ID: 1162573192

View in Genome Browser
Species Human (GRCh38)
Location 19:11484043-11484065
Sequence GCAGGGGGGTCTCGCCGGTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 89}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162573173_1162573192 24 Left 1162573173 19:11483996-11484018 CCCTCCCACCCAATCCTCTAGCG 0: 1
1: 0
2: 1
3: 13
4: 164
Right 1162573192 19:11484043-11484065 GCAGGGGGGTCTCGCCGGTGTGG 0: 1
1: 0
2: 0
3: 8
4: 89
1162573177_1162573192 19 Left 1162573177 19:11484001-11484023 CCACCCAATCCTCTAGCGGCACG 0: 1
1: 0
2: 0
3: 0
4: 38
Right 1162573192 19:11484043-11484065 GCAGGGGGGTCTCGCCGGTGTGG 0: 1
1: 0
2: 0
3: 8
4: 89
1162573182_1162573192 15 Left 1162573182 19:11484005-11484027 CCAATCCTCTAGCGGCACGGGGC 0: 1
1: 0
2: 0
3: 2
4: 27
Right 1162573192 19:11484043-11484065 GCAGGGGGGTCTCGCCGGTGTGG 0: 1
1: 0
2: 0
3: 8
4: 89
1162573180_1162573192 16 Left 1162573180 19:11484004-11484026 CCCAATCCTCTAGCGGCACGGGG 0: 1
1: 0
2: 0
3: 3
4: 24
Right 1162573192 19:11484043-11484065 GCAGGGGGGTCTCGCCGGTGTGG 0: 1
1: 0
2: 0
3: 8
4: 89
1162573172_1162573192 25 Left 1162573172 19:11483995-11484017 CCCCTCCCACCCAATCCTCTAGC 0: 1
1: 0
2: 2
3: 27
4: 411
Right 1162573192 19:11484043-11484065 GCAGGGGGGTCTCGCCGGTGTGG 0: 1
1: 0
2: 0
3: 8
4: 89
1162573184_1162573192 10 Left 1162573184 19:11484010-11484032 CCTCTAGCGGCACGGGGCGGCCT 0: 1
1: 0
2: 0
3: 5
4: 42
Right 1162573192 19:11484043-11484065 GCAGGGGGGTCTCGCCGGTGTGG 0: 1
1: 0
2: 0
3: 8
4: 89
1162573174_1162573192 23 Left 1162573174 19:11483997-11484019 CCTCCCACCCAATCCTCTAGCGG 0: 1
1: 0
2: 0
3: 7
4: 146
Right 1162573192 19:11484043-11484065 GCAGGGGGGTCTCGCCGGTGTGG 0: 1
1: 0
2: 0
3: 8
4: 89
1162573176_1162573192 20 Left 1162573176 19:11484000-11484022 CCCACCCAATCCTCTAGCGGCAC 0: 1
1: 0
2: 1
3: 7
4: 54
Right 1162573192 19:11484043-11484065 GCAGGGGGGTCTCGCCGGTGTGG 0: 1
1: 0
2: 0
3: 8
4: 89
1162573190_1162573192 -10 Left 1162573190 19:11484030-11484052 CCTGTCACTCACTGCAGGGGGGT 0: 1
1: 0
2: 1
3: 27
4: 110
Right 1162573192 19:11484043-11484065 GCAGGGGGGTCTCGCCGGTGTGG 0: 1
1: 0
2: 0
3: 8
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162573192 Original CRISPR GCAGGGGGGTCTCGCCGGTG TGG Exonic
900101500 1:964048-964070 GGAGTGGGGTCTCCACGGTGGGG - Intronic
900183995 1:1324625-1324647 GCAGGCGGGCCTCGCGGGTCCGG - Exonic
900880507 1:5377971-5377993 TCAGGGGGCTCTGGCTGGTGGGG + Intergenic
901098475 1:6701544-6701566 GCGGGAGGGTCTGGGCGGTGGGG + Intronic
901551313 1:9997714-9997736 GGAGGGGGGTCCGGCCGGGGAGG + Intronic
902919227 1:19656582-19656604 GCAGGGGGATCGCGGCGGTGGGG + Intronic
912409020 1:109467019-109467041 GCCGGGGGGTCAGGGCGGTGGGG - Intronic
922416638 1:225428135-225428157 CCCGGGCGGCCTCGCCGGTGGGG - Intronic
923783065 1:237042653-237042675 GCAGCGGGGACTCGCGGGCGGGG + Intronic
1067221437 10:44346991-44347013 GCAGGGGAGTATCATCGGTGTGG + Intergenic
1067478063 10:46579134-46579156 GCAGGCTGGTCTCGCCGGTCTGG - Exonic
1067616677 10:47762653-47762675 GCAGGCTGGTCTCGCCGGTCTGG + Intergenic
1067751529 10:48974972-48974994 GCAGGCGGGTCACGTGGGTGAGG - Exonic
1071231856 10:83597354-83597376 GCAGAGGGCACTCCCCGGTGTGG - Intergenic
1072453174 10:95555281-95555303 GCAGGGGGGCCTGGCCTTTGGGG + Intronic
1074377815 10:112952823-112952845 GCAGGGGGCACAGGCCGGTGGGG - Intronic
1077419488 11:2443954-2443976 GCAGCGCGGTCTCGACGGTGGGG + Intergenic
1077551247 11:3201233-3201255 GCAGCAGGGGCTCGCTGGTGTGG + Intergenic
1081755020 11:45538333-45538355 GCAGAGAGGTATTGCCGGTGGGG + Intergenic
1083260335 11:61518989-61519011 GCAGTGGGGTCTGGAAGGTGGGG + Intronic
1084411016 11:69005907-69005929 GCAGGAGGCTCACGCCGGTAAGG + Exonic
1091738204 12:2940766-2940788 GCAGGTGGGACTTGTCGGTGGGG - Exonic
1103984574 12:124758699-124758721 GATGAGGGGTCTCGCCGGTGCGG - Intergenic
1113909261 13:113834490-113834512 TCCGGGGGCCCTCGCCGGTGGGG - Intronic
1116677061 14:47919872-47919894 GCAGGGCGGTCCCACCAGTGAGG + Intergenic
1122633846 14:103121293-103121315 GCAGGGGGCTCTGCCTGGTGGGG - Intergenic
1125796731 15:42409022-42409044 GGAGGGGGCTCTTGCAGGTGGGG + Intronic
1132418022 15:101638275-101638297 GTGGGGGGGTCTCACTGGTGAGG - Intronic
1132571907 16:647904-647926 GCTGGGGGGTCTCTCCTGGGGGG - Intronic
1133848781 16:9481940-9481962 GCAGGGGGCTCTGAGCGGTGGGG + Intergenic
1134038889 16:11052794-11052816 GCGGGGGGATCTCCCAGGTGGGG - Intronic
1136564579 16:31062255-31062277 GGAAGGGGCGCTCGCCGGTGTGG + Exonic
1136628499 16:31476266-31476288 GGAGTGGGGTATCGCGGGTGGGG - Intronic
1139322017 16:66122533-66122555 CCAGGGGGGTCTCTCAGGAGGGG + Intergenic
1140799328 16:78470822-78470844 GCAGTGGGGTCTTGCTGGTCGGG - Intronic
1144484174 17:15651396-15651418 GCAGGGGGATCCTGCTGGTGAGG - Exonic
1146832200 17:36079894-36079916 GCAGGCGGATCTCTCCGGTCAGG + Intergenic
1147407052 17:40219628-40219650 GGAGAGGGGTCTTGCGGGTGGGG + Intronic
1148554378 17:48569486-48569508 GCAGGGGCGTCTAGGGGGTGGGG + Intronic
1156451021 18:37266569-37266591 GCAGGGGGTCCGCGGCGGTGGGG + Exonic
1159911031 18:74147175-74147197 GCAGGTTGGTCTGGCGGGTGGGG - Intronic
1160452453 18:78974532-78974554 GCCGGGTGGGCTCGCCGGCGTGG - Intergenic
1160999936 19:1905509-1905531 CATGGGGGGTCTCGGCGGTGAGG + Intronic
1161210199 19:3061995-3062017 GGAGGGGGGTCGCGCCGGGCTGG + Intronic
1162068786 19:8141616-8141638 GCAGAGGGGTCAGGCTGGTGAGG - Intronic
1162573192 19:11484043-11484065 GCAGGGGGGTCTCGCCGGTGTGG + Exonic
1163444259 19:17337648-17337670 GCACGTGGGCCTCGCAGGTGGGG + Exonic
1166141851 19:40809468-40809490 GCAGGTGGGTGTCGAGGGTGAGG + Intronic
1166185667 19:41137299-41137321 GCAGGTGGGTGTCGAGGGTGAGG - Intergenic
1167368364 19:49066157-49066179 GCAGGAGGGTGTCCCCGGTTAGG + Intergenic
929539650 2:42810149-42810171 GCAGGCGGGCCTCGCCGCGGTGG - Intergenic
930424298 2:51193974-51193996 GCAGGGAGGACCCGCCAGTGAGG + Intergenic
939808445 2:146803874-146803896 GCAGGGGGATCTCGGGGGAGAGG + Intergenic
943589792 2:189783939-189783961 GCAGGGGGGACTCCCCTGAGGGG - Intronic
946315600 2:218909337-218909359 GCAGGGGGGCGTCGCCAGTCCGG - Intergenic
948485553 2:238278748-238278770 GCAGAGGGGCCTGGCAGGTGTGG + Intronic
1171223204 20:23420485-23420507 GCAGGTGGGCCCCGCCGGGGAGG - Intronic
1173334553 20:42102011-42102033 GCAGGGGGGGCTGGCTGGTGGGG + Intronic
1173864905 20:46307591-46307613 CAGGGGGGGTCGCGCCGGTGGGG + Intronic
1176074356 20:63241730-63241752 TCAGTGGGGTCTGGCCTGTGGGG + Intronic
1176510628 21:7745205-7745227 GCAGGGGCGCCCCGCAGGTGGGG - Intronic
1178644741 21:34375734-34375756 GCAGGGGCGCCCCGCAGGTGGGG - Exonic
1180866538 22:19122781-19122803 GCCGAGGGGTCGCGCGGGTGGGG + Intergenic
1181084798 22:20434882-20434904 GCAGGAGGGTCGGGCTGGTGTGG - Intronic
1182089735 22:27585933-27585955 GCAGGGGGGTGTCGTGGATGTGG + Intergenic
1182194943 22:28506336-28506358 GCAGGGAGGTCCTGCCTGTGAGG - Intronic
1182430135 22:30294397-30294419 GCTGGAGGGTCTCGCCTGTCAGG + Intronic
1184510188 22:44928887-44928909 GCAGTGGGGCCTCAGCGGTGAGG - Intronic
1184697857 22:46150070-46150092 GCAGGAGGGGCTCGCCAGCGTGG + Intergenic
969575883 4:8035440-8035462 GCATGGGGGGCTCCCCGGGGTGG - Intronic
975628837 4:76378964-76378986 GCAGGGGGATCTGGCTGGTATGG + Intronic
982129184 4:152212106-152212128 GCAGGGAGCTCTTGACGGTGTGG - Intergenic
987034193 5:14003932-14003954 GCATGGGGGTCTCTCCTATGGGG - Intergenic
998428295 5:142048602-142048624 CCAGAGGGGTCTCTCAGGTGAGG + Intergenic
1001752552 5:174142688-174142710 CTAGGGGGGTCTCCCAGGTGGGG + Intronic
1007759742 6:44127155-44127177 GGAGGGGGGTCCCGACGGGGAGG - Intronic
1010669899 6:78674896-78674918 GCAGGGGGGTTTAGGGGGTGGGG + Intergenic
1014818159 6:125957237-125957259 GCAGGGAGGCCTCGCCGTTGTGG + Intronic
1017164041 6:151391177-151391199 GCAGGGGCGCCTCGCGGGGGCGG - Intronic
1019431452 7:1001600-1001622 GGTGGGGGGTCCTGCCGGTGGGG + Intronic
1019932816 7:4234851-4234873 GCAGGGAGGCCTCGGCGTTGGGG + Intronic
1020089897 7:5333128-5333150 GCGGGGAGGTCCCGCCGGGGAGG - Intronic
1023042151 7:36181226-36181248 GCAGTGGGGTGTGGCGGGTGGGG - Intronic
1024985124 7:55187798-55187820 GCAGGTGGGTCTCTGGGGTGGGG + Intronic
1029746414 7:102517785-102517807 GCAGGGGGGGCGGGCCGGGGAGG + Intergenic
1030121160 7:106112106-106112128 GCAGGCGGGCCTGGCCGGCGCGG + Intronic
1035459192 7:159028928-159028950 GCAGAGGGGTGTGGCCGGCGTGG + Exonic
1037749562 8:21672235-21672257 GCAGGAGGGTCTCGAGGCTGGGG + Intergenic
1041465577 8:58154749-58154771 GCATGGCGGTCTCTCCTGTGTGG - Intronic
1045516255 8:102863498-102863520 GCGCGGGGGTCTCGCCGCCGGGG - Intronic
1047259133 8:123240831-123240853 GCAGGGGGAGCTCGCCGAAGAGG + Intronic
1055783229 9:79842868-79842890 GCAGGGCTGTCTTGCCAGTGGGG - Intergenic
1057269616 9:93643458-93643480 CCAGGGGGGACTAGACGGTGAGG - Intronic
1057274802 9:93670542-93670564 GCAGGGGGTTGTGGGCGGTGGGG + Intronic
1060065921 9:120501110-120501132 TCAGGGGGGTCTAGCTGATGGGG - Intronic
1062424696 9:136500689-136500711 GCAAGGCGGTCTCGCCCGTGCGG + Exonic
1187690096 X:21857396-21857418 GAAAGGGCTTCTCGCCGGTGTGG - Exonic
1198000804 X:132433742-132433764 GCAGGGAGGTCCCGGGGGTGGGG - Intronic