ID: 1162572779

View in Genome Browser
Species Human (GRCh38)
Location 19:11482445-11482467
Sequence CGGAGCCGGCAGGTTTCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 45}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162572779_1162572790 -1 Left 1162572779 19:11482445-11482467 CCCATGGAAACCTGCCGGCTCCG 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1162572790 19:11482467-11482489 GGCAGTGCGGGGAGAGTGGAGGG 0: 1
1: 0
2: 4
3: 56
4: 697
1162572779_1162572792 13 Left 1162572779 19:11482445-11482467 CCCATGGAAACCTGCCGGCTCCG 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1162572792 19:11482481-11482503 AGTGGAGGGGACCTGCCTCGCGG 0: 1
1: 0
2: 2
3: 6
4: 139
1162572779_1162572789 -2 Left 1162572779 19:11482445-11482467 CCCATGGAAACCTGCCGGCTCCG 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1162572789 19:11482466-11482488 CGGCAGTGCGGGGAGAGTGGAGG 0: 1
1: 0
2: 2
3: 33
4: 338
1162572779_1162572798 21 Left 1162572779 19:11482445-11482467 CCCATGGAAACCTGCCGGCTCCG 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1162572798 19:11482489-11482511 GGACCTGCCTCGCGGGGGGAGGG 0: 1
1: 1
2: 1
3: 6
4: 127
1162572779_1162572796 17 Left 1162572779 19:11482445-11482467 CCCATGGAAACCTGCCGGCTCCG 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1162572796 19:11482485-11482507 GAGGGGACCTGCCTCGCGGGGGG 0: 1
1: 0
2: 0
3: 8
4: 127
1162572779_1162572794 15 Left 1162572779 19:11482445-11482467 CCCATGGAAACCTGCCGGCTCCG 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1162572794 19:11482483-11482505 TGGAGGGGACCTGCCTCGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 108
1162572779_1162572797 20 Left 1162572779 19:11482445-11482467 CCCATGGAAACCTGCCGGCTCCG 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1162572797 19:11482488-11482510 GGGACCTGCCTCGCGGGGGGAGG 0: 1
1: 0
2: 1
3: 8
4: 220
1162572779_1162572791 0 Left 1162572779 19:11482445-11482467 CCCATGGAAACCTGCCGGCTCCG 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1162572791 19:11482468-11482490 GCAGTGCGGGGAGAGTGGAGGGG 0: 1
1: 0
2: 8
3: 57
4: 581
1162572779_1162572793 14 Left 1162572779 19:11482445-11482467 CCCATGGAAACCTGCCGGCTCCG 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1162572793 19:11482482-11482504 GTGGAGGGGACCTGCCTCGCGGG 0: 1
1: 0
2: 1
3: 20
4: 164
1162572779_1162572795 16 Left 1162572779 19:11482445-11482467 CCCATGGAAACCTGCCGGCTCCG 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1162572795 19:11482484-11482506 GGAGGGGACCTGCCTCGCGGGGG 0: 1
1: 0
2: 0
3: 15
4: 169
1162572779_1162572787 -5 Left 1162572779 19:11482445-11482467 CCCATGGAAACCTGCCGGCTCCG 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1162572787 19:11482463-11482485 CTCCGGCAGTGCGGGGAGAGTGG 0: 1
1: 0
2: 1
3: 13
4: 187
1162572779_1162572801 30 Left 1162572779 19:11482445-11482467 CCCATGGAAACCTGCCGGCTCCG 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1162572801 19:11482498-11482520 TCGCGGGGGGAGGGAGCTCGCGG 0: 1
1: 0
2: 0
3: 10
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162572779 Original CRISPR CGGAGCCGGCAGGTTTCCAT GGG (reversed) Intronic
903690152 1:25167598-25167620 CTGAGCGGGCAGGTTTCTGTGGG + Intergenic
904495404 1:30883887-30883909 CGGAGCCTGCAGGGATCCAGAGG - Intronic
910399892 1:86828120-86828142 CTGAGCTAGCATGTTTCCATAGG - Intergenic
914980501 1:152410645-152410667 CAGAGCCAGCAGGGTTCCAGAGG - Exonic
919747213 1:201016481-201016503 CAGAGCTGGCAGGCTGCCATGGG - Intronic
1064497428 10:15927445-15927467 CTGAGCCTGCACCTTTCCATGGG + Intergenic
1066294725 10:34044195-34044217 TGGAGCCATCAGGTTCCCATTGG + Intergenic
1067790095 10:49281455-49281477 GGGAGCCAGGAGGTTTCCCTAGG - Intergenic
1069990284 10:72310976-72310998 CGGAGCCAGCAGCTCTCCAGTGG - Intergenic
1072427726 10:95344043-95344065 AGGAGCCTGCAGATCTCCATAGG - Intronic
1085212310 11:74791869-74791891 CGGAGCCGGCAGGTGTCAGCTGG - Intronic
1089496921 11:118912667-118912689 AGGAGCAGGCAGGTTGCCACTGG - Intronic
1094327457 12:29256284-29256306 CTGAGCCGGGAGGATTCCTTGGG - Intronic
1106467461 13:30025551-30025573 CTGAGCAGGCAGCTTTCCAAAGG + Intergenic
1133210805 16:4262485-4262507 AGGAGCCGGCAGGTTCCCGCTGG - Intronic
1135656652 16:24256116-24256138 GGGGGCCGGCTGGTTTCCCTGGG - Exonic
1143251319 17:5525361-5525383 AGGAGCTGACAGGCTTCCATTGG - Intronic
1152328307 17:79655566-79655588 CTGAGCCGGCAGGAGGCCATTGG + Intergenic
1160984347 19:1831236-1831258 TGGTGCGGGCAGGTTCCCATGGG - Intronic
1162572779 19:11482445-11482467 CGGAGCCGGCAGGTTTCCATGGG - Intronic
1168436542 19:56322373-56322395 CTCAGCCGGCAGGCTTCCCTAGG + Intronic
927988197 2:27428557-27428579 CACCGCCGGCAGGTTTCCATTGG - Exonic
937450839 2:122001065-122001087 CGGACCCCGCAGGTTTCCCAAGG + Intergenic
1170122640 20:12927113-12927135 CTGAGCCTGCCTGTTTCCATAGG - Intergenic
1179016225 21:37596175-37596197 AGGGGCAGGCGGGTTTCCATGGG + Intergenic
1179790512 21:43753578-43753600 CGGAGCCAGCGGGATTCCCTAGG - Exonic
1183953378 22:41365081-41365103 TGGAGTGGGCAGGTGTCCATCGG - Intergenic
1184659892 22:45960876-45960898 TGGAGCCAGCAGGGTTCCTTGGG + Intronic
951753013 3:26057891-26057913 TTTAGCCGGTAGGTTTCCATTGG + Intergenic
958673493 3:97234897-97234919 AGATGCAGGCAGGTTTCCATAGG - Intronic
964476031 3:157098433-157098455 TGGAGGAGGCAGGTTTCCAGTGG + Intergenic
973653749 4:53024082-53024104 TGAAACCAGCAGGTTTCCATTGG - Intronic
982204056 4:152983890-152983912 TGGAGCCGTCAGCTTCCCATTGG + Intergenic
986323962 5:6657698-6657720 CAGAGACGGCAGGATCCCATGGG + Intronic
999461042 5:151758088-151758110 CGGACCGGGCAGGTTTTCAGAGG - Intronic
1001127163 5:169030064-169030086 AGGAGAGGGCAGGTTTCCAAGGG - Intronic
1002321893 5:178381298-178381320 GGGAGCCGGCAGGGTCCCCTGGG - Intronic
1014146458 6:118003422-118003444 CACAGCCGGCAGGTTGCCATGGG - Intronic
1020013786 7:4819817-4819839 CGGAGCCTGCAGGCATCCCTGGG + Intronic
1022164853 7:27748157-27748179 AGGAGCCAGCAGGTTTATATTGG + Intronic
1023612415 7:41984263-41984285 CAGAGCAGGCAGTTTTCCCTTGG + Intronic
1027266356 7:76497119-76497141 CAGAGCCCACAGGTTTCTATAGG - Intronic
1027317736 7:76995237-76995259 CAGAGCCCACAGGTTTCTATAGG - Intergenic
1032968652 7:137132266-137132288 GGGAACAGCCAGGTTTCCATTGG - Intergenic
1043059729 8:75484956-75484978 CAGAGACGTCAGGTTTACATTGG - Intronic
1046922935 8:119752947-119752969 AGGAGCAGGCAGGGTTCCAGCGG + Intronic
1049983712 9:928586-928608 AGGAGCCAGAAGCTTTCCATTGG + Intronic
1190998515 X:55636122-55636144 AGGAGCCAGCAGGCTTCCAGAGG - Intergenic