ID: 1162573251

View in Genome Browser
Species Human (GRCh38)
Location 19:11484359-11484381
Sequence GCACACTACCAAGCCAACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 85}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162573242_1162573251 26 Left 1162573242 19:11484310-11484332 CCATCAAGCAGAACTGAGATCGA 0: 1
1: 0
2: 1
3: 6
4: 78
Right 1162573251 19:11484359-11484381 GCACACTACCAAGCCAACATGGG 0: 1
1: 0
2: 0
3: 8
4: 85
1162573249_1162573251 -6 Left 1162573249 19:11484342-11484364 CCTGAGAGGCATAGGGTGCACAC 0: 1
1: 0
2: 1
3: 12
4: 277
Right 1162573251 19:11484359-11484381 GCACACTACCAAGCCAACATGGG 0: 1
1: 0
2: 0
3: 8
4: 85
1162573248_1162573251 -5 Left 1162573248 19:11484341-11484363 CCCTGAGAGGCATAGGGTGCACA 0: 1
1: 0
2: 0
3: 9
4: 134
Right 1162573251 19:11484359-11484381 GCACACTACCAAGCCAACATGGG 0: 1
1: 0
2: 0
3: 8
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162573251 Original CRISPR GCACACTACCAAGCCAACAT GGG Intronic
905045080 1:34991108-34991130 GCACTTTGGCAAGCCAACATGGG - Intronic
905085838 1:35375827-35375849 GCACTTTAGGAAGCCAACATTGG + Intronic
909040876 1:70649913-70649935 GCCCAGTTCCAAGCCAACAGAGG + Intergenic
912383627 1:109260666-109260688 TCACACTACCAAGCACACCTGGG - Intronic
913506215 1:119518182-119518204 GCACACCACCAAGCCCTGATTGG - Intergenic
915674718 1:157519465-157519487 TCAGACAACCAAGCCAACAATGG + Intronic
923204656 1:231746857-231746879 GCAAACTACCCATCCAACAGGGG - Intronic
1070550569 10:77487888-77487910 GCACAGTACCAGCCCAACCTGGG - Intronic
1071436217 10:85650197-85650219 CCAGACTGCCAAGCCAACAGTGG + Intronic
1072270248 10:93769326-93769348 GCACACTCCCAAGTGAACATGGG - Intronic
1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG + Intronic
1082185210 11:49171331-49171353 GGACACTACCAAGCCCAGATTGG + Intronic
1083370953 11:62180246-62180268 GCACACTACGCATCCAACAAAGG - Intergenic
1085259533 11:75196353-75196375 GCTCACTATCACGCCATCATCGG + Intronic
1086681122 11:89674011-89674033 GGACACTACCAAGCCCAGATTGG - Intergenic
1089134128 11:116235618-116235640 TCAAACTTCCAAGCCTACATTGG + Intergenic
1091711048 12:2740835-2740857 GCACTCTAGAAAACCAACATAGG - Intergenic
1092389683 12:8064958-8064980 GCACACTGTGAGGCCAACATGGG - Intronic
1093060917 12:14602589-14602611 GCAAATTACCAATCCAACATGGG - Intergenic
1095465762 12:42486620-42486642 ACACAGTACAAAGCCAACTTTGG + Intronic
1100881427 12:99022055-99022077 GAACTCTACCTAGACAACATGGG + Intronic
1103422056 12:120794312-120794334 GCACACTATAAAGCCAAAAAAGG - Intronic
1110542119 13:76718513-76718535 GCACACTATAAGGCCAACCTAGG + Intergenic
1113800790 13:113085401-113085423 GCACACAGCCCAGCCCACATGGG + Intronic
1114368473 14:22057172-22057194 GCACACTACACATCCAACAAAGG + Intergenic
1115589298 14:34848194-34848216 GCATTCTACCAATGCAACATAGG + Intronic
1116080577 14:40165519-40165541 GCACACTACCCATCTAACAAGGG + Intergenic
1116489458 14:45489150-45489172 GCAAACTACCAATCTAACAAGGG - Intergenic
1129582569 15:76828100-76828122 GCAGAGTCCCAAGACAACATAGG - Intronic
1133526149 16:6607680-6607702 GCACACTCACATGCCCACATAGG - Intronic
1134105110 16:11479741-11479763 GCAAACTAACAAACCAACACTGG + Intronic
1136086576 16:27889679-27889701 CCACACTACAAAGCCCCCATGGG + Intronic
1146802287 17:35835274-35835296 GCAGACTACCAATCCAACGTAGG - Intronic
1147486087 17:40816000-40816022 GCAAAATATCAAGCCATCATGGG + Intergenic
1158412927 18:57223551-57223573 GCAGACTACCAAGACAGCAGAGG - Intergenic
1162573251 19:11484359-11484381 GCACACTACCAAGCCAACATGGG + Intronic
925722021 2:6838780-6838802 GAACACCGCCAAGCCAAAATAGG + Intergenic
926687308 2:15708249-15708271 TCAACCTTCCAAGCCAACATGGG + Intronic
927075493 2:19572899-19572921 GTACACTCCCAGGCCCACATAGG + Intergenic
927864533 2:26580210-26580232 CCACCCTACCAAGCCAGCCTAGG - Intergenic
930722093 2:54647590-54647612 GCACTTTACCAAGCCAAGGTGGG + Intronic
935283364 2:101539591-101539613 GCAGACTCCCAAGCCAGAATAGG + Intergenic
939891013 2:147736193-147736215 GCAAACTACCCATCCAACATGGG + Intergenic
940762215 2:157750567-157750589 GCGCCCTACCAACCCAATATAGG + Intronic
942239695 2:173949439-173949461 GCACACTGCCAAGACACTATAGG + Intronic
943677873 2:190734409-190734431 GCAAATTACCAAGTTAACATTGG - Intergenic
944024743 2:195150286-195150308 GCATGCTACCAAGCCCACAGTGG + Intergenic
945684622 2:212953917-212953939 GCACACTCCCTGGCCACCATAGG + Intergenic
946443239 2:219714759-219714781 GTACTCTTCCAAGCCCACATGGG - Intergenic
947158614 2:227189066-227189088 ACAGAATCCCAAGCCAACATGGG - Intronic
1170410239 20:16081902-16081924 TCACTCTGCCAAGCCCACATGGG + Intergenic
1179472036 21:41617269-41617291 GCACATTACCCAGCCATGATAGG + Intergenic
953285314 3:41600889-41600911 GCACACTCCCAAGGAAACAGAGG + Intronic
954287280 3:49627920-49627942 GCATACTACCCAGCCCACACAGG - Intronic
956468419 3:69541687-69541709 GCACACTGCCTCTCCAACATAGG + Intronic
958065423 3:88539384-88539406 CCACACTACCAAACCCACGTGGG - Intergenic
962883359 3:139600115-139600137 GCACACTATAAAGCCCACTTTGG + Intronic
963039769 3:141060302-141060324 GCACACAACCATGCCAACTGTGG - Intronic
973617910 4:52697960-52697982 GCAAACTATCCATCCAACATAGG + Intergenic
978640161 4:110861137-110861159 GCACAATAACAGGCCAACAGTGG - Intergenic
980540131 4:134182694-134182716 GCAAACTACTAATCCAACAGAGG + Intergenic
982097331 4:151934948-151934970 GCACACATCCAAAGCAACATGGG - Intergenic
982510156 4:156272467-156272489 GCAAACTAACAATCCAACAAAGG - Intergenic
988475676 5:31583234-31583256 TCCCAGTACCAAGCCAATATTGG + Intergenic
988637921 5:33007544-33007566 GAACACTACCAAGATAACGTTGG - Intergenic
989755479 5:44948150-44948172 GCACACTGCCTTCCCAACATAGG - Intergenic
992681747 5:79160353-79160375 GCAAACTACCCATCCAACAAAGG + Intronic
996645060 5:125804163-125804185 GCTCACTTCCAAGCCACCATGGG + Intergenic
996981623 5:129502635-129502657 GCACACAAGGAAGCCAACATTGG + Intronic
1000820404 5:165975672-165975694 GCAGACTCCCAAGCCAGAATAGG - Intergenic
1001111989 5:168904207-168904229 GCTGACTACCATGCCAACTTGGG + Intronic
1008771141 6:54980167-54980189 GCAGGCTGCCGAGCCAACATTGG + Intergenic
1010278737 6:73999247-73999269 GCACTCTACGAATCCAACAAAGG - Intergenic
1012793241 6:103727154-103727176 GCAGACTACCCATCCAACAAGGG - Intergenic
1013563079 6:111326222-111326244 GCAAACTACCCATCTAACATGGG + Intronic
1014091883 6:117413383-117413405 CCACCATACCCAGCCAACATAGG + Intronic
1014861418 6:126471801-126471823 GAACATTACCAAACCATCATAGG - Intergenic
1017021257 6:150142576-150142598 GGACGCTACCCAGCCAACAGAGG + Intergenic
1019054247 6:169211371-169211393 GCAAACTACCCATCCAACAAGGG + Intergenic
1019226774 6:170518177-170518199 GAACACTATCAAGCTAACAGTGG + Intergenic
1020005861 7:4783523-4783545 CCACACTCCCAACCCACCATGGG - Intronic
1020130404 7:5556039-5556061 GCACACCATCAAGCAAACACCGG + Intronic
1025135251 7:56406402-56406424 GCATACTACCAAGCAGACCTAGG - Intergenic
1028284251 7:88975675-88975697 GCAAACTACCCATCCAACAAAGG - Intronic
1039640435 8:39214590-39214612 GCAAACTACCCATCCAACAAGGG - Intronic
1040768894 8:50949735-50949757 GCAAACTAGGAAGCCCACATGGG + Intergenic
1048433261 8:134390415-134390437 TCACACCACCAAGCCCACACAGG + Intergenic
1048997932 8:139805527-139805549 GCACAGTGCCAAGCCCACACTGG - Intronic
1060228340 9:121809581-121809603 GTACACCAACAAGCCCACATGGG + Intergenic
1188915569 X:35905480-35905502 GCAAACTACCAATCTGACATGGG - Intergenic
1197056278 X:122123587-122123609 GCAAAGTACCCAGCCAAGATTGG + Intergenic
1197973473 X:132139703-132139725 GCAAACTATGCAGCCAACATGGG - Intergenic
1200157848 X:153987001-153987023 GCACGTCACCAAGCCAAAATGGG - Intergenic
1201051267 Y:9938085-9938107 GCACACACTTAAGCCAACATGGG - Intergenic