ID: 1162572329

View in Genome Browser
Species Human (GRCh38)
Location 19:11480632-11480654
Sequence TCCGTGTTGAGGGGGGCTCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 112}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162572319_1162572329 4 Left 1162572319 19:11480605-11480627 CCATTCTTGTGTGCCCGGCGGGC 0: 1
1: 0
2: 0
3: 2
4: 56
Right 1162572329 19:11480632-11480654 TCCGTGTTGAGGGGGGCTCCGGG 0: 1
1: 0
2: 0
3: 4
4: 112
1162572315_1162572329 14 Left 1162572315 19:11480595-11480617 CCTACAGTGACCATTCTTGTGTG 0: 1
1: 0
2: 3
3: 15
4: 134
Right 1162572329 19:11480632-11480654 TCCGTGTTGAGGGGGGCTCCGGG 0: 1
1: 0
2: 0
3: 4
4: 112
1162572322_1162572329 -10 Left 1162572322 19:11480619-11480641 CCGGCGGGCGCGGTCCGTGTTGA 0: 1
1: 0
2: 0
3: 2
4: 24
Right 1162572329 19:11480632-11480654 TCCGTGTTGAGGGGGGCTCCGGG 0: 1
1: 0
2: 0
3: 4
4: 112
1162572321_1162572329 -9 Left 1162572321 19:11480618-11480640 CCCGGCGGGCGCGGTCCGTGTTG 0: 1
1: 0
2: 1
3: 7
4: 38
Right 1162572329 19:11480632-11480654 TCCGTGTTGAGGGGGGCTCCGGG 0: 1
1: 0
2: 0
3: 4
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162572329 Original CRISPR TCCGTGTTGAGGGGGGCTCC GGG Exonic