ID: 1162567946

View in Genome Browser
Species Human (GRCh38)
Location 19:11454357-11454379
Sequence CAGGGTGAGCACTCTGGGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 274}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162567946_1162567957 -2 Left 1162567946 19:11454357-11454379 CCCACCCCAGAGTGCTCACCCTG 0: 1
1: 0
2: 1
3: 22
4: 274
Right 1162567957 19:11454378-11454400 TGTGGCTTCCGCAGGGACGTGGG 0: 1
1: 0
2: 0
3: 5
4: 114
1162567946_1162567953 -9 Left 1162567946 19:11454357-11454379 CCCACCCCAGAGTGCTCACCCTG 0: 1
1: 0
2: 1
3: 22
4: 274
Right 1162567953 19:11454371-11454393 CTCACCCTGTGGCTTCCGCAGGG 0: 1
1: 0
2: 0
3: 12
4: 347
1162567946_1162567960 17 Left 1162567946 19:11454357-11454379 CCCACCCCAGAGTGCTCACCCTG 0: 1
1: 0
2: 1
3: 22
4: 274
Right 1162567960 19:11454397-11454419 TGGGGCCCTCGCGTCGTCCGTGG 0: 1
1: 0
2: 0
3: 3
4: 36
1162567946_1162567962 19 Left 1162567946 19:11454357-11454379 CCCACCCCAGAGTGCTCACCCTG 0: 1
1: 0
2: 1
3: 22
4: 274
Right 1162567962 19:11454399-11454421 GGGCCCTCGCGTCGTCCGTGGGG 0: 1
1: 0
2: 0
3: 2
4: 28
1162567946_1162567956 -3 Left 1162567946 19:11454357-11454379 CCCACCCCAGAGTGCTCACCCTG 0: 1
1: 0
2: 1
3: 22
4: 274
Right 1162567956 19:11454377-11454399 CTGTGGCTTCCGCAGGGACGTGG 0: 1
1: 0
2: 0
3: 19
4: 284
1162567946_1162567952 -10 Left 1162567946 19:11454357-11454379 CCCACCCCAGAGTGCTCACCCTG 0: 1
1: 0
2: 1
3: 22
4: 274
Right 1162567952 19:11454370-11454392 GCTCACCCTGTGGCTTCCGCAGG 0: 1
1: 0
2: 0
3: 17
4: 456
1162567946_1162567958 -1 Left 1162567946 19:11454357-11454379 CCCACCCCAGAGTGCTCACCCTG 0: 1
1: 0
2: 1
3: 22
4: 274
Right 1162567958 19:11454379-11454401 GTGGCTTCCGCAGGGACGTGGGG 0: 1
1: 0
2: 1
3: 15
4: 153
1162567946_1162567961 18 Left 1162567946 19:11454357-11454379 CCCACCCCAGAGTGCTCACCCTG 0: 1
1: 0
2: 1
3: 22
4: 274
Right 1162567961 19:11454398-11454420 GGGGCCCTCGCGTCGTCCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162567946 Original CRISPR CAGGGTGAGCACTCTGGGGT GGG (reversed) Exonic
900407250 1:2498171-2498193 CAGGCTGAGAACTCTGAGGAGGG - Intronic
900917758 1:5650585-5650607 CTGGCTGAGCACTCTGTGATGGG - Intergenic
900930439 1:5733779-5733801 CAGGGTGAGCACTCGAGTTTGGG - Intergenic
901034156 1:6326259-6326281 AAGGGTGAGCCCTCGGGGGCAGG - Intronic
902660849 1:17902291-17902313 AAGGGTGAGTACTCTTGTGTAGG + Intergenic
902981594 1:20127231-20127253 TAAGGTCAGCACCCTGGGGTAGG + Intergenic
904028610 1:27520283-27520305 CAGACTGAGCCCTGTGGGGTTGG + Intergenic
904842205 1:33379659-33379681 GAGGGTGAGCACACTGAGGATGG - Intronic
906161150 1:43650027-43650049 TAGGCTGAGCACACTGAGGTCGG + Intergenic
906817986 1:48898984-48899006 CAGCGCAATCACTCTGGGGTCGG - Intronic
915089770 1:153416317-153416339 CCAGGTGAGGTCTCTGGGGTGGG + Intergenic
915095741 1:153460832-153460854 CCAGGTGAGGTCTCTGGGGTGGG - Intergenic
916448016 1:164891751-164891773 CAGGGTGAGCATCCTGGGACAGG - Intronic
916475193 1:165162391-165162413 CAGGGTGCAGTCTCTGGGGTTGG - Intergenic
917925369 1:179785165-179785187 CAGGGTGAGGAATGGGGGGTGGG - Intronic
919934105 1:202240417-202240439 CAAGGTGAGTGCTCTGGGGAGGG + Intronic
920291421 1:204925892-204925914 CAGGGTGAGGAAGCTGGGGTTGG + Intronic
920505614 1:206513362-206513384 CAAGGTGAGTATTCTTGGGTGGG + Intronic
1062855562 10:777945-777967 CAGGGGGAGGCCTGTGGGGTCGG - Intergenic
1064480099 10:15731782-15731804 TATTGTGTGCACTCTGGGGTGGG + Intergenic
1066415379 10:35216474-35216496 CAGGGTGAGCACTCTGTACACGG - Intergenic
1067544964 10:47186204-47186226 CATGGTGAGCACTCTGGCAGTGG - Intergenic
1068150200 10:53121662-53121684 CAGGGTGAGGACACTGAGGTTGG + Intergenic
1069719375 10:70539777-70539799 CAGGCTGAGGCCTCTGGGGAGGG + Intronic
1070461883 10:76678357-76678379 AAAGGTGAGCAGTCTGGAGTGGG + Intergenic
1070743549 10:78918641-78918663 AATCGTGAGCAATCTGGGGTGGG + Intergenic
1072220313 10:93321661-93321683 AAGGGTGAGCAGTCTAGGGTAGG - Intronic
1072607955 10:96999572-96999594 CTTGGTGAGCCCTCTGGGGAAGG + Exonic
1073559717 10:104486491-104486513 AAGGGTGAATACTCTGGGGCAGG + Intergenic
1076983104 11:215696-215718 CAGGGTGAGCCATCAGGGCTGGG + Exonic
1077132172 11:978572-978594 CAGGGAGCCCACCCTGGGGTTGG - Intronic
1078438460 11:11344746-11344768 CAGTGTGAGCACTATGTGGATGG + Intronic
1079869705 11:25781578-25781600 CAGTGTGATCAGCCTGGGGTGGG - Intergenic
1083306265 11:61763490-61763512 CATGGTCAGCATTCTGGGCTGGG + Intronic
1083778714 11:64907103-64907125 CAGGGTGGGCAGGCTGGCGTGGG + Intronic
1084091020 11:66879456-66879478 CAGGGTGAGTGCTCTGGGACAGG - Intronic
1084106711 11:66985293-66985315 CAGGCAGAGAACTCTGGGCTGGG - Intergenic
1088359613 11:108976891-108976913 CAGGGTGAGCCCTCAGGGCCTGG - Intergenic
1090513325 11:127398573-127398595 CAGGCTGATCTCTCTGGGATGGG - Intergenic
1091790207 12:3267877-3267899 CAGGGTGGGCACTCTACGTTGGG - Intronic
1091838530 12:3602819-3602841 CAGGATGAGGACTCCGGGGATGG - Intergenic
1092090739 12:5801881-5801903 CAGGGTTTGCACTCAGGGGAGGG - Intronic
1096476610 12:51912816-51912838 CTGGGAGAGCACTCAGGGCTGGG + Intronic
1098308488 12:69124782-69124804 CAGGGTAAGCACTCAGATGTGGG - Intergenic
1098695158 12:73543160-73543182 CATGGGGACCCCTCTGGGGTGGG + Intergenic
1098870761 12:75814491-75814513 CAGGGTGAAAATACTGGGGTAGG + Intergenic
1099395117 12:82129001-82129023 CAAGGTGAGAGATCTGGGGTTGG - Intergenic
1100137063 12:91566760-91566782 CACAGTGATCACGCTGGGGTAGG + Intergenic
1100740066 12:97581793-97581815 CAGCGTGGCCACTCTGTGGTAGG - Intergenic
1101984292 12:109433607-109433629 CAGGCAGAGCTCTCTGGAGTGGG - Intronic
1102042104 12:109807729-109807751 AAGGGTTAGCTCTCTGGGCTGGG + Intronic
1102650558 12:114439460-114439482 CAGGTTGAGCACCCTGGCTTCGG - Intergenic
1103122712 12:118394286-118394308 CAGAGTGAACACTCAGGGATTGG + Intronic
1103948086 12:124538151-124538173 CAGGCTGAGCTGGCTGGGGTTGG - Intronic
1104082849 12:125445933-125445955 CAGGGAGACAGCTCTGGGGTGGG + Intronic
1104933220 12:132351413-132351435 CAGGGTGAGCACACTGTCCTCGG + Intergenic
1106015225 13:25863120-25863142 CAGGGTGGGGTCTCTGGGGTGGG - Intronic
1108211263 13:48142072-48142094 CAGAGTGAGCAATGTGGGGGTGG + Intergenic
1111154890 13:84309603-84309625 CAGCATGAGGACCCTGGGGTTGG - Intergenic
1112369961 13:98785592-98785614 CAGGCTCAGCCCACTGGGGTGGG + Intergenic
1113542477 13:111119767-111119789 CAGTGTCAGGATTCTGGGGTTGG + Intronic
1119164468 14:72480733-72480755 CAGGCTGAGCTCTCTCAGGTGGG + Intronic
1119530783 14:75359699-75359721 AAAGCTCAGCACTCTGGGGTGGG + Intergenic
1121321334 14:92993361-92993383 CAGGGTGAGCCCTCAGGGACAGG + Intronic
1121743893 14:96273040-96273062 CAGGGAGAGGAGTCAGGGGTGGG - Intergenic
1122602572 14:102928972-102928994 CCGGGTGAGCACTGAGGGGAGGG + Exonic
1122816171 14:104315281-104315303 CAGGGGCAGGACTGTGGGGTCGG - Intergenic
1123804972 15:23861156-23861178 CGGGGTGCTCACACTGGGGTGGG + Intergenic
1124363277 15:29054247-29054269 CAGGGTGTGCACTGTGGGCCAGG - Exonic
1125892712 15:43278101-43278123 CTGGGTGAAAACCCTGGGGTAGG + Intronic
1128233108 15:66049044-66049066 CAGAGTGGGCATTCTGGGGGAGG + Intronic
1129182674 15:73886973-73886995 CAGGAGCAGCACTCTGGGGAAGG - Intronic
1129693639 15:77728344-77728366 CAGGGTGAGCTCTGGGGGTTGGG - Intronic
1130002625 15:80060089-80060111 CAGGGTGGTCGCGCTGGGGTCGG + Intronic
1130918383 15:88323872-88323894 CAGGGTGATAACTATGGGGCAGG + Intergenic
1131305863 15:91242612-91242634 CAGTGTGAAGACTCTGAGGTGGG + Intronic
1131308897 15:91269939-91269961 CAGAGTGACCACTCTAGGGATGG + Intronic
1131389341 15:92034336-92034358 CAGAGAGAGCAGGCTGGGGTGGG + Intronic
1132469170 16:92349-92371 CAGGGTGGGCTCTATGGGGAGGG + Intronic
1132718029 16:1301732-1301754 CAGGCTGAGGGCTCAGGGGTGGG - Intergenic
1133825240 16:9272606-9272628 CAGGGTGAGGAGGCTGCGGTGGG + Intergenic
1134269928 16:12724271-12724293 GAGGGTGAGCTCACTGGGGTAGG - Intronic
1135250753 16:20899881-20899903 CTGGGTGAGCGCTGTGAGGTAGG - Intronic
1135403795 16:22184046-22184068 CAGGGTCTGCCCCCTGGGGTGGG + Intronic
1136316046 16:29455181-29455203 CTTGGTGGGCACGCTGGGGTCGG + Intronic
1136430623 16:30194523-30194545 CTTGGTGGGCACGCTGGGGTCGG + Exonic
1137530111 16:49274073-49274095 GAGGGTGAGCCCTCCAGGGTGGG - Intergenic
1137560947 16:49502144-49502166 CAGCTTGAGACCTCTGGGGTTGG + Intronic
1139327337 16:66162721-66162743 AAGTGTTAGCTCTCTGGGGTTGG - Intergenic
1139683024 16:68580368-68580390 CAGGGATTGGACTCTGGGGTGGG + Intergenic
1141026110 16:80550224-80550246 CAGGGTGAGGACACTGGTGTAGG - Intronic
1141836046 16:86540323-86540345 GAGGGTCAGCACTGTGGGGGAGG - Intronic
1143357878 17:6344054-6344076 CAGGGTGGGGATGCTGGGGTGGG - Intergenic
1143471133 17:7176962-7176984 CAGGGTGAGGGCGCTGGGGCGGG - Exonic
1143755964 17:9067789-9067811 CAGGGTGAGGGCTCTGGGCTTGG + Intronic
1144872257 17:18378475-18378497 CTGGGTGAGAGCTCTGGGGAGGG - Intronic
1144951906 17:18998895-18998917 CAGGGTGAGCTCTGTGGCCTGGG - Intronic
1146306138 17:31731134-31731156 AAGCGTGTGCACTCTGGGGATGG + Intergenic
1146480852 17:33203748-33203770 TAGGGTGAGCACACTGGAGTGGG + Intronic
1146673258 17:34756467-34756489 CAGGCTCAGCACTGGGGGGTGGG - Intergenic
1147326867 17:39673835-39673857 CTGGGTGAGGACTCTGGGGTAGG - Intronic
1149237626 17:54611636-54611658 CAGAGGGAGCACCCTGGTGTGGG + Intergenic
1149913252 17:60585356-60585378 CAGGGGGAGGCCTCAGGGGTGGG + Intronic
1151163846 17:72187782-72187804 CAGGGTGAGCAGGCGGGGGAAGG - Intergenic
1151360108 17:73583714-73583736 CAGGGTGAGCACACGGGTGGTGG + Intronic
1151555035 17:74842554-74842576 CAGGGGCAGGACTCTGGGGCTGG - Exonic
1151749013 17:76026547-76026569 CTGGGTGAGAACTCTGGGGAGGG + Intronic
1151906200 17:77050931-77050953 CAGGGCGACCACTCTCGGCTGGG + Intergenic
1152610173 17:81311510-81311532 CTCGGTGAGCAGCCTGGGGTGGG + Exonic
1152633958 17:81422973-81422995 CAGGGAGGGGACTCTGGGTTGGG - Intronic
1153514119 18:5889629-5889651 TTGGGTGAGCACAGTGGGGTGGG + Exonic
1153773528 18:8433776-8433798 CGGGGGGAGCAAACTGGGGTTGG + Intergenic
1154343503 18:13523778-13523800 CAGGGAGAGCCCACTGGGGTCGG - Intronic
1155063482 18:22248744-22248766 CAGGGTGGGGCCTCTGGGCTCGG + Intergenic
1157522142 18:48352596-48352618 CAGGGTGAGCAGGCTGGAGGAGG + Intronic
1157607171 18:48933223-48933245 CAGGGTGGGCCCCCTGGGATGGG - Intronic
1158082940 18:53615728-53615750 CAGGGTAAGCAGGCTGTGGTTGG - Intergenic
1160952008 19:1672190-1672212 CAGGGTGGGCTCCGTGGGGTGGG - Intergenic
1161041849 19:2114634-2114656 CAGGGTGGGCAGGCTGGGGTGGG - Intronic
1161411001 19:4117400-4117422 GAAGGTGAGCACTGCGGGGTCGG - Exonic
1162567946 19:11454357-11454379 CAGGGTGAGCACTCTGGGGTGGG - Exonic
1163114485 19:15180845-15180867 CAGAGTCAGTACTGTGGGGTGGG + Intronic
1163115231 19:15185093-15185115 CAAGGTGGGGACCCTGGGGTTGG - Intronic
1163256839 19:16161103-16161125 CAGAGTGGGAACCCTGGGGTAGG + Intergenic
1163557330 19:18000165-18000187 CAGGGTGAGAACCCAGGGTTTGG + Intergenic
1163622488 19:18369258-18369280 GAGGGGGAGCAGTTTGGGGTGGG - Exonic
1164453383 19:28386029-28386051 TAGGGTCAGTTCTCTGGGGTTGG - Intergenic
1164594765 19:29525858-29525880 GAGGGGGAGCGCTCTGGGGCGGG + Intergenic
1165567924 19:36747859-36747881 CAGTGTGAACACTCTGATGTCGG + Exonic
1165727343 19:38122442-38122464 CAGGGTGAGGGCTCTGGGAGAGG - Intronic
1166040308 19:40198363-40198385 CAGGATCAGGACTGTGGGGTGGG - Exonic
1166228932 19:41414300-41414322 CAGGGTTAGGACTCTGGAGGGGG + Intronic
1166834834 19:45660973-45660995 CAGGATGAGGAGTCAGGGGTGGG - Intergenic
1166906712 19:46115564-46115586 CAGGCTGAGGTTTCTGGGGTTGG - Intergenic
1166939666 19:46355169-46355191 CAGGGAGCGAACTCTGAGGTGGG - Intronic
1167245026 19:48367976-48367998 CTGGATTAGCACTCTGGGGGTGG - Intronic
927808855 2:26171009-26171031 CAGGGTGAGCGGGCTGGGTTTGG + Intergenic
927990395 2:27443033-27443055 CAGGGTGAGCAGCCTGGGCCTGG - Intronic
928205466 2:29280393-29280415 CAGGTGGACCACTCTGGGATGGG + Intronic
929461634 2:42106185-42106207 CCGGATGTGCCCTCTGGGGTGGG + Intergenic
929691286 2:44076089-44076111 CAGGGTGAGCAGGCTGGGGAGGG + Intergenic
929905314 2:46040520-46040542 CTGGGGGAGCACTCTGGGGAAGG + Intronic
931177183 2:59865742-59865764 CAGGGTTAGCTGTCTGGGTTTGG + Intergenic
931517822 2:63059906-63059928 CAGGGTGAGGGCGCTGGCGTTGG + Intergenic
934912495 2:98272382-98272404 CAGGGAGAGCACTCAGGGAAAGG - Intronic
935677708 2:105609892-105609914 CAGGGGGTGCACTTTGGGGGAGG + Intergenic
936257954 2:110933693-110933715 CTGGGGGAGCACTGTGGGGCGGG + Intronic
936514166 2:113171267-113171289 AAGGGTGAGCACACTGCCGTGGG - Intronic
936600334 2:113889525-113889547 CAGGGTGAGCAGTCGGGGAACGG - Intergenic
937078933 2:119126650-119126672 CACGGTGAGCACCCTGGGCATGG + Intergenic
937418345 2:121735265-121735287 AAAGGTGAGGACTCTGGAGTTGG - Intronic
937911273 2:127076824-127076846 CTGGGTGGGCACCCTGGGCTGGG - Intronic
938370939 2:130768017-130768039 CAGGCTGAGCACCCAGGGGGAGG + Exonic
938900760 2:135796912-135796934 CAGGGTGTGCATTGTGAGGTGGG + Intronic
940900263 2:159120295-159120317 CAGGGTGGGCACTGTGGGATAGG + Intronic
941641054 2:167988973-167988995 GGGGGTGAGCACTCTGGTCTGGG - Intronic
946894929 2:224313956-224313978 CAGGATCAGGACTCTGGGGAAGG - Intergenic
1170251482 20:14288526-14288548 CAGGGTGATCACACTTGGGCAGG - Intronic
1170605655 20:17873705-17873727 CAGGGAGAGCACTGGGGGCTGGG - Intergenic
1171411226 20:24950044-24950066 GAGGGTCAGCACTCAGGGGGAGG + Intronic
1172813594 20:37669286-37669308 CAGGCTGAGCACTCAGTGGATGG + Intergenic
1174365548 20:50054252-50054274 CAAGGTGTGGGCTCTGGGGTTGG - Intergenic
1174962766 20:55176724-55176746 CTGGGTGAGTCCTCTGGGGCAGG - Intergenic
1175246090 20:57582963-57582985 CAGGCTGAGGGGTCTGGGGTGGG + Intergenic
1175495681 20:59412606-59412628 CAGGGAGAGGAATTTGGGGTCGG - Intergenic
1176025673 20:62984357-62984379 CAGGGTGGGCATTCTTGGGGAGG - Intergenic
1176052928 20:63130106-63130128 TAGAGTGAGCCCTCCGGGGTGGG - Intergenic
1176425131 21:6544044-6544066 CAGGAAGAGCTCTCTGAGGTGGG + Intergenic
1179700622 21:43152361-43152383 CAGGAAGAGCTCTCTGAGGTGGG + Intergenic
1179823849 21:43952854-43952876 CAGGGTGGGACCTCAGGGGTGGG - Intronic
1179874947 21:44262647-44262669 GAGGGTGGGCACTCCGGGGCAGG + Intergenic
1180083840 21:45498540-45498562 CTGGGGCTGCACTCTGGGGTGGG + Intronic
1181040107 22:20188048-20188070 CGGCACGAGCACTCTGGGGTCGG + Intergenic
1181274669 22:21681024-21681046 CATGGTGATCACCCAGGGGTGGG + Intronic
1181287234 22:21762175-21762197 GAGCGTGAGCACCCTGGGCTGGG + Exonic
1182524197 22:30905669-30905691 CCGGGTGGGCTCACTGGGGTGGG + Intronic
1182977865 22:34640371-34640393 CAGGCTGAGGACTCGGGGGCAGG + Intergenic
1183548604 22:38468415-38468437 CAGGGTGGGGACTCCGGCGTGGG + Intronic
1183707569 22:39483846-39483868 CAGGTAGAACAATCTGGGGTAGG - Intronic
1183933265 22:41248164-41248186 CAGGGAGAGCACACTGTGCTGGG + Intronic
1184029888 22:41886339-41886361 CAGGGTGGGCTTTCTGGGGAAGG + Intronic
1184038851 22:41931761-41931783 AAGTGAGAGCACTCTGGGGATGG + Intergenic
1184099724 22:42335799-42335821 CAGGGTGCCAGCTCTGGGGTGGG + Intronic
1184510543 22:44930716-44930738 CAGGCAGAGCACTCTGGGGCAGG + Intronic
1184652554 22:45925798-45925820 GAGGGTGAGCAGCCCGGGGTGGG - Intronic
1185046976 22:48533399-48533421 CAGGGTGAGGACTCCAGGGCAGG + Intronic
1185049044 22:48544145-48544167 TGGGGTGTGCACCCTGGGGTGGG + Intronic
950250641 3:11462500-11462522 CAGCGTGAACACTTTAGGGTTGG + Intronic
950863712 3:16172444-16172466 CAGGGTGACAGCCCTGGGGTGGG + Intergenic
950936623 3:16845766-16845788 CAGGGTAAGCAATTTGGGGCCGG + Intronic
951080512 3:18445390-18445412 CAGGGGGCGCACACGGGGGTTGG + Intronic
954214243 3:49115705-49115727 CTCGGTGAGAATTCTGGGGTGGG - Exonic
954329325 3:49881121-49881143 CAGGCTGAGGGCTGTGGGGTGGG + Intergenic
954689005 3:52385986-52386008 CATGGTGAGCACTCAGGAGGTGG + Intronic
954796924 3:53166187-53166209 CAGGGCCTTCACTCTGGGGTAGG + Intronic
961513906 3:127421027-127421049 CAGGGTGAGTACTCTGTTGGAGG - Intergenic
961866727 3:129958790-129958812 CAGACAGAGCACTGTGGGGTGGG + Intergenic
967818313 3:193817169-193817191 CAGAGTGAGCGCGCTGGGGCTGG + Intergenic
968182837 3:196609933-196609955 CAGTGTGATGCCTCTGGGGTAGG - Intergenic
968189830 3:196659813-196659835 CAGGGTGAGCATCCGGGCGTGGG - Exonic
968478547 4:824162-824184 GAGGGTGCACACTCTGGCGTAGG - Intronic
969187574 4:5488335-5488357 AATGGTGAGCACTCTGGACTTGG + Intronic
969196178 4:5565761-5565783 AATGGTGAACACTCTGGGGATGG - Intronic
969364386 4:6685730-6685752 CAAGGTCAACACCCTGGGGTGGG - Intergenic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
980252328 4:130334266-130334288 CAGGGTTAGCAATTTGGGCTGGG + Intergenic
982577121 4:157127393-157127415 CAGGGTTTGCACTCTGTTGTTGG + Intronic
984681733 4:182618927-182618949 CAGGTTGACTACTCGGGGGTGGG + Intronic
985169048 4:187128627-187128649 CAGGGTTAGCACTCTCTGGCTGG - Intergenic
985578759 5:685737-685759 CAGCGTGGCCACTCTGGGGACGG + Intronic
986686103 5:10276337-10276359 CAGGGTTAGCACTCCTGGGGAGG + Intronic
986731163 5:10636026-10636048 CAAGGACATCACTCTGGGGTCGG - Intronic
987004434 5:13695339-13695361 CAGGGAGAGCCCTCTGCGGATGG - Intronic
989120282 5:37998066-37998088 CAGGGGGAGCACCTTTGGGTTGG - Intergenic
990489384 5:56289201-56289223 TAGGGTAAGAACTCTGGAGTAGG - Intergenic
991956799 5:72002753-72002775 GAAGATGTGCACTCTGGGGTAGG + Intergenic
996700302 5:126444159-126444181 CAGGTGGAGCACACTGTGGTAGG + Intronic
997309354 5:132866774-132866796 CAGGGGCAGGAGTCTGGGGTTGG + Intronic
997352411 5:133240448-133240470 CAGTGTGAGCAACCTGGAGTGGG + Intronic
997376815 5:133403417-133403439 CAGGGCAGGCACTTTGGGGTAGG - Intronic
999242411 5:150135658-150135680 CAGTGTGAGCACGCTGGAGAAGG + Exonic
1000121139 5:158198912-158198934 CAGTGTGAGCTGTCGGGGGTGGG + Intergenic
1000521507 5:162300111-162300133 CAGTGTGGGGACTCTGCGGTGGG + Intergenic
1000651388 5:163822479-163822501 CAAGCTGTGCACCCTGGGGTTGG + Intergenic
1001934018 5:175691945-175691967 CAGGCTGTGCACCCTGGGGCCGG - Intergenic
1005989286 6:30893160-30893182 TTGGGTGAGCAATCTTGGGTGGG + Exonic
1006047243 6:31308286-31308308 CGGGCTGGTCACTCTGGGGTCGG + Intronic
1008370473 6:50724803-50724825 CAGGGTGTGAACTGCGGGGTAGG - Intronic
1010013362 6:71075435-71075457 CATGGTGACCCCTCTGGGATGGG + Intergenic
1011614618 6:89186448-89186470 CAGGAGGGGCACTCTGGGGCAGG - Intronic
1012872443 6:104688048-104688070 AAGAGGGAGGACTCTGGGGTGGG - Intergenic
1013409778 6:109873473-109873495 GAGGCTGAGCACTGTGGGGTTGG + Intergenic
1016445171 6:144124603-144124625 TAGGGTGATCATTCTGGGGAAGG + Intergenic
1016867131 6:148778591-148778613 CAGGCAGGGCACTCTGGTGTGGG + Intronic
1017285006 6:152664240-152664262 CAAGGTGAGAATTCTGGTGTGGG - Intergenic
1019176781 6:170163466-170163488 CAGGGAAAGCACTGTGGGGACGG + Intergenic
1019224695 6:170500284-170500306 CAGAGTGGGCTCTCTGGGGTGGG + Intergenic
1019345286 7:526734-526756 CAGGGGAAGCGCTCTGGGGTTGG - Intergenic
1019907219 7:4073947-4073969 TAGGCTGAGCACTATGGGGTGGG + Intronic
1021698255 7:23294061-23294083 CAGGGAGAGCAGCCTGGGGTGGG - Intergenic
1024570321 7:50717924-50717946 CATGTTGAGCAGTCTGGAGTGGG - Intronic
1025231336 7:57204970-57204992 CAGGGTGAGCTTTCTGCGGGAGG - Intergenic
1026844998 7:73693774-73693796 CAGGGTCTGCACTCTGGGGCTGG - Intronic
1026872112 7:73859205-73859227 AAGGCAGAGGACTCTGGGGTAGG - Intergenic
1027216523 7:76187293-76187315 CAGGAGAAGCACTTTGGGGTAGG - Intergenic
1029125692 7:98293861-98293883 CATGGGGGTCACTCTGGGGTGGG + Intronic
1029191575 7:98775896-98775918 CAGGAAGAGCCCACTGGGGTGGG - Intergenic
1029421973 7:100476601-100476623 GAGGGTGACCACTGTGGAGTGGG - Intronic
1029952691 7:104603832-104603854 CATGCTGGGCACACTGGGGTGGG + Intronic
1030086524 7:105820369-105820391 AAGAGTGAGCACTGTGGGATGGG + Intronic
1032020833 7:128406316-128406338 CTGGGGGAGAACTCGGGGGTGGG - Intronic
1032166973 7:129553088-129553110 GATGGTGAGGGCTCTGGGGTGGG - Intergenic
1032287833 7:130556019-130556041 GAGTGTGAGCATTTTGGGGTGGG + Intronic
1033304992 7:140218687-140218709 CAGAGATAGGACTCTGGGGTGGG + Intergenic
1034139720 7:148804282-148804304 CAATGTGAGTACTCTGGGGCTGG - Intergenic
1034489864 7:151387423-151387445 CAGGCTGAGGACCCTGGGGCTGG - Intronic
1034622740 7:152468843-152468865 GAGGTTGAGGACTCTGTGGTTGG + Intergenic
1035727409 8:1833589-1833611 CATGGTGAGCATCCTGGGGGTGG - Intronic
1035949300 8:4001504-4001526 CAGGGTTGGTACTCAGGGGTGGG - Intronic
1040652142 8:49461012-49461034 CAGGCTTGGCACTCTGGGGGTGG - Intergenic
1041563358 8:59246491-59246513 AAGGGTGAGCATACTGGGATGGG + Intergenic
1045296015 8:100872172-100872194 GAGGGTGAGCGCTCTGGAGAAGG - Intergenic
1045472204 8:102522507-102522529 CCAGGTGAGCACTCTCAGGTGGG + Intergenic
1047496059 8:125409773-125409795 GAGAGTCAGCATTCTGGGGTGGG - Intergenic
1047623198 8:126629652-126629674 AAGTGAGAGCACGCTGGGGTTGG + Intergenic
1048334660 8:133493429-133493451 CTGGCTGAGCATCCTGGGGTGGG + Intronic
1049310956 8:141933613-141933635 TGGGGTGAGCTCTCTTGGGTGGG + Intergenic
1049614967 8:143572075-143572097 CAGGGTGAGCACTGTCGCCTGGG + Exonic
1050574570 9:6979958-6979980 TAGGATGAGAACTCTGTGGTGGG + Intronic
1053414365 9:37937800-37937822 AAGGGTGATAACCCTGGGGTGGG + Intronic
1054450602 9:65401786-65401808 CATTGAAAGCACTCTGGGGTGGG - Intergenic
1054715227 9:68550808-68550830 CAGGGTGGGTACGCTGGGGATGG + Intergenic
1057354964 9:94325260-94325282 CAGTGTCAGGACTCTGGGGAAGG + Exonic
1057652788 9:96932374-96932396 CAGTGTCAGGACTCTGGGGAAGG - Exonic
1057939801 9:99271976-99271998 CAGGGTGGGCACTGTGGGAGGGG + Intergenic
1059822342 9:117987076-117987098 CAGGGTTTGTACTCTGGTGTTGG - Intergenic
1060985829 9:127818469-127818491 CACTGTGAGGACTCAGGGGTGGG - Intronic
1061216632 9:129225459-129225481 CAGGGTGAGCACTCTGCTTGTGG - Intergenic
1061222521 9:129260396-129260418 CACTGAGAGCCCTCTGGGGTGGG + Intergenic
1061290925 9:129649865-129649887 CAAGGTCAGAGCTCTGGGGTGGG + Intergenic
1061787664 9:133040096-133040118 CAGTGTGAGCACTTTGGGAAGGG + Intronic
1062000291 9:134212462-134212484 GAGGATGTGCCCTCTGGGGTGGG + Intergenic
1062053473 9:134458863-134458885 CAGGGTGAGGGCTCTGGGTGAGG + Intergenic
1062284310 9:135766293-135766315 CAGGGTGGACCATCTGGGGTGGG + Intronic
1062313380 9:135952196-135952218 CAGGAAGAGCACCCTGGGCTTGG - Intronic
1062702435 9:137914346-137914368 CAGGGTATGAAGTCTGGGGTGGG - Intronic
1188440958 X:30215185-30215207 CAAGGTGAGGACTCTGAGGGCGG + Intergenic
1189921754 X:45909335-45909357 CAAGGTGAGCAGTTTAGGGTTGG + Intergenic
1190249096 X:48708672-48708694 CAGGGTGAGCACAAAGGGCTGGG - Exonic
1194069683 X:89305882-89305904 CATGCTGAGCCCTCTGGGTTAGG - Intergenic
1195565130 X:106331624-106331646 CAGGGTGAACAGTTTAGGGTCGG + Intergenic
1196270462 X:113704552-113704574 CAGGGTGAACAGTTTGGGGTTGG + Intergenic
1199296529 X:146165274-146165296 CAGGGTGTGGAGTCTGGGTTTGG - Intergenic
1200723830 Y:6640023-6640045 CATGCTGAGCCCTCTGGGTTAGG - Intergenic
1202119361 Y:21508242-21508264 CCAGGTGAGCAGTCTGGGGCTGG - Intergenic
1202121813 Y:21531782-21531804 CCAGGTGAGCAGTCTGGGGCTGG - Intronic
1202157193 Y:21897600-21897622 CCAGGTGAGCAGTCTGGGGCTGG + Intronic
1202159639 Y:21921141-21921163 CCAGGTGAGCAGTCTGGGGCTGG + Intergenic