ID: 1162568555

View in Genome Browser
Species Human (GRCh38)
Location 19:11457600-11457622
Sequence GTCTCTGCTCTGTTTGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 198}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162568546_1162568555 20 Left 1162568546 19:11457557-11457579 CCTTGGAGTGGCTATGAGCTTGG 0: 1
1: 0
2: 0
3: 18
4: 177
Right 1162568555 19:11457600-11457622 GTCTCTGCTCTGTTTGGGCCAGG 0: 1
1: 0
2: 0
3: 25
4: 198
1162568551_1162568555 -6 Left 1162568551 19:11457583-11457605 CCAGGTCCTGGGTTTGAGTCTCT 0: 1
1: 0
2: 1
3: 25
4: 213
Right 1162568555 19:11457600-11457622 GTCTCTGCTCTGTTTGGGCCAGG 0: 1
1: 0
2: 0
3: 25
4: 198
1162568545_1162568555 21 Left 1162568545 19:11457556-11457578 CCCTTGGAGTGGCTATGAGCTTG 0: 1
1: 0
2: 1
3: 13
4: 102
Right 1162568555 19:11457600-11457622 GTCTCTGCTCTGTTTGGGCCAGG 0: 1
1: 0
2: 0
3: 25
4: 198
1162568544_1162568555 22 Left 1162568544 19:11457555-11457577 CCCCTTGGAGTGGCTATGAGCTT 0: 1
1: 0
2: 1
3: 10
4: 112
Right 1162568555 19:11457600-11457622 GTCTCTGCTCTGTTTGGGCCAGG 0: 1
1: 0
2: 0
3: 25
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162568555 Original CRISPR GTCTCTGCTCTGTTTGGGCC AGG Intronic
900425866 1:2578319-2578341 GTCACTGCTCTTTCTGTGCCTGG - Intergenic
900690631 1:3978280-3978302 GTCTCTGCTCTTGGTGGGGCGGG + Intergenic
901244869 1:7721902-7721924 GTCCCTCCTCTGTCTGGGCGTGG - Intronic
902235168 1:15052881-15052903 GTCTCATCTCTGTCTGGGCCTGG - Intronic
902331503 1:15733164-15733186 GTGTCTGCTCAGTCTGGGGCTGG - Intronic
902774890 1:18668282-18668304 GTGCCTGCTTTGTGTGGGCCAGG - Intronic
903183610 1:21617659-21617681 GTCTCGGCGCTGTCTGGGTCTGG - Intronic
908249990 1:62257892-62257914 GTCTCTTCTCTGTCCTGGCCTGG + Intronic
912887640 1:113492035-113492057 GTCTCTGCTAGGTTTTGGTCAGG - Intronic
913046025 1:115074124-115074146 TGCTCTGCTCTGTTTGGGCAGGG - Intronic
914444715 1:147740185-147740207 GTCTCTCCTTTCTGTGGGCCTGG - Intergenic
914927471 1:151900906-151900928 TTTTCTGCCCTGGTTGGGCCAGG - Intronic
915094071 1:153446706-153446728 GTGTCTGCTATGTTGGGGTCTGG - Intergenic
915147540 1:153803943-153803965 TCCTCTTCTCTGGTTGGGCCTGG + Intergenic
915364422 1:155306419-155306441 GTCTCTGCTCAGTGTGGGGATGG + Intergenic
915621667 1:157089928-157089950 GACTCTGCTGTGTCTCGGCCCGG + Intergenic
920512296 1:206560229-206560251 GTGGCTGCTCAGTTTGTGCCTGG + Intronic
922463202 1:225828660-225828682 GTCTCTGGGCTGTCAGGGCCGGG + Intronic
923334283 1:232953282-232953304 CTTTCTGATCTGTTTGTGCCTGG + Intronic
924002301 1:239567837-239567859 GAGACTGCTCTGTTTGGGCATGG + Intronic
1062830116 10:599885-599907 GTCTCTGCTCAGTGTGGGACAGG + Intronic
1062979200 10:1707861-1707883 GACTCTGCTGTGTGTGGACCGGG - Intronic
1071418785 10:85467536-85467558 GTCTCTGCCCAGTTTGTGTCAGG - Intergenic
1071531081 10:86390725-86390747 GTCTATGTTGGGTTTGGGCCTGG + Intergenic
1073239364 10:102045575-102045597 GTTTATGCTCTGTTTAGGCACGG - Intronic
1076130236 10:128008933-128008955 GTCTCTGGTCTGGCTGGGGCTGG + Intronic
1076310491 10:129502880-129502902 TTTTATGCTCTGTTTGGGTCCGG - Intronic
1076848286 10:133080647-133080669 GTCCCTGCTCTGTCAGGGCTGGG - Intronic
1076980159 11:199869-199891 GTCTCTGCCCTGGCTGGGGCTGG - Intronic
1077176305 11:1192613-1192635 GTCTCTGCTCTTTGTGGCACAGG + Intronic
1077383801 11:2259698-2259720 GTCCCAGCTCTGTGTGGGCCTGG + Intergenic
1077863083 11:6200122-6200144 GTCTCTGATCTGCTTGGTGCGGG - Exonic
1080090581 11:28343505-28343527 GACTCAGCACTGTTTGGGCCTGG + Intergenic
1083308119 11:61771399-61771421 CTCTCTAGCCTGTTTGGGCCAGG - Intronic
1083956113 11:65983732-65983754 GGCTGTGCTGTGTTTGGGCCAGG - Intergenic
1084028493 11:66467190-66467212 GTCTCTGCGCCGTCCGGGCCCGG + Intronic
1084501492 11:69538170-69538192 GTCCCTGCTCTGCTGGGGTCAGG - Intergenic
1086752315 11:90512543-90512565 TTTTCTGCCCTGTGTGGGCCAGG + Intergenic
1086782544 11:90925770-90925792 GTCACTGCTTTGCTTTGGCCTGG + Intergenic
1088135566 11:106552290-106552312 GTCTCTGCACTCTCGGGGCCAGG + Intergenic
1089112097 11:116065160-116065182 GCCTCTTCTCTGTTTGTGACTGG - Intergenic
1089676502 11:120093500-120093522 GTCTTTGCTCTGGTGGGGGCTGG + Intergenic
1091205304 11:133816912-133816934 GTCCCTGCTCTGTGGGAGCCAGG + Intergenic
1091254801 11:134173739-134173761 CTGTCTGCTTTGTGTGGGCCGGG + Intronic
1091825783 12:3511666-3511688 GGCTCTGGGCTGTGTGGGCCTGG + Intronic
1091997283 12:5003447-5003469 GTGTCTGCTATGTGTGGGCATGG + Intergenic
1092312596 12:7374570-7374592 GTCTCTGCTCACTTTGGGGAGGG - Exonic
1093907771 12:24712952-24712974 GTCTCTTCTCTGCTAGGGCTGGG - Intergenic
1094045330 12:26160146-26160168 GGCACTGCACTGTTTGGTCCAGG + Intronic
1095426595 12:42081176-42081198 GTCTCTGGTCTCTGTAGGCCAGG - Intergenic
1096007786 12:48186030-48186052 GTCCCTGCCCTGGTTGGGACAGG + Intergenic
1096615018 12:52827289-52827311 GTCTCAGCTCTTGTGGGGCCAGG - Intronic
1099801407 12:87461433-87461455 GTCCTTGCTCTCTCTGGGCCTGG - Intergenic
1100501407 12:95177553-95177575 GTTTCTGTTCAGTTTGGGCCAGG - Intronic
1101288799 12:103344738-103344760 GTCTCTGCTCTGTTTGTACATGG - Intronic
1101941644 12:109103683-109103705 GTCCCTGCTGTGTTTGGTCCTGG + Intronic
1102023474 12:109699760-109699782 GTCCCTGCCCTGGTTGGGACAGG - Intergenic
1102182170 12:110920816-110920838 CTCTCTGCGGTGCTTGGGCCGGG + Intergenic
1102993901 12:117333725-117333747 TTCTCTGCTGTGTGTGGCCCGGG + Intronic
1103932590 12:124458436-124458458 GGCTCTGCTCTTGGTGGGCCGGG - Intronic
1103942476 12:124508576-124508598 GTCTCTGCTCAGTGTTGGCTGGG - Intronic
1104226145 12:126835872-126835894 TTTTCTGCTCTGGGTGGGCCAGG - Intergenic
1104831250 12:131753305-131753327 GTCTCTGCTGTGGTTGGGGGCGG - Exonic
1105822273 13:24090249-24090271 TTCTCTGCTCTGCTGTGGCCAGG + Intronic
1108391932 13:49955431-49955453 TACTCTGCACTGTGTGGGCCTGG + Intergenic
1108520884 13:51246163-51246185 GCCACTGCTCTGTTTGGTTCTGG + Intronic
1109882894 13:68504606-68504628 GTCTGTGCTCTGTTAGGAACAGG - Intergenic
1110563716 13:76937047-76937069 GTATCTGCTATGTTGGGGCAGGG + Intergenic
1113532519 13:111038945-111038967 GTCTCTCCTCTGTATGGACACGG - Intergenic
1114193571 14:20458612-20458634 GGCTGTGCTGTGTTTGGGCCGGG - Exonic
1115766161 14:36625547-36625569 GGCTCTGCTCTGTTTGGAGAAGG - Intergenic
1120385706 14:83842778-83842800 GGCTCTGCTCTATTTGAGCCAGG + Intergenic
1120493496 14:85205250-85205272 GTCTCTTCTCTGTGTTTGCCAGG - Intergenic
1121103151 14:91263998-91264020 CTCTCTCCTCTCTCTGGGCCCGG + Intergenic
1121425389 14:93847124-93847146 GTCCCTGCTCTGTTTCAGCCAGG + Intergenic
1123789157 15:23701954-23701976 GTCTCTTCTCTGTTGGGAACAGG - Intergenic
1123888386 15:24749496-24749518 TGCTCTGCTCTGTCTGAGCCAGG - Intergenic
1124382270 15:29176863-29176885 GTCTGTGCCCTCTCTGGGCCTGG + Intronic
1127117440 15:55742624-55742646 GCCTCTGCGCTGCTTGGGCAGGG - Intronic
1128902258 15:71435226-71435248 TTCTCTGCTCTGTCTGGGGTTGG - Intronic
1129409137 15:75339186-75339208 GTACCTGCCCTGTCTGGGCCAGG + Intronic
1133191578 16:4137430-4137452 GTCTCTGCTCTTTTTTGGCTTGG + Intergenic
1134005006 16:10813082-10813104 GTCTCTGCTCTTTCTGTCCCTGG - Intronic
1134776866 16:16860868-16860890 TTCTCGTCTCTGTTTGAGCCAGG - Intergenic
1135195722 16:20392881-20392903 GGCTCTGCTCTGTTTTAACCAGG - Intronic
1135562894 16:23490011-23490033 GTCTCTGTTCTGATTCAGCCTGG - Intronic
1138379737 16:56591497-56591519 GCCACTGGTCTGTTTGGGGCTGG + Intergenic
1138487898 16:57358501-57358523 GTCTCTGCACTGTGTGGCCTTGG - Intergenic
1138819055 16:60236306-60236328 GTGTCTGCCTTGTTTGGGCATGG - Intergenic
1139756419 16:69147572-69147594 GTCTCTGATCTGGTTGTGCTTGG + Intronic
1141472425 16:84248211-84248233 GGCTGTGCTCTTTTTGGGTCTGG - Intergenic
1143963346 17:10738604-10738626 GCCTTTCCTCTGTGTGGGCCAGG - Intergenic
1144493242 17:15732061-15732083 GTCACTGCTCTGGCTAGGCCCGG - Intergenic
1145246707 17:21274498-21274520 GTCTCTGCCCTGTTTGAGCTGGG - Intergenic
1147841548 17:43375401-43375423 ATTTCTGCTCTGTGTGGGTCAGG - Intergenic
1148084861 17:44987925-44987947 GTCTGTCCTCTGGTTGGGGCGGG + Intergenic
1148126413 17:45239534-45239556 TTCTCTGCTCAGCCTGGGCCAGG - Intronic
1150473313 17:65455954-65455976 GTATCTGCTCTGAGTGGGCAGGG - Intergenic
1152920339 17:83063396-83063418 GTCTCTGTGCTGTGTGGCCCTGG - Intergenic
1155344725 18:24847088-24847110 GTCTGTGCACTGTTCTGGCCAGG - Intergenic
1156619115 18:38827832-38827854 TTCACTGCTCTGTATGAGCCTGG + Intergenic
1157996615 18:52565174-52565196 GTCTCTGTTCTATTTGAGCATGG + Intronic
1159019133 18:63128669-63128691 GACTCTGCTCAGTTTGGCCCTGG - Exonic
1160305532 18:77731759-77731781 GTCCCTGCTCTGTTGGGTCATGG - Intergenic
1160521475 18:79510761-79510783 GTCCCTGCCCTGTGTGGCCCTGG + Intronic
1160880784 19:1319013-1319035 GCCTCTGCCCAGTTCGGGCCGGG + Intergenic
1161474573 19:4477134-4477156 GCCTCTCCTTTGTTTCGGCCTGG + Intronic
1161768755 19:6220325-6220347 GACTCTGTGCTGTTGGGGCCTGG + Intronic
1161788072 19:6340563-6340585 GTCTCTGCTCTGTGTGTGGGTGG + Intergenic
1162041237 19:7972190-7972212 CGCTCAGCTCTGTTTGGGGCAGG - Intronic
1162568555 19:11457600-11457622 GTCTCTGCTCTGTTTGGGCCAGG + Intronic
1162885692 19:13695286-13695308 GTCCCTGCTCTGCTCAGGCCCGG - Intergenic
1166233028 19:41436766-41436788 CTCTCTGCTTTGTTTGGTCATGG - Intronic
1167619588 19:50553326-50553348 ATCTCTGCTCTGAGTGGGACGGG - Intronic
1167732122 19:51265943-51265965 GTCTTTGCTCTCTCTGTGCCAGG - Intronic
925719280 2:6812082-6812104 TTCTCTGCGTTGTTAGGGCCTGG - Intergenic
925801877 2:7609685-7609707 TTCTCTCCTGTCTTTGGGCCAGG - Intergenic
926225828 2:10966288-10966310 GTCTCTGCTCAGCCTGGGGCTGG + Intergenic
926786532 2:16523691-16523713 GTCTCTGCTCTGGCTCAGCCTGG - Intergenic
927962535 2:27250015-27250037 GGCTTTGCCCTGTTGGGGCCTGG + Intergenic
930844465 2:55887194-55887216 ATCTCTGCTCTGTGTGACCCTGG - Intronic
931077094 2:58727662-58727684 GTGTCTCCTCTGATTGGGGCAGG + Intergenic
935039803 2:99415250-99415272 GTGGCTGCACTCTTTGGGCCCGG - Intronic
936109987 2:109657144-109657166 GACTCTGCTCTGTGGGGGACAGG + Intergenic
937004948 2:118502773-118502795 CTCTCTTCTCTGTTTCTGCCTGG - Intergenic
938695147 2:133828195-133828217 GTTTCTGCTTTGTTTTTGCCTGG + Intergenic
939491257 2:142879711-142879733 GTTTCTACTCTGTCTGTGCCAGG + Intronic
1168758783 20:334359-334381 GTCTCTGCTCTGTGATGGCTGGG - Intergenic
1170113303 20:12828685-12828707 GTATATGCTGTGTTTGGGGCAGG + Intergenic
1172063299 20:32201980-32202002 GTCTCTGCTCTGGTTGCGGGAGG + Exonic
1172163296 20:32883436-32883458 TACTCTGCACTGTGTGGGCCTGG + Intronic
1172965567 20:38831893-38831915 TTCTCTGCTCCTTTTGGGCTGGG + Intronic
1174170154 20:48612498-48612520 GTGGCTGCTCTGAATGGGCCAGG - Intergenic
1175270635 20:57731482-57731504 GTCTCAGCTGTGTTAGAGCCTGG - Intergenic
1175650851 20:60721441-60721463 TTCTCTGCTCTGTCTGAGCCAGG - Intergenic
1177283163 21:19011615-19011637 ATCTCTGTTCTTGTTGGGCCTGG + Intergenic
1178587312 21:33881077-33881099 GTGTCTGTTCTGTTTGGCACTGG + Intronic
1178615489 21:34129372-34129394 GCCTCTGCTCTGTTTCTACCGGG + Intronic
1178715211 21:34958137-34958159 GTTTCTGCTCTGTTTTGTCCTGG - Intronic
1178905632 21:36633570-36633592 ATCTTTGCTCTCTTTGAGCCAGG - Intergenic
1180795426 22:18601954-18601976 GTCTCTGCTCAGTGAGGACCTGG - Intergenic
1181135431 22:20762675-20762697 GTTTTTGCTCTGTTTGGGTCTGG + Intronic
1181226314 22:21393358-21393380 GTCTCTGCTCAGTGAGGACCTGG + Intergenic
1181252336 22:21541498-21541520 GTCTCTGCTCAGTGAGGACCTGG - Intergenic
1181361591 22:22341971-22341993 GTCTCTGCTCTGCTTCTTCCTGG + Intergenic
1183209431 22:36441718-36441740 GACTCTGTTCTGGTTGGGCTTGG + Intergenic
1183597496 22:38821569-38821591 GTCCCTGCCCTCTCTGGGCCTGG - Exonic
1184747917 22:46466550-46466572 GTCTCTGCTCTGTGGTGTCCGGG - Intronic
953263438 3:41362891-41362913 GGCTCTGCTCTCTTGGTGCCTGG - Intronic
954284771 3:49611105-49611127 GCTTCTGCCCTGTTTGGGGCAGG + Intronic
956526813 3:70173274-70173296 GTCTCTGTTCTGTTTGTCACAGG + Intergenic
958762494 3:98326151-98326173 GTCTCTCTTTTGTTTGAGCCAGG + Intergenic
958982249 3:100735839-100735861 GACTCTGCACTCTTTTGGCCGGG - Intronic
963084888 3:141427612-141427634 GTCTCCACTCTGTATTGGCCAGG + Intronic
964813840 3:160695187-160695209 GTCAGTGCGCTGTGTGGGCCAGG - Intergenic
966801933 3:183772283-183772305 GACTCTGCTCTGTTTTGAACAGG + Exonic
968288222 3:197520442-197520464 GCCTCCCCTCTGTGTGGGCCGGG + Intronic
968591884 4:1463652-1463674 GTCCCAGCTTTGTCTGGGCCTGG + Intergenic
969681215 4:8644526-8644548 GTCTCTGCTGTTTTAGGCCCTGG - Intergenic
970867706 4:20778089-20778111 GTCTCTGCTGAGTTTGGGAGTGG - Intronic
973981864 4:56314477-56314499 GCCTCTCCTCCGCTTGGGCCTGG - Exonic
974766664 4:66356014-66356036 CTCTCTGCACTGGGTGGGCCGGG - Intergenic
975599281 4:76082540-76082562 GTGTCTGCTCTGTCTGTGCTTGG + Intronic
976231979 4:82853636-82853658 GTCTCTGCTATATTTGTGCAGGG - Exonic
976367040 4:84244176-84244198 GTCTCTGCTCTGGTTGTGGGAGG - Intergenic
977546473 4:98387762-98387784 GTGTTTGCTATGTATGGGCCTGG + Intronic
981733894 4:147928386-147928408 GTCTCTGGTTTGTTTGGGAGTGG + Intronic
982892827 4:160877400-160877422 TTCACTGCCCTGTTTGGTCCCGG + Intergenic
983908674 4:173211295-173211317 ATCTCTGCTCTGTGTGAGCCTGG + Intronic
984821287 4:183884994-183885016 GTCTCTGCGCTGTTAGGTCTGGG - Intronic
992683997 5:79181516-79181538 TTCCCTGATCTGTTTGGGCTTGG - Intronic
992831189 5:80595073-80595095 GTCTCTGCTCTCTCTGGCCTTGG - Intergenic
994260907 5:97657534-97657556 GTCTCAGCTCTGTGTGGGTAGGG - Intergenic
994873014 5:105378437-105378459 CTCTCTGCTCTATTTTGGCCAGG + Intergenic
995216999 5:109606487-109606509 TTCTCAGCTCTGTGTGAGCCAGG - Intergenic
995642099 5:114268568-114268590 TTCTCTGCTCTTTTTGGTTCAGG - Intergenic
998404644 5:141867415-141867437 TTTTCTAATCTGTTTGGGCCCGG + Intronic
1001922457 5:175611237-175611259 GTCACTGCTTTGTCTTGGCCAGG - Intergenic
1002876550 6:1215788-1215810 GTCTCAGCTCTGGTTGGGGAAGG - Intergenic
1004177367 6:13351377-13351399 CTCTTTGGGCTGTTTGGGCCTGG + Intergenic
1006595400 6:35189503-35189525 GTCTGTGGTCTGTTAGGGACTGG + Intergenic
1006595469 6:35190077-35190099 GTCTGTGGTCTGTTAGGGACTGG - Intergenic
1007886452 6:45235875-45235897 TTTTCTGCTCTGGTTGGGCCAGG - Intronic
1013202782 6:107917077-107917099 TTTTCTGCTCTGGGTGGGCCAGG - Intronic
1013591575 6:111623322-111623344 GTCTCTGCTCTGCGTGGCTCAGG + Intergenic
1013723665 6:113064636-113064658 GACTCTGCTCTGGTTAGGCAAGG - Intergenic
1013837211 6:114346511-114346533 GTCTCTGCTCTCATTGAGCGAGG + Intergenic
1018109790 6:160524028-160524050 GGCTCTGCTCTGGTGTGGCCTGG + Intergenic
1023601579 7:41886307-41886329 CTCCCTGCTCTGTGGGGGCCAGG - Intergenic
1026586611 7:71660884-71660906 GGCTCTGCTCTGTGTTGGCTGGG - Intronic
1027469872 7:78560072-78560094 GTCCCTGCTTTGTGTGGGCATGG - Intronic
1029163098 7:98566950-98566972 GTCTCTGCACTGCTTTGCCCTGG - Intergenic
1029664554 7:101986772-101986794 GACTCTGCTCTGGTAGGGTCCGG - Intronic
1036679454 8:10860356-10860378 GTCTCTGCTCCTTTTGAGCTGGG + Intergenic
1036957227 8:13201161-13201183 GTTTCTGATTTGTTTGGGACTGG + Intronic
1038733880 8:30151723-30151745 TTTTCTGCTCTGGGTGGGCCAGG + Intronic
1039576369 8:38627062-38627084 GTCCTTGCTATGTTTGTGCCAGG - Intergenic
1041257853 8:55994884-55994906 AACTCTGGTCTGTTTGAGCCAGG + Intronic
1041793786 8:61724990-61725012 GTCTGTGATCTGTTAGGGACTGG - Intergenic
1048369033 8:133760994-133761016 GTCTCTGTTCTGCCTGGGGCGGG + Intergenic
1051759786 9:20449519-20449541 CTCGCTGCTCTCTTTGGGGCAGG + Intronic
1052584746 9:30411796-30411818 GTGGCTGCTCAGTTTGGCCCGGG - Intergenic
1053420579 9:37975005-37975027 GTCTCTGCTCTTCCTGGGCCAGG + Intronic
1055017536 9:71634692-71634714 GTCTGTGAACTCTTTGGGCCTGG - Intergenic
1057198317 9:93127247-93127269 GCCTCTGCTGTGTCGGGGCCGGG - Intronic
1057479592 9:95434173-95434195 GTCTGCGCTCTCTTTGGGCCAGG + Intergenic
1059424041 9:114209768-114209790 GGTTCTGCTCTGTTTGGGCAGGG - Intronic
1059430626 9:114248193-114248215 GTCTGTGCTCTGTTAGAGACAGG - Intronic
1060536769 9:124395935-124395957 GTCCCTGCTCTCCGTGGGCCAGG - Intronic
1060597638 9:124857756-124857778 TTGTCTGCTCTGGTGGGGCCTGG - Exonic
1060878769 9:127103034-127103056 CTCTCTGCAGTGCTTGGGCCTGG + Intronic
1061709215 9:132476199-132476221 GTCTATCCTCTGCTTGGTCCTGG + Intronic
1062570839 9:137184569-137184591 GTGTCTGCTCTGTCTGCGTCTGG - Intronic
1062570848 9:137184611-137184633 GTGTCTGCTCTGTCTGCGTCTGG - Intronic
1186588987 X:10908860-10908882 GTCTCTGTTGTGGTTGGGCGTGG + Intergenic
1186805858 X:13139510-13139532 TGCTCTGCTCTGTCTGAGCCTGG - Intergenic
1187597573 X:20790531-20790553 GTCCCTGCTCTGTATAGGACAGG - Intergenic
1190279794 X:48922181-48922203 GACTCTGTTCTGTGTGGGGCAGG - Intronic
1190691631 X:52917569-52917591 TTCTGTGCTCTGTTTGGGGAGGG + Intergenic
1190694352 X:52938223-52938245 TTCTGTGCTCTGTTTGGGGAGGG - Intronic
1190817224 X:53939205-53939227 GTCTCTGCTTTGCTGTGGCCAGG + Exonic
1193108553 X:77704853-77704875 GTCTCTGCACTCTTGGGGCCTGG - Intronic
1200732328 Y:6756177-6756199 GTATCAGGTCTGTTTGGTCCAGG + Intergenic
1201886522 Y:18889918-18889940 GTCTCTGCCCTGTTAAGACCAGG - Intergenic