ID: 1162572573

View in Genome Browser
Species Human (GRCh38)
Location 19:11481532-11481554
Sequence AGTCTTCTGCAGAAGGAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 234}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162572563_1162572573 17 Left 1162572563 19:11481492-11481514 CCACCTCAAGACCACGGGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1162572573 19:11481532-11481554 AGTCTTCTGCAGAAGGAGACTGG 0: 1
1: 0
2: 1
3: 22
4: 234
1162572568_1162572573 6 Left 1162572568 19:11481503-11481525 CCACGGGGGAGGGTGGCTACTGT 0: 1
1: 0
2: 0
3: 6
4: 120
Right 1162572573 19:11481532-11481554 AGTCTTCTGCAGAAGGAGACTGG 0: 1
1: 0
2: 1
3: 22
4: 234
1162572566_1162572573 14 Left 1162572566 19:11481495-11481517 CCTCAAGACCACGGGGGAGGGTG 0: 1
1: 0
2: 0
3: 8
4: 137
Right 1162572573 19:11481532-11481554 AGTCTTCTGCAGAAGGAGACTGG 0: 1
1: 0
2: 1
3: 22
4: 234
1162572558_1162572573 27 Left 1162572558 19:11481482-11481504 CCAGTGTAGACCACCTCAAGACC 0: 1
1: 0
2: 0
3: 4
4: 46
Right 1162572573 19:11481532-11481554 AGTCTTCTGCAGAAGGAGACTGG 0: 1
1: 0
2: 1
3: 22
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162572573 Original CRISPR AGTCTTCTGCAGAAGGAGAC TGG Intronic
900206285 1:1433261-1433283 AGGCTTCTGCAGAAGATGAAGGG - Intergenic
901826909 1:11868018-11868040 AGTCATCTTCAGAAAGAGAAAGG - Intergenic
901840132 1:11949144-11949166 CAACTTCAGCAGAAGGAGACAGG + Intronic
902223937 1:14984637-14984659 AGTCTCCATCAGAAGGAGCCAGG + Intronic
903271548 1:22191711-22191733 AGTTGTCTGGAGAAGGAGTCTGG + Intergenic
903556587 1:24198083-24198105 ATTCTTAGGCAGATGGAGACAGG - Intergenic
904432000 1:30470314-30470336 AAGCTTCTTCTGAAGGAGACAGG - Intergenic
904846468 1:33422168-33422190 AGTTTTCTGGAGAAAGTGACAGG - Intronic
904917846 1:33983148-33983170 GGCCCTCTGCAGAGGGAGACTGG + Intronic
905371878 1:37486733-37486755 AGTCTCCTGCAGGGGGGGACAGG + Intergenic
906620946 1:47278560-47278582 AGTCTTCTTTAGAACAAGACAGG + Intronic
907185686 1:52607452-52607474 AGGCTTCTGCAGCTGGAGAAGGG - Intronic
907597345 1:55732128-55732150 AGTTATCTGCAGAAGATGACAGG - Intergenic
908931198 1:69317495-69317517 AGTCTTGTGCTCAAGGTGACTGG + Intergenic
910880684 1:91919950-91919972 AGTTTGATGCAGAAGTAGACTGG - Intergenic
911554639 1:99328923-99328945 AGTCTTCTGCAGAAGTGGGAAGG - Intergenic
912733324 1:112128831-112128853 AGTCATCTGCAGAAGATGGCAGG + Intergenic
914686483 1:149984361-149984383 AGGCTTCTGCAGAAAGAGAATGG + Intronic
914994931 1:152535245-152535267 TGTCTCCTGCAGAGAGAGACGGG - Intronic
915161510 1:153923517-153923539 AGCCTTTGGCAGACGGAGACAGG - Intergenic
916359100 1:163947875-163947897 AGTCTTCAGAAGTAGCAGACTGG - Intergenic
917093740 1:171379869-171379891 AGGCTGCTGAACAAGGAGACAGG - Intergenic
917440896 1:175067867-175067889 GGTCTGCGGCAGGAGGAGACCGG + Exonic
918150828 1:181796879-181796901 AGTCTACAGCAGAAGGACAGGGG + Intronic
918821835 1:189266541-189266563 ATTCTTCTGCAGAGAGAGAATGG - Intergenic
919148274 1:193662422-193662444 ATTCTTCTGGAAAAGGAGAGGGG + Intergenic
921671056 1:217924566-217924588 AGTCCTCATCAGAAGGAGATGGG + Intergenic
922183749 1:223256494-223256516 AGTCATCTGCAGGAGGAGAGCGG - Intronic
922781048 1:228252583-228252605 AGTTATCTGCAGAAGATGACAGG + Intronic
923020836 1:230162500-230162522 AGCCTTGGGGAGAAGGAGACTGG - Intronic
1062966549 10:1611805-1611827 AGTTTCCTTCAGAAGGAGATGGG - Intronic
1064020128 10:11802382-11802404 AGCCAACTGCAGAAGGAGAGAGG + Intergenic
1066376370 10:34860962-34860984 GGACTTCTGCAGAGGGAGAGGGG + Intergenic
1067630297 10:47959080-47959102 GGCCTTCTGGAGAAGGAGGCAGG + Intergenic
1067708972 10:48633767-48633789 ATCCATCTGCAGAAGGAGATGGG + Intronic
1075044507 10:119135360-119135382 ATTCATCTGCTGAAGGACACTGG - Intronic
1075611532 10:123858720-123858742 AGTCTTTAGCAGAGGGAGAGTGG - Intronic
1075669702 10:124256009-124256031 AGCCTTGTGCAGCAGGACACTGG + Intergenic
1076624525 10:131813320-131813342 ATTCCTCTGAAGAAGGACACAGG - Intergenic
1077382488 11:2250692-2250714 AGGCGCCTGCAGGAGGAGACGGG + Intergenic
1077513085 11:2981858-2981880 TGTATTCTGCAGAAGGTGACGGG - Intronic
1077513403 11:2984617-2984639 TGTATTCTGCAGAAGGTGACGGG - Intronic
1080961236 11:37162819-37162841 GGTCTTCTGCAGGAGAAGAAAGG + Intergenic
1081709460 11:45207640-45207662 AGTTTTATGGAGAAGGAGACTGG + Intronic
1082118753 11:48356136-48356158 AGGCTTATGCAGTAGGAGACTGG - Intergenic
1082255572 11:50029171-50029193 AGGCTTATGCAGTATGAGACTGG + Intergenic
1084286937 11:68137862-68137884 AGTTTTCTGCAAAAGGAGTGGGG - Intergenic
1084696970 11:70761578-70761600 AGTCTTCTCCAGAATGTGAGGGG - Intronic
1085819072 11:79772677-79772699 AATCTACTGCAAAAAGAGACAGG + Intergenic
1087245675 11:95833503-95833525 AGACTTCTGCAGAAGGTGAGGGG + Exonic
1090209495 11:124908075-124908097 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1090455906 11:126849607-126849629 AATCAGCTGCAGAAGGAGAAAGG + Intronic
1090527543 11:127553712-127553734 AGTCTTCTGCAAGAAGACACTGG + Intergenic
1093145951 12:15567212-15567234 TGTCTTCTAGAGAAGGAGAGAGG - Intronic
1093430463 12:19079694-19079716 AATCTTCTGCAGAATAAGCCAGG + Intergenic
1093524162 12:20088164-20088186 AGTCATATGCAGAATGAAACTGG + Intergenic
1095731663 12:45512384-45512406 AGTTTGGTGCAGAAGGGGACAGG - Intergenic
1096442207 12:51652856-51652878 AGTCTTCTGAGGTAGTAGACAGG - Intronic
1096657976 12:53103594-53103616 TGTCCTCTGCAGACGCAGACGGG - Exonic
1097096314 12:56551496-56551518 AGTCTTCTTATGAAGTAGACTGG + Intronic
1097716614 12:62972749-62972771 AGTCTTCTCCAGGAGAAGACTGG - Intergenic
1097821385 12:64132191-64132213 AGTTATCTGCAGAAGAAGGCAGG + Intronic
1098749845 12:74279564-74279586 AGTTATCTGCAGAAGATGACAGG - Intergenic
1101264129 12:103066095-103066117 AGTTATCTGCAGAAGATGACAGG - Intergenic
1101277585 12:103219196-103219218 AGTTTTCTGCATATGGAAACAGG - Intergenic
1101926654 12:108977306-108977328 AGCCTTCGGCAGCAGGAGAAGGG + Intronic
1102407861 12:112689704-112689726 AGCCTTCAGCAGAGGTAGACAGG - Intronic
1102743968 12:115233420-115233442 GGGCTTCAGAAGAAGGAGACAGG + Intergenic
1103495374 12:121358006-121358028 AGTCTCCTGGAGACAGAGACTGG - Intronic
1104989308 12:132616161-132616183 AGTTTTCCCCAGAAGCAGACGGG - Intergenic
1106345407 13:28872141-28872163 AGGCTCCTGGAGAAGGAGTCTGG + Intronic
1106538296 13:30667043-30667065 AATCTTTTGGAGAAAGAGACTGG + Intergenic
1106656464 13:31752243-31752265 AGTCATCTGAAGAAGGAGGGGGG + Intronic
1107983578 13:45755999-45756021 AGTTATCTGCAGAAGATGACAGG + Intergenic
1109720398 13:66268669-66268691 AGTCTTCTGCAGAGGGTCTCAGG - Intergenic
1110528102 13:76563232-76563254 AGCCTTCTGAAGAATGAGAAAGG - Intergenic
1113219785 13:108086856-108086878 AGCCTTCTGGAGAACAAGACTGG - Intergenic
1113461986 13:110488523-110488545 AGACTTCTCCAGAAAGACACAGG - Intronic
1114867626 14:26616709-26616731 AGCCATATGCAGAAAGAGACTGG + Intergenic
1115059714 14:29173867-29173889 AGTTATCTGCAGAAGATGACAGG - Intergenic
1115344045 14:32323273-32323295 AATCTTATGCAGAAGGAGAAAGG - Intergenic
1115790841 14:36876278-36876300 AGGCTTCTGCAGAAGCAAAGTGG - Intronic
1116130831 14:40854470-40854492 AGTCCTATGCAGAAGGGGGCAGG + Intergenic
1116158382 14:41236692-41236714 AGCTATCTGCAGAAGGTGACAGG + Intergenic
1117236217 14:53779616-53779638 AGTGGTCAGCAGAAGGAGAATGG + Intergenic
1117992979 14:61453024-61453046 TGTTTTCTGCAGAAGCAGAAAGG - Intronic
1121634622 14:95445614-95445636 AGTCTTCTGCAGAGAGTGACAGG - Intronic
1128134194 15:65250634-65250656 AGTCTGCAGCAGTAGGAGAAGGG - Intronic
1128781455 15:70361466-70361488 AGCCTTCTGCAGCAGAAGGCTGG + Intergenic
1131805861 15:96121828-96121850 TGCCTTCTGCAGAAAGAGGCTGG + Intergenic
1131809748 15:96160621-96160643 ACTCTTCTGCAAAAGGAATCAGG - Intergenic
1132129634 15:99264061-99264083 ACCCTTCTGCAGAAGAAAACTGG - Intronic
1134859247 16:17546342-17546364 CTTCATCTGCAGAAGTAGACGGG - Intergenic
1135712826 16:24732182-24732204 AGTGTTCTGAGGAAGGAGAGAGG + Intronic
1136024516 16:27461228-27461250 AGCCTCCTGCAGCAGGGGACGGG - Exonic
1136117131 16:28101594-28101616 GATCTTCTGCAGGAGGAGATTGG - Exonic
1136463903 16:30429128-30429150 AGTTTGCTGCGGAACGAGACTGG - Exonic
1137771348 16:51017839-51017861 TGTTTTCTGCAGAAGGAAAAAGG - Intergenic
1137953480 16:52806037-52806059 AGTGTTCTGGAAAAGGAGAGTGG + Intergenic
1140622400 16:76751427-76751449 AGTGAACTGCAGAAGGAGAAGGG + Intergenic
1141425749 16:83943407-83943429 AGTTTTCTGCAGAATGAGGGAGG + Intronic
1141697162 16:85625587-85625609 CGTGTTCTGCAGAAGAACACGGG - Intronic
1145759115 17:27415899-27415921 AGCCTTCTTCACAAGGTGACAGG - Intergenic
1148252584 17:46097067-46097089 ATTCCTCTGCATAAGGAAACAGG + Intronic
1148542859 17:48493733-48493755 AGTCTTGTGTAAAAGGAAACTGG + Intergenic
1150368902 17:64618551-64618573 AGTCTCCAGCAGCAGCAGACAGG - Intronic
1152498262 17:80690481-80690503 AATCAACTGCAGAAAGAGACAGG - Intronic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1154068461 18:11131068-11131090 AGTTATCTGCAGAAGGTGGCAGG - Intronic
1157175688 18:45449892-45449914 AGGCTTCTGCAGCATGAGGCTGG - Intronic
1157423702 18:47567383-47567405 AGCCTCCTGCAGACAGAGACTGG + Intergenic
1157760586 18:50261352-50261374 AGTCTTCCACAGAATAAGACTGG + Intronic
1159191999 18:65058399-65058421 ATTCTTCAGTAGAAGGAGTCAGG + Intergenic
1161572306 19:5037225-5037247 ACCCTCCTGCAGAAGCAGACTGG + Intronic
1162547297 19:11338628-11338650 AGCCTTGGGCAGAAGGAGACAGG - Intronic
1162572573 19:11481532-11481554 AGTCTTCTGCAGAAGGAGACTGG + Intronic
1164541165 19:29122501-29122523 CTTCTTCTCCAGAAGGAGAGGGG - Intergenic
1165410145 19:35654831-35654853 AGGCATCAGCAGAAGGAGACAGG - Intronic
1165545627 19:36533066-36533088 TGTCTACAGCAGAAGGAGAATGG - Intergenic
1167421122 19:49404002-49404024 AGGTTACTGCAGAAGGAGGCAGG + Intronic
1168349823 19:55669378-55669400 AGGCTTGAGCAGAGGGAGACTGG + Intronic
926008735 2:9392307-9392329 GGGCTGCTGCAGCAGGAGACAGG - Intronic
926210303 2:10864320-10864342 AATCTTTTCCAGAAGGAGAGAGG + Intergenic
927522451 2:23707611-23707633 AGTCTGCTCTAGAAGGAGCCCGG + Exonic
929272747 2:39990798-39990820 TCTCTTCAGCAGCAGGAGACTGG - Intergenic
929424083 2:41826309-41826331 AGTCTCCTTCAAAAGGAGAAGGG - Intergenic
931025408 2:58108616-58108638 AGACTTCCACAGATGGAGACAGG - Intronic
933265687 2:80178412-80178434 AGTTATCTGCAGAAGATGACAGG + Intronic
933819931 2:86101730-86101752 AGGGTTCTGCAGATGGAGAGTGG - Intronic
935745089 2:106183421-106183443 AGTCTTTTTCAGAGGGAGTCTGG - Intronic
935918645 2:107986261-107986283 AGTTTTCTGGAGGAGGAGATGGG + Intergenic
937280299 2:120713099-120713121 TGTCTTCAGCAGCAGGAGGCTGG + Intergenic
937325385 2:120987022-120987044 ACTCTACTGCAGAACGAGCCAGG + Intronic
937477014 2:122224772-122224794 AGTCTAATGCAGAGGGAGAGGGG - Intergenic
937582066 2:123499196-123499218 AGTTCTCTGCAGAAGAAGACAGG + Intergenic
938285297 2:130109232-130109254 TGGCTTCTGCATAAGGAGGCAGG - Intronic
939966489 2:148615447-148615469 AGTTTTCAGCAAAAGGAGAATGG + Intergenic
940218818 2:151329190-151329212 AGCCTTCTGCAGAAGAAGGAGGG - Intergenic
941725068 2:168851910-168851932 AGTCTTCTGGAGGAAGAGCCTGG - Intronic
943882197 2:193159900-193159922 ACGCTACTGCAGAGGGAGACTGG + Intergenic
946577973 2:221096975-221096997 AATCTTCTGAAGAAGTAGATGGG + Intergenic
947649375 2:231772279-231772301 AGTCTACTGCAAAGGGAGGCAGG - Intronic
948632812 2:239312872-239312894 CTTCATCTGCAGAGGGAGACCGG + Intronic
948731097 2:239964192-239964214 GGGCCTCTGCAGCAGGAGACTGG + Intronic
1169020969 20:2330542-2330564 AGTCATCTGCAGAGGCAGAGAGG - Intronic
1172222276 20:33282098-33282120 TGTCTGCTGCAGATGGAGACAGG + Intronic
1173058231 20:39636659-39636681 TGTCATCTGCAGAATGAGAATGG - Intergenic
1173361418 20:42347764-42347786 AGGCTGCTGAACAAGGAGACAGG - Intronic
1177373305 21:20235234-20235256 TGTCTTTTGCAGGATGAGACTGG - Intergenic
1177944241 21:27447371-27447393 AGTCTGTTTAAGAAGGAGACAGG - Intergenic
1178663187 21:34523576-34523598 AGTCTTATGCAGCTGGAGCCTGG + Exonic
1178862800 21:36303505-36303527 CGTGTTCTCCAGTAGGAGACTGG + Intergenic
1179522944 21:41957078-41957100 TGTCTTCTGCAGTGGGAGAAGGG - Intergenic
1180988034 22:19917159-19917181 AGCCACCTGCAGAAGGAGGCTGG - Intronic
1182947463 22:34337118-34337140 ATTCTTCTTCACAAGGTGACAGG - Intergenic
1183397622 22:37581455-37581477 AGTGTTCAGCAGAAGGAAATTGG - Intronic
1184944476 22:47793463-47793485 AGTCTTCTGCAAAAGGAAACAGG - Intergenic
1185025814 22:48411284-48411306 AGGTTTCTTCAGAAGGAGAGAGG + Intergenic
1185296272 22:50056882-50056904 CTTCTTCTTCAGATGGAGACGGG - Exonic
949245863 3:1924893-1924915 AGTTATCTGCAGAAGGTGGCGGG - Intergenic
949441983 3:4091487-4091509 AGTCTTCTGAAGGAAGACACAGG - Intronic
949903054 3:8835790-8835812 AGCCCTCTGAAGAGGGAGACAGG + Intronic
951432799 3:22627931-22627953 ACTCTTCTGCATAAGGTGGCTGG + Intergenic
954916574 3:54153043-54153065 ATTCTTCTCCAAAAAGAGACTGG - Intronic
955467839 3:59254816-59254838 TTTGTTCTGCAGAAGAAGACAGG - Intergenic
956557302 3:70538153-70538175 ATTCTTCTGCAGAAATAGAATGG - Intergenic
956703897 3:71982917-71982939 AGTTATCTGCAGAAGATGACAGG + Intergenic
957774446 3:84737933-84737955 AGTCTCATGAGGAAGGAGACAGG + Intergenic
958621179 3:96563269-96563291 AGTGCTCTGCAAAAGGAGATAGG - Intergenic
958703428 3:97622149-97622171 AGAGTTCTGCAGATGGATACTGG - Intronic
963661389 3:148132115-148132137 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
967257054 3:187604001-187604023 AGTCTTCTGAAAAATGAGACAGG - Intergenic
968680532 4:1915823-1915845 AGTGTTCTGCATGAGGGGACAGG + Intronic
971857654 4:32062863-32062885 AGTTATCTGCAGAAGATGACAGG + Intergenic
977204714 4:94155654-94155676 AGTTATCTGCAGAAGATGACAGG - Intergenic
980977047 4:139621203-139621225 AGTCTTCTTCAGAATGACAAGGG + Intergenic
981362398 4:143862843-143862865 AGTCTTCTGAGGAAGGAAGCAGG + Intergenic
981382223 4:144086886-144086908 AGTCTTCTGAGGAAGGAAGCAGG + Intergenic
981964380 4:150582807-150582829 ATTCTTCTGCAGAAGAAAAGAGG + Exonic
982153744 4:152494317-152494339 AGTTTTCTGTAGAAAGAGAAAGG + Intronic
982421763 4:155207708-155207730 AGGCTTCACCACAAGGAGACAGG + Intergenic
983112768 4:163773276-163773298 AGTCTCCTCCAAAAGGAGCCAGG + Intronic
986177973 5:5367944-5367966 AGTATTCTGCAACAGGAGAATGG - Intergenic
987086612 5:14475403-14475425 TCTCTTCTGCAGAAGCAGATGGG + Intronic
987112642 5:14701677-14701699 AGACTCCTGCAGAAGGAGGCCGG + Intergenic
989328957 5:40233063-40233085 AGCCTTCTGGAGATGAAGACAGG - Intergenic
992109883 5:73482906-73482928 AGTTATCTGCAGAAGATGACAGG + Intergenic
996018556 5:118567827-118567849 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
997146832 5:131443562-131443584 AGGTTTGTGCAGAAGGAGAAGGG - Intronic
999019267 5:148145220-148145242 AGCCTTCTTCAGAGGGAGATGGG - Intergenic
1000249899 5:159483952-159483974 TTTGTTCTGCAGAAGGAGAATGG + Intergenic
1002444165 5:179279036-179279058 GGTGCTCTGCAGAAGGAAACAGG - Intronic
1003695901 6:8406168-8406190 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1004610583 6:17235955-17235977 AGTCTTCTGCTAAAAGTGACAGG + Intergenic
1005741485 6:28794987-28795009 TGGCTTCTGCAGATGGAGAGAGG + Intergenic
1007278974 6:40696254-40696276 AGCCTTATGCAGAACGCGACAGG - Intergenic
1009390114 6:63135106-63135128 AGTTATCTGCAGAAGATGACAGG + Intergenic
1010657187 6:78525488-78525510 AGTTTATTGCTGAAGGAGACAGG - Intergenic
1011609350 6:89135004-89135026 AGTCTGCTGCAGAAGGGTACAGG + Intergenic
1011890721 6:92156206-92156228 CGTCTTCTTCAGAAGGTGGCAGG + Intergenic
1012700729 6:102453331-102453353 AGTCCTCTCCACAAAGAGACTGG + Intergenic
1015879321 6:137855551-137855573 TGGCTCCTGCAGAAAGAGACTGG + Intergenic
1016753657 6:147660157-147660179 ATCCTTCTGCAAAAGGAGCCGGG - Intronic
1019043213 6:169123110-169123132 AGTCTGCTGCAGAAATAGAATGG + Intergenic
1019631913 7:2053982-2054004 ACCCTTCTGCAGAGGGAGGCAGG + Intronic
1020226792 7:6286583-6286605 TGTCTTCTACAAAAGGAAACAGG + Intergenic
1022672721 7:32471463-32471485 AGGCTGCTGCAGGACGAGACTGG - Intergenic
1022991370 7:35711284-35711306 AGTTCTCTGCAGAAGGGGAAAGG + Intergenic
1024822154 7:53344398-53344420 AGTCTAGTGCTGAAGGAGGCAGG - Intergenic
1025035050 7:55588728-55588750 ACTCTTAGGAAGAAGGAGACTGG + Intergenic
1027833813 7:83215985-83216007 ACTCTTCTTCAGGAGGAGACTGG + Intergenic
1028730598 7:94143708-94143730 AATCTTCTGCTGAAGGAAAATGG - Intergenic
1030368750 7:108673998-108674020 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1031236824 7:119187986-119188008 AGTTATCTGCAGAAGATGACAGG - Intergenic
1034351962 7:150422007-150422029 AGTCGACTGCAGGAGGAGAGAGG + Intergenic
1034481957 7:151328730-151328752 ATTCTTATGCAGAAGGAGAAAGG + Intergenic
1034738349 7:153450224-153450246 AGGCTTGTGCAGAGGGAGAAAGG + Intergenic
1037177651 8:15966046-15966068 CATCTTCTGCACAAGGAGGCAGG + Intergenic
1037890790 8:22622832-22622854 AGCCTTCTGCAGGAGGAGGTAGG - Intronic
1039039439 8:33393545-33393567 ATGCTCCTGCAGAAGGAGAGGGG - Intronic
1039322902 8:36452557-36452579 CGTCTTCTCCACAAGGTGACAGG + Intergenic
1041650554 8:60298118-60298140 AGTCTATTGGAAAAGGAGACAGG - Intergenic
1041730119 8:61054235-61054257 AGGCTGCTGCAGGAGGAGATAGG - Intergenic
1041934551 8:63321300-63321322 AGTTATCTGCAGAAGATGACAGG - Intergenic
1042402836 8:68369728-68369750 AGTCATCTGGAGAAGCAGACAGG + Intronic
1042483154 8:69325487-69325509 AGTATTGTGCAGCTGGAGACCGG + Intergenic
1042680361 8:71376887-71376909 AGGCTTCTGCGGAGGGAGCCTGG - Intergenic
1045263756 8:100601754-100601776 AGGCTTCAGCAGAACGACACTGG + Intronic
1046093978 8:109536710-109536732 AGTTTTCTTCAGAAGGGGCCTGG - Intergenic
1047191931 8:122686318-122686340 AGTTTTCGGAAGAAAGAGACTGG - Intergenic
1047891592 8:129317648-129317670 AGTCTTCTCCAGCAGCAGAAAGG + Intergenic
1049672063 8:143874275-143874297 AATCTGGTGCAGAAGGGGACAGG - Intronic
1049679311 8:143910541-143910563 AGTGTTCTGGAGGAGGACACAGG - Intergenic
1052442272 9:28512312-28512334 AGTTATCTGCAGAAGATGACAGG + Intronic
1052536918 9:29759596-29759618 AGTCTTCTCCTGACCGAGACTGG + Intergenic
1053479757 9:38407417-38407439 ACTATGCAGCAGAAGGAGACTGG - Intergenic
1054805958 9:69395987-69396009 AGGCTTCTGCAGAGAGAGAGTGG - Intergenic
1056486311 9:87061764-87061786 AGCCTCCTGCAGAGTGAGACAGG + Intergenic
1058704482 9:107627390-107627412 ATTCTTCTGCTGAAGGAAGCTGG - Intergenic
1059196508 9:112375898-112375920 AGTTATCTGCAGAAGAAGGCAGG + Intergenic
1060173325 9:121479279-121479301 TCCCTTCTGCAGAAGGAGGCAGG + Intergenic
1062434875 9:136542509-136542531 CGGCTTCTGCAGAGGGAGAAGGG + Intronic
1186732879 X:12429128-12429150 AGTCTTCTCCAGCTGGAGAAGGG + Intronic
1187203875 X:17162542-17162564 AGGCTTCTGCATAAGCAGAAAGG + Intergenic
1189205968 X:39239069-39239091 AGACTTGGGCAGAAGGAGACTGG + Intergenic
1191941263 X:66483896-66483918 AGTTATCTGCAGAAGATGACAGG + Intergenic
1193053487 X:77125736-77125758 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1193832946 X:86310065-86310087 AGTTATCTGCAGAAGATGACAGG - Intronic
1193957280 X:87878178-87878200 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
1194513420 X:94822284-94822306 AGTTATCTGCAGAAGATGACAGG + Intergenic
1197002284 X:121452889-121452911 AGTTATCTGCAGAAGATGACAGG - Intergenic
1197380003 X:125727937-125727959 AGTTTTCTGCAGAAGATGGCAGG + Intergenic
1197591864 X:128419355-128419377 AGTTATCTGCAGAAGATGACTGG - Intergenic
1198255937 X:134924520-134924542 AGTGTTCTGAACAAGGGGACAGG - Intergenic
1199083102 X:143598375-143598397 AGTGTTTTTCAGTAGGAGACTGG + Intergenic
1199371371 X:147053410-147053432 TGTCATCTGCAGACGGAGACAGG - Intergenic
1199715716 X:150506206-150506228 TGTCTGCTGGAAAAGGAGACAGG + Intronic
1200340497 X:155390672-155390694 AGTTATCTGCAGAAGATGACAGG + Intergenic