCAAGGTGGG + Intergenic
945038377 2:205723874-205723896 GACATGGCGGTGGCCAAGGATGG + Exonic
947416537 2:229902135-229902157 CACTCTGAGGGGGCCAAGGCAGG + Intronic
947526209 2:230878236-230878258 TACAGGGAGGTGGGCAGGGTTGG - Exonic
947701518 2:232238371-232238393 CAGAGGGAGGTGGCCAAGGAAGG + Intronic
948897458 2:240934067-240934089 CACGGGGTGGTGGCCCAGGTGGG - Intronic
1169235889 20:3929617-3929639 CACTTGGAACTGGCCAAGGTAGG + Intronic
1169592830 20:7164049-7164071 CACATGGAAGCTGCCAAGGTTGG - Intergenic
1171531452 20:25856127-25856149 CACTCGGAGGGGGCCAAAATCGG - Intronic
1171949116 20:31405338-31405360 CCCAAGGAGCTGGCCAAGGAGGG - Intronic
1172380444 20:34486042-34486064 CACTCTGAGGTTGCCCAGGTTGG + Intronic
1174407922 20:50314093-50314115 GACACGGAGGTGTCCAGGCTCGG - Intergenic
1176822192 21:13667310-13667332 CACACAGTGGTGGCAAAGGCAGG + Intergenic
1178766994 21:35463720-35463742 TAGACGGAGGTGCCCAGGGTAGG + Intronic
1181694100 22:24584483-24584505 CAAAAGGAGATGGCCAAGGAGGG - Intronic
1181891183 22:26065022-26065044 CACACGCTGGTGGCCAAAGCGGG - Intergenic
1182019090 22:27065880-27065902 CACAAGGGCGTGGCCAAGGTAGG + Intergenic
1184706897 22:46220694-46220716 CACTCTGGGGAGGCCAAGGTGGG + Intronic
950880405 3:16318262-16318284 CACAAGGAAGTGGCCATGGTGGG - Intronic
952154531 3:30628419-30628441 AGCACAGAGGTGACCAAGGTGGG - Intronic
952397077 3:32930506-32930528 CACATGGAGGTTGCCAAGGGTGG - Intergenic
957392586 3:79596364-79596386 CACAAGGAAGTAGCCAAAGTGGG + Intronic
961154354 3:124666258-124666280 AACAGGAAAGTGGCCAAGGTCGG + Intronic
968712417 4:2128528-2128550 GGCACGGAGGTGGCAAAGGAGGG + Intronic
968764176 4:2459486-2459508 CTCCTGGGGGTGGCCAAGGTGGG + Intronic
969738455 4:9006654-9006676 CACACTTTGGAGGCCAAGGTGGG - Intergenic
974027966 4:56750743-56750765 CACACTGAGTTTGCCAAAGTGGG + Intergenic
974147724 4:57967413-57967435 CACAGGGAGGTGGCTAAGGCTGG - Intergenic
979824918 4:125221002-125221024 TACACGGAAGCTGCCAAGGTTGG - Intergenic
983561590 4:169107038-169107060 CACCAGGAGGTGGCCATGGCAGG - Exonic
984047223 4:174815616-174815638 CACATGGAAGTTGCCAAGGCTGG + Intronic
986258722 5:6123983-6124005 CACATGGAAGCTGCCAAGGTTGG + Intergenic
987097933 5:14566486-14566508 CACATGGAGGCTGTCAAGGTTGG + Intergenic
988526797 5:31994251-31994273 CACTTTGAGGAGGCCAAGGTGGG - Intronic
990788984 5:59455386-59455408 CACATGGAAGTTGCCAAGCTTGG - Intronic
991940823 5:71850429-71850451 CACATGGAAGTGGCCAAGGCTGG + Intergenic
993019936 5:82579676-82579698 CACACTTGGGAGGCCAAGGTGGG - Intergenic
1000070605 5:157737243-157737265 CACTCTGAGGAGGCCAAGGTAGG + Intronic
1001139580 5:169133351-169133373 CATGGGGAGGTGGCAAAGGTGGG - Intronic
1001315112 5:170636410-170636432 CACAGGGGGGTGGCCGAGGAGGG + Intronic
1001559499 5:172659929-172659951 CACAGGGTGGTGGCCAGGGAGGG - Intronic
1002210034 5:177593107-177593129 CAGACGGAGGTTGCCCAGGCCGG - Intronic
1002346414 5:178550804-178550826 GGCACGGAGTTGGCCAAGCTGGG + Intronic
1006632061 6:35436733-35436755 CAGACGGCAGTGGCCATGGTGGG + Intergenic
1007957304 6:45929524-45929546 CACACAGGGGTTGCCAAGGAAGG + Intronic
1009047090 6:58245910-58245932 CACACGGGGGTGTACACGGTGGG - Intergenic
1010584637 6:77642935-77642957 CAAAGGGAGGTGGGCAAGGGTGG + Intergenic
1011723414 6:90183152-90183174 CACACTGAGGAGGTAAAGGTTGG - Intronic
1012749560 6:103140486-103140508 CACAGGAGGGAGGCCAAGGTGGG - Intergenic
1012868379 6:104644809-104644831 GACACGGAGGTAGCAAGGGTAGG - Intergenic
1012889889 6:104885807-104885829 CACAAGAGGGAGGCCAAGGTGGG + Intergenic
1018047309 6:159977323-159977345 CACAAGGAGGCAGCCAAGGTCGG - Intronic
1018645542 6:165944407-165944429 GACAGGGAGGTGGACATGGTGGG + Intronic
1019978775 7:4605753-4605775 CTCACGGAACAGGCCAAGGTGGG + Intergenic
1020025744 7:4898651-4898673 CTTCAGGAGGTGGCCAAGGTGGG + Intergenic
1021033981 7:15774407-15774429 CACAGGGTGGGGGCCAGGGTAGG - Intergenic
1022042218 7:26591988-26592010 CACAGTGAGGTGGCCCAGGCAGG - Intergenic
1022468271 7:30665704-30665726 GACACAGAGGTGGCCACGGCTGG - Intronic
1023017540 7:35982721-35982743 CACCCGGAGGTGGCCAGCGCGGG - Intergenic
1026354289 7:69544039-69544061 CCCAAGGAGGTAGTCAAGGTAGG + Intergenic
1026392071 7:69912038-69912060 CACAAGAGGGAGGCCAAGGTAGG - Intronic
1026794011 7:73354283-73354305 CAGAGGGACGTGGCCAAGGGAGG + Intronic
1026872634 7:73862458-73862480 CACACTTAGGAGGCCGAGGTGGG + Intronic
1027388720 7:77683651-77683673 CACTCTGGGGAGGCCAAGGTGGG - Intergenic
1030021127 7:105276323-105276345 CACTTTGAGGGGGCCAAGGTGGG - Intronic
1030024779 7:105312881-105312903 CACTTGGGGGAGGCCAAGGTGGG - Intronic
1032268610 7:130384884-130384906 CACAGAGACGTGGCCAAGGCGGG - Intronic
1033594996 7:142852705-142852727 GACACTCAGGAGGCCAAGGTGGG - Intergenic
1034684354 7:152956974-152956996 CTCACAGGGGAGGCCAAGGTGGG + Intergenic
1034938079 7:155212547-155212569 CACACTTAGGTGGTGAAGGTGGG - Intergenic
1038369348 8:26972572-26972594 CACACGGCCGTAGGCAAGGTGGG + Intergenic
1038574834 8:28696026-28696048 CACACTTAGGTGGGTAAGGTGGG - Intronic
1042209033 8:66359360-66359382 CACATTGGGGAGGCCAAGGTGGG - Intergenic
1045935267 8:107671437-107671459 CAGAAGCAGGTGGCAAAGGTGGG + Intergenic
1049110406 8:140638819-140638841 CACTTTGAGGAGGCCAAGGTGGG - Intergenic
1049189481 8:141278972-141278994 CACAGGCTGGGGGCCAAGGTGGG - Intronic
1049316272 8:141970246-141970268 CACAGGGAGGAGGCCCTGGTGGG - Intergenic
1049762828 8:144338626-144338648 CGAACGGAGGAGGCCAAGGATGG - Intergenic
1051499249 9:17759120-17759142 CACAGGGAGGTGAGCAAGGAAGG - Intronic
1053483281 9:38432414-38432436 CTCAAGAAGGTGGCCCAGGTAGG + Intergenic
1054160098 9:61667495-61667517 CACACGAAGGGGGCCAAAATGGG + Intergenic
1054160693 9:61670518-61670540 CACTCGGAGGGGGCCAAAATCGG - Intergenic
1054160985 9:61671927-61671949 CACTCGGAGGGGGCCAAAATCGG - Intergenic
1054173048 9:61857625-61857647 CACTCGGAGGGGGCCAAAATCGG + Intergenic
1054447135 9:65382820-65382842 CACTCGGAGGGGGCCAAAATCGG + Intergenic
1054664494 9:67723156-67723178 CACTCGGAGGGGGCCAAAATCGG - Intergenic
1057880589 9:98790198-98790220 CACGCTGAGGTGGTCAGGGTTGG + Exonic
1059326591 9:113507525-113507547 TACACCGAGGTGGCCAAGCGCGG + Exonic
1060237997 9:121879605-121879627 CACACAGGGGTGGCAAAGGCAGG + Intronic
1060475782 9:123985494-123985516 CACACAGAGGTGCCCCAAGTAGG - Intergenic
1185631279 X:1517434-1517456 CACACAGAGGCGGACAAGGTTGG - Intronic
1187023165 X:15406063-15406085 CCCAAGGAGGTGGCCATGTTAGG + Intronic
1190875380 X:54456462-54456484 CACAGGTGGGTGGCCAAGGAAGG + Intronic
1191696580 X:63996587-63996609 CACGTGGAGGTTGCCAAGGCTGG - Intergenic
1195094046 X:101489235-101489257 CCCAGGGAAGTGGCCAAGATGGG + Exonic
1195722486 X:107879550-107879572 CACAGGGTGGTGGGCAGGGTGGG + Intronic
1196462804 X:115947424-115947446 CACAGGCAGGTGACCATGGTGGG - Intergenic
1197775981 X:130119059-130119081 AAGACGGAGGTGGCCAGGGACGG + Intergenic
1199134494 X:144234558-144234580 CACTCTGGGGGGGCCAAGGTGGG + Intergenic