ID: 1162576295

View in Genome Browser
Species Human (GRCh38)
Location 19:11500949-11500971
Sequence CAGAAGTTGGAGAAGTGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 356}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162576295_1162576299 4 Left 1162576295 19:11500949-11500971 CCTGTCCACTTCTCCAACTTCTG 0: 1
1: 0
2: 0
3: 39
4: 356
Right 1162576299 19:11500976-11500998 TTCTCTGTGACTCCCAGCAGAGG 0: 1
1: 0
2: 5
3: 28
4: 255
1162576295_1162576300 11 Left 1162576295 19:11500949-11500971 CCTGTCCACTTCTCCAACTTCTG 0: 1
1: 0
2: 0
3: 39
4: 356
Right 1162576300 19:11500983-11501005 TGACTCCCAGCAGAGGCCACTGG No data
1162576295_1162576303 19 Left 1162576295 19:11500949-11500971 CCTGTCCACTTCTCCAACTTCTG 0: 1
1: 0
2: 0
3: 39
4: 356
Right 1162576303 19:11500991-11501013 AGCAGAGGCCACTGGCATCAAGG 0: 1
1: 0
2: 8
3: 60
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162576295 Original CRISPR CAGAAGTTGGAGAAGTGGAC AGG (reversed) Intronic
903234448 1:21940557-21940579 CTGAATTTGGAGGAGTGGACAGG - Intergenic
905175522 1:36132972-36132994 CAGAAGTTCGAGACCTGGCCTGG + Intergenic
905489117 1:38329664-38329686 CAAAAGTTGGACCAGTGGTCAGG - Intergenic
905835033 1:41111313-41111335 ATGATGTTGGAGAAGTGGACAGG - Intronic
905984848 1:42270597-42270619 AAGAAGTTGGTGAAGTGGAGAGG + Intronic
906399464 1:45494484-45494506 CAGAAGCTGGAGATGAGGAAAGG + Intronic
907249915 1:53131193-53131215 CAGAAGGTGGAGAGCTGGACGGG + Intronic
907287385 1:53390536-53390558 CAGAAGGAGGAGAAGGGGAGTGG + Intergenic
907937439 1:59055380-59055402 CTGAAGTTGGAGAAGTTAGCAGG + Intergenic
908550494 1:65203906-65203928 CAGATTTTGGAGAGATGGACAGG + Intronic
909679709 1:78278213-78278235 GAGAAGATGGAGAGGTAGACAGG + Intergenic
911730017 1:101283112-101283134 TAGAAGTTGGATAGGTGGAGAGG + Intergenic
912830333 1:112947267-112947289 CAGAATTTGAAGAAATGTACTGG + Intronic
914887056 1:151594045-151594067 CAACAGTTAGAGAAGTAGACAGG - Intergenic
915156968 1:153885051-153885073 CAGAAGATGGAGAACAGGGCCGG - Intronic
915332835 1:155124424-155124446 CAGAAGTTGGAAAATAGGCCGGG - Intergenic
915928293 1:160041187-160041209 CAGAAGCTGGGGAAGTGGAAAGG + Exonic
915943876 1:160136001-160136023 CAGGAGGTGGAGGAGGGGACAGG + Intronic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
918528053 1:185486578-185486600 CAGAGCCTGGAGAAGTGGAATGG + Intergenic
918528192 1:185487852-185487874 CAGAGGTTGGAAAGGTGGATGGG + Intergenic
918570080 1:185979952-185979974 CTGAAGTTGAAGAGGTGGGCTGG - Intronic
920356228 1:205375250-205375272 CAGCAGTGGGAGAATTGGCCTGG + Intergenic
921013939 1:211169870-211169892 CAGAAGTTGGAAAAGTGTGGAGG - Intergenic
921691844 1:218160647-218160669 CAGAAGGAAGAGAAGTGGAGAGG - Intergenic
921810846 1:219511918-219511940 CAGAGGTAGGAGATGTGGAGAGG + Intergenic
921966663 1:221097781-221097803 CTGAAGCTGGTGAAATGGACTGG + Intergenic
922612562 1:226940977-226940999 CAGAGTTTGGAGAAGAGGAAAGG - Intronic
923326074 1:232881276-232881298 CAGGGGTTGGGGAAGTGGAGAGG - Intergenic
923532425 1:234822016-234822038 CAGACATTGGAGAAGTGCAGTGG - Intergenic
924068668 1:240254105-240254127 CAGCAGTGGAAGAAGTGGGCTGG + Intronic
924517808 1:244780822-244780844 AAGAAGGTAGAGAAGTGGAGTGG - Intergenic
1063857885 10:10275075-10275097 CAGGGTCTGGAGAAGTGGACAGG - Intergenic
1064654734 10:17545851-17545873 CAGAAGTTGGGAAAGGGAACAGG + Intergenic
1065217848 10:23467469-23467491 GTGAAGTTGGAGATGTGGGCAGG + Intergenic
1066413115 10:35192921-35192943 CAAAAGAGGGAGAAGTGGAGAGG - Intronic
1066468296 10:35672273-35672295 CAGAAGTTGGAGGTAGGGACAGG + Intergenic
1067016349 10:42758608-42758630 CAGGAGTTGGTGAAGGGGACAGG - Intergenic
1067935894 10:50611876-50611898 CAGGAGTTGGAAAAGGGGATGGG - Intronic
1068351145 10:55847180-55847202 CAAAAGTTGGAGAATGGGCCTGG + Intergenic
1069740154 10:70682208-70682230 CAGAAGAAAGAGAAGAGGACCGG + Intronic
1069872929 10:71544205-71544227 CAGATGCAGGAGAGGTGGACGGG + Intronic
1070740867 10:78902465-78902487 CAGAAGTCAGAGAAGAGGATGGG - Intergenic
1071053564 10:81480880-81480902 TAGAAGTTGCAAAAGTGGCCGGG + Intergenic
1071519412 10:86319721-86319743 CAGAAGTTGCTGACGAGGACAGG + Intronic
1072557168 10:96528807-96528829 ATGAAGTTGGAGAAGTGAACAGG + Intronic
1072586330 10:96786121-96786143 TAGAAGTAGAAGCAGTGGACAGG - Intergenic
1073856931 10:107687070-107687092 CAGAAGTTGAAGATATGGATCGG + Intergenic
1078631230 11:13006577-13006599 GAGAAGCTGGAGAAGTGGGCTGG + Intergenic
1078631379 11:13007797-13007819 CTGAAGTTGGATAATTGAACAGG - Intergenic
1078652634 11:13209941-13209963 CAGAAGGTGGAAAGGAGGACTGG - Intergenic
1078762158 11:14260049-14260071 CAGGAGTGGGAGGAGTGGGCTGG - Intronic
1079190202 11:18270628-18270650 CAGGAGGTCGAGAAGGGGACAGG - Intergenic
1079398395 11:20085741-20085763 CAGAATGTTGAGCAGTGGACTGG - Intronic
1079536457 11:21520813-21520835 CAAATGTTGGAGGAGTGGTCAGG - Intronic
1081594501 11:44449977-44449999 CAGAAGTTGGAGAAGGAAAAAGG + Intergenic
1081747299 11:45482192-45482214 CAGAAGTCAGAGTAGTGGGCAGG + Intergenic
1083896820 11:65624225-65624247 CAGCAGATGCAGAAGTAGACAGG - Exonic
1083897046 11:65625195-65625217 CAGAAGACTGAGAAGAGGACAGG - Exonic
1084410118 11:69002002-69002024 CAGGAGTTGGTGCAGTGGCCTGG - Intergenic
1084694135 11:70743936-70743958 CAGAAGGAGGTGCAGTGGACGGG - Intronic
1085204534 11:74722840-74722862 CAGAAGTTGGAGGAGAGAATGGG + Intronic
1085601111 11:77856792-77856814 CCAATGTTGGAGAAGGGGACTGG - Intronic
1085649270 11:78252652-78252674 CTGAAGCTGTGGAAGTGGACAGG - Intronic
1086609023 11:88731206-88731228 ATGAAGCTGGAGAAGTGGGCAGG - Intronic
1087194074 11:95287136-95287158 AAGAAGTTTAAAAAGTGGACAGG - Intergenic
1088238829 11:107753073-107753095 CATCAGATGGAGAACTGGACAGG + Intergenic
1091074939 11:132606641-132606663 CAGAAGTGGGAAAAGGGGAGAGG - Intronic
1091146087 11:133281653-133281675 CAGAAGTTGGAAGAGTGTAGAGG + Intronic
1091797120 12:3303792-3303814 CAGATGTTGGAGGGGTGGGCCGG + Intergenic
1092317959 12:7439881-7439903 AAGGAGTTGGAGTAGTGGGCGGG - Intronic
1094551154 12:31452994-31453016 CAGATGTTAGAGCAGTGGAGTGG - Intronic
1095350070 12:41199843-41199865 CAGATGTTGAAGATGTGGAAGGG + Intronic
1096192715 12:49630859-49630881 TAGAGGTAGGAGAAGTGGAAGGG + Intronic
1096455334 12:51780345-51780367 CACAAGTTGGAAAAGGGGAGAGG - Intronic
1096939976 12:55332769-55332791 TAGAAGTGGAAGAAATGGACTGG - Intergenic
1098416452 12:70240622-70240644 GGGAAGATGGAGAAGTGGGCAGG + Intergenic
1099033571 12:77559256-77559278 CACATGTTGGAGGAGTGGCCTGG - Intergenic
1099673751 12:85730189-85730211 CTGAAGTTGGAGTAAAGGACTGG - Intergenic
1099885563 12:88525981-88526003 TAGAATTTGGATAAGTGGATGGG + Intronic
1100289899 12:93203811-93203833 CTGAGGTTGGAGAAGTGGTATGG - Intergenic
1100371630 12:93974131-93974153 CAGTAGTTGGATAATTAGACTGG - Intergenic
1100510082 12:95262046-95262068 AAGGAGTTGGAGAAGTGGGATGG - Intronic
1100573025 12:95860522-95860544 AAGAAGTTGGAGATGGGGAGGGG - Intronic
1101531764 12:105580098-105580120 AAGAGGTTGGACAAGTGGCCCGG + Intergenic
1101545686 12:105710284-105710306 ATGAAGTTGGAGAAGTAGGCAGG - Intergenic
1101762727 12:107672100-107672122 CTGAAGTGGGAGAAGTGGGGAGG + Intergenic
1102742540 12:115221182-115221204 CCACAGTTGGAGAAGTGGTCAGG - Intergenic
1103076224 12:117985005-117985027 AAGAAGTTGCAGAATTGGAGGGG + Intergenic
1103763938 12:123269065-123269087 GAGCAGTTGGGGAAGAGGACGGG - Intronic
1103882247 12:124175103-124175125 CAGAAGTTGGTGATGATGACAGG + Intronic
1106142025 13:27019596-27019618 CAGAATTTGGGGAATGGGACAGG - Intergenic
1108800838 13:54092760-54092782 CAGTAATTGGAAAAGTGGCCAGG - Intergenic
1111986488 13:95071290-95071312 CAGAAGCTGCAGCAGTGGAGGGG + Intronic
1112746678 13:102534654-102534676 AAGAAGTTGGAGAAGTACATGGG + Intergenic
1113997074 14:16097441-16097463 CAGAATGTGGAGATGTGGAGTGG - Intergenic
1114069099 14:19094168-19094190 CAGGAGTTGGTGAAGGGGACAGG + Intergenic
1114093161 14:19305835-19305857 CAGGAGTTGGTGAAGGGGACAGG - Intergenic
1115160479 14:30388114-30388136 GAGAAGTTGGAAAAGTACACAGG - Intergenic
1115616830 14:35103222-35103244 ATGAAGTTGGAGAAGTAGGCAGG - Intronic
1116364243 14:44040099-44040121 CAGAAGTTGGAAAAGTGTGGAGG + Intergenic
1116937982 14:50761753-50761775 AAGAAATTAGAGAAGTGGATTGG + Intronic
1116957979 14:50943844-50943866 AAAAAGTTTGTGAAGTGGACAGG + Intronic
1117268184 14:54112965-54112987 CCAAAGTTGGAGAAGGGGCCTGG + Intergenic
1118907135 14:70031359-70031381 CAGGAGATGGAGGAGTGGAGAGG - Intronic
1119404170 14:74386319-74386341 CTGAGGTTGGAGAGGTGGATGGG + Intergenic
1119574618 14:75708179-75708201 TAGAGGTGGGAGAAGTGGAATGG + Intronic
1119829160 14:77685566-77685588 CAGAAGTTGGAGAACCAGCCTGG + Intronic
1119946775 14:78703689-78703711 CTGAAGTTGGAGAAATGGAATGG - Intronic
1120281437 14:82443615-82443637 GAGAAGATGGAGAAGGGGAAGGG - Intergenic
1120785751 14:88534074-88534096 CAGAAGTTTAAAAAGTGGCCGGG + Intronic
1121686628 14:95840263-95840285 CAGAAGTTGGAGCTGGGGACAGG - Intergenic
1121926094 14:97928604-97928626 CAGAAGATGAAGAAGGGAACAGG + Intronic
1125242508 15:37592133-37592155 CAGCACTTGGCGAAGTGGAAGGG + Intergenic
1125736085 15:41926859-41926881 CTGTAGTTGGAGAAGAGGAAAGG - Intronic
1127890217 15:63243684-63243706 CAGAATTTGGGGAAGGGGGCAGG + Intronic
1127918186 15:63472485-63472507 TAGAAGGTGGGGAAGTGGGCTGG + Intergenic
1128220947 15:65968170-65968192 CAGAAGGAGGAGAAGTAGAATGG + Intronic
1128333141 15:66769420-66769442 CAGATGATGGAGAGGTGAACTGG - Intronic
1128456480 15:67834228-67834250 CAGGAGTTTCAGAAGTGGACGGG - Exonic
1128687229 15:69695815-69695837 TGGAAGTTGGAGAAGAAGACAGG - Intergenic
1128812244 15:70581074-70581096 CAGAAGTGTGAGGAATGGACAGG + Intergenic
1128985038 15:72213727-72213749 AAGAAGTTGAAAAAGTGGGCTGG - Intronic
1129143966 15:73631897-73631919 GAGAAGATGGAGAAGTGGTGGGG - Intronic
1129526085 15:76215510-76215532 CAGAAGTAGGAGTAGTGACCTGG - Exonic
1130551706 15:84893611-84893633 GACCAGCTGGAGAAGTGGACAGG - Intronic
1130610924 15:85360290-85360312 CAGAGGCTGGAGAGTTGGACAGG + Intergenic
1131106224 15:89736696-89736718 CAGGAGGTGGGGGAGTGGACAGG + Intronic
1131302411 15:91211062-91211084 ATGAAGTTGGAGAGGTGGGCAGG + Intronic
1131940485 15:97559601-97559623 CAGAAGATGTAGAAGTGGTATGG - Intergenic
1132196255 15:99916687-99916709 CAGAAGTTAGACAAGAGGCCTGG + Intergenic
1132541998 16:514536-514558 GAGAAGATGGAGGAGTGGAGAGG + Intronic
1134522436 16:14924797-14924819 CAGGCGTGGGAGGAGTGGACAGG + Intronic
1134591728 16:15460129-15460151 TAGAAGTTGGAGAAGGGTAGGGG - Intronic
1134710106 16:16323448-16323470 CAGGCGTGGGAGGAGTGGACAGG + Intergenic
1134949497 16:18345197-18345219 CAGGCGTGGGAGGAGTGGACAGG - Intergenic
1135345067 16:21681892-21681914 GGTAAGTTGGAGAAGTGGGCTGG + Intronic
1135527941 16:23228285-23228307 CAAAAGTAGGAAAAGTGGAGGGG - Intergenic
1136663709 16:31789682-31789704 CAGAGGTTGAAGAGGTGGCCAGG + Intronic
1136777230 16:32878522-32878544 CAGAACCTGGAGAGGTGGGCAGG + Intergenic
1137571097 16:49566803-49566825 CAGAAGTTAGAGAAGGGGAGGGG + Intronic
1138609510 16:58111480-58111502 CAGGAGGTGGAGAAGTGGAGGGG - Intergenic
1140750809 16:78021890-78021912 CAGGAGTTCGAGAAGAGCACGGG - Intergenic
1140787765 16:78360287-78360309 TAGAAGTTGGAGAAGTAGGCTGG + Intronic
1140997065 16:80271466-80271488 CAGAAGTTGGGAAAGAGGCCTGG + Intergenic
1144619966 17:16812235-16812257 CATAAGTTAGATAAGTGTACCGG + Intergenic
1144877714 17:18411095-18411117 CAGAAGGTGGGGAAGAAGACTGG - Intergenic
1144892721 17:18503469-18503491 CATAAGTTAGATAAGTGTACCGG - Intergenic
1145139492 17:20440818-20440840 CATAAGTTAGATAAGTGTACCGG + Intergenic
1145154515 17:20533308-20533330 CAGAAGGTGGGGAAGAAGACTGG + Intergenic
1145831608 17:27920884-27920906 CAGAAGTTGGGGAGGTGAATTGG + Intergenic
1145889291 17:28403801-28403823 CAGGAGTTAGAGACCTGGACTGG + Exonic
1146224271 17:31052164-31052186 CAAAAGTTGGACAAGAGGAGAGG - Intergenic
1146393103 17:32441023-32441045 TCGAAGTTGGAGAAGTAGGCAGG + Intergenic
1146456899 17:33015652-33015674 CAGCAGGGGGAGAACTGGACAGG - Intronic
1146709827 17:35031400-35031422 CAGAAGTTAGTGAATTGGCCAGG - Intronic
1146711016 17:35041500-35041522 CATGAATTGGAGAAGTGGTCAGG - Intronic
1148551437 17:48552653-48552675 CACAAGGGGGAGAAGAGGACTGG + Exonic
1149553927 17:57559734-57559756 CAGAAGCTGGAAAAATGCACTGG - Intronic
1151037169 17:70814133-70814155 CAGAGGCTGGCGAAGTGGTCTGG + Intergenic
1151138649 17:71971260-71971282 TAGAAGATGGAGAAATGGTCTGG + Intergenic
1151176714 17:72294639-72294661 CAGAAGCTGGAAAACTAGACTGG - Intergenic
1151924066 17:77180741-77180763 CAGTATTTGGACAAGTGGACGGG + Intronic
1152232596 17:79121735-79121757 CAGATGTTGGAGAGATAGACAGG - Intronic
1152463662 17:80454276-80454298 CAGAGGTGGGAGAAGAGGTCAGG + Intergenic
1152472736 17:80499380-80499402 CAGCTGTTGGAGACGTGGCCTGG - Intergenic
1153108101 18:1550898-1550920 CAAATGTTGGAGAAGGGGCCTGG + Intergenic
1153592273 18:6686228-6686250 AAGAGGCTGGAGAAGTAGACTGG - Intergenic
1156309220 18:35907445-35907467 CAGAAGTTGCAGATGAGTACTGG - Intergenic
1157392438 18:47314018-47314040 CAGAGGCTGGAGAAGAGGCCAGG - Intergenic
1157393332 18:47321551-47321573 CAGAAGCAGGAGAATTGCACTGG + Intergenic
1158000822 18:52616821-52616843 CAGAAGTTGGAGGTGTGGGAGGG + Intronic
1158179425 18:54697239-54697261 CAGAAGATGCCGAAGTGGCCAGG + Intergenic
1158416544 18:57253919-57253941 CAGAACCTGTAGAAGTGGAGTGG + Intergenic
1158429239 18:57369353-57369375 CAGAGGAAGGAGAACTGGACAGG - Intronic
1158664564 18:59420837-59420859 CAGCTGTGGGAGAAGAGGACCGG - Intergenic
1160297948 18:77654941-77654963 CAGGAGCTGGAGAAGGGGAGGGG + Intergenic
1161086519 19:2338062-2338084 CAGAAGATGGAAAAGGGGCCAGG - Intronic
1161474044 19:4474520-4474542 TAGAAGCTGGAGACGTGGATGGG + Intronic
1162576295 19:11500949-11500971 CAGAAGTTGGAGAAGTGGACAGG - Intronic
1164031806 19:21413918-21413940 CAGCAGTTGCAGAAGGAGACGGG - Intronic
1166135382 19:40773968-40773990 CAGGAAGTGGAGAAGTGGAGAGG - Intronic
1168225757 19:54993836-54993858 CAGAAGTTGGAGAAGTAAAAAGG - Intronic
1168429003 19:56262313-56262335 TAGAAGTTAGAAAAGTGGGCCGG - Intronic
925517134 2:4695409-4695431 CAAAAGTGGGAGAAGGGGGCAGG + Intergenic
926798837 2:16641066-16641088 CAGAAGTGGGAGCAGAGGAGGGG - Intronic
927322725 2:21766592-21766614 CACAAGCTGGAGAAATGGAAAGG + Intergenic
927406696 2:22778464-22778486 CTGAATTTGGACAAGTGGAATGG - Intergenic
928365951 2:30703053-30703075 CTGAAGTTGGAGAACAGGGCAGG + Intergenic
928478396 2:31654957-31654979 CAGAACTTGGAGAAGAAGAAAGG - Intergenic
929041810 2:37751596-37751618 GAGAAGTTGGAGAGGTGGCCAGG - Intergenic
929161413 2:38836275-38836297 CAGAGGTGGAAGAAGTGGAAGGG - Intronic
932710125 2:74056921-74056943 CACAACTTGGAGAAATGGGCTGG + Intronic
933014975 2:77113653-77113675 CAGAAGAGGCAGAAGTGCACTGG + Intronic
933457980 2:82541282-82541304 GAGGAGGTGGAGAAGTGGAGAGG - Intergenic
936823360 2:116551699-116551721 CTGAAATTGCAGAAGTGGAATGG - Intergenic
937636973 2:124167053-124167075 GAGAAGTTAGAGAAGACGACAGG - Intronic
938387224 2:130875487-130875509 CAGCTGGTGGAGAAGTGGAAGGG + Intronic
938487140 2:131723200-131723222 GAGGAGATGGGGAAGTGGACGGG + Intronic
939056398 2:137370091-137370113 CAAAAGTAGGAAAATTGGACAGG + Intronic
939282730 2:140085635-140085657 AAGAGGTTGGAGTAGTGGACTGG - Intergenic
939299156 2:140311503-140311525 TAGACATTGGAGAAGTGGAAGGG + Intronic
939887717 2:147699179-147699201 CAGAATTTGGATGAGAGGACAGG - Intergenic
940451745 2:153845833-153845855 CACAAGTTGTAGAAGTAAACAGG + Intergenic
941525082 2:166597266-166597288 CACATGTTGGAGGAGTGGTCTGG - Intergenic
943636030 2:190307932-190307954 CAGAGTTATGAGAAGTGGACAGG - Intronic
943705826 2:191033159-191033181 CAGAAATTGGAGAAATATACAGG + Intronic
945005125 2:205397026-205397048 CAGTAGTGGCAGTAGTGGACCGG - Intronic
945473656 2:210256236-210256258 CAGAAGATGGACAAGTGAACTGG + Intergenic
945659814 2:212672197-212672219 CAGAAGTTGAAGAAGAAGAAAGG - Intergenic
945891515 2:215435933-215435955 CAGAGGGTGGGGAAGGGGACGGG + Exonic
946385992 2:219384864-219384886 CAGAGATTGGAGAAGGGGGCTGG + Intronic
947401625 2:229736447-229736469 CAGTAGTGGCAGCAGTGGACTGG - Intergenic
947597751 2:231424625-231424647 CAGAGGTTTGAGAAGTGCAGAGG - Intergenic
948052861 2:234991736-234991758 CAGGAGTTGGGGAAGTGGAAAGG + Intronic
948119884 2:235522214-235522236 TAGAAGCTGGAGCTGTGGACAGG + Intronic
949008770 2:241666872-241666894 AAGAACTGGGAGAAGGGGACGGG - Intronic
1169947005 20:10999777-10999799 CAGAACTGGCAGAAGTGGACAGG - Intergenic
1170166863 20:13368760-13368782 CAGGGGTTGGGGAAGGGGACAGG - Intergenic
1171914204 20:31000194-31000216 CAGAAATTGGATATTTGGACAGG - Intergenic
1172012278 20:31852512-31852534 TAGAAGTTGGAGATGTTGGCCGG + Intronic
1172700569 20:36851412-36851434 ATGAAGATGGAGAAGTGGACGGG - Intronic
1175471618 20:59233975-59233997 CAGAAGTAGAAGAAGCAGACAGG - Intronic
1176665461 21:9682985-9683007 CAGAAGCTGGAGACGAGGAAGGG - Intergenic
1177762842 21:25421256-25421278 CAGAAGTGGGAGAGGTGGAAGGG - Intergenic
1178168718 21:30013249-30013271 GAAAACTTGGAAAAGTGGACAGG + Intergenic
1178312443 21:31540600-31540622 CAGAAGTTTAAGAAGTGAGCAGG - Intronic
1178635374 21:34297936-34297958 CAGAAGATGATGACGTGGACAGG + Intergenic
1179522942 21:41957072-41957094 CTGCAGTGGGAGAAGGGGACTGG - Intergenic
1179582656 21:42353229-42353251 CAGAAGTGGCAGAAGTGGAGTGG - Intergenic
1180487573 22:15816731-15816753 CAGGAGTTGGTGAAGGGGACAGG + Intergenic
1182670755 22:31993824-31993846 CAGAAGCTGGAGGAGAGGCCAGG - Intergenic
1183225176 22:36544925-36544947 CAAACGTTGGGAAAGTGGACAGG + Intergenic
1183337769 22:37260468-37260490 CAGAGGCGGGAGAAGTGGAGCGG + Intergenic
1184553502 22:45218815-45218837 CAGAAGTTGGGGGAGGGGAGAGG - Intronic
1203294027 22_KI270736v1_random:23116-23138 GAGAAGTTGGAGAGGTGGCCAGG - Intergenic
949520512 3:4848876-4848898 CAAATGTTAGAGAAGTGGAATGG - Intronic
951170730 3:19539080-19539102 AAGAAGTTGGGGAAGAGGAGAGG - Intergenic
951296122 3:20936986-20937008 CACAAATTGGAGAAATGGATAGG - Intergenic
952562571 3:34612250-34612272 CTAAAGTGAGAGAAGTGGACTGG - Intergenic
952600697 3:35078612-35078634 CAGAAGTGGCAGAGGTGGAGGGG + Intergenic
953631371 3:44620902-44620924 GGAAAGTTGGAGAAGGGGACAGG - Intronic
955994038 3:64659542-64659564 AAGAGGTCTGAGAAGTGGACAGG + Intronic
956009419 3:64814650-64814672 CAGATGTGTGAGTAGTGGACAGG - Intergenic
956202551 3:66721302-66721324 CAGAAGTTTGAGATGAGAACAGG - Intergenic
956387846 3:68739854-68739876 CAGAAATTGGAGACTTGGAAGGG + Intronic
956542402 3:70355771-70355793 AAGGAGTAGGAGAAGTGGAGAGG + Intergenic
957245951 3:77716473-77716495 CAGAAGTGGGAGAAGCGCAATGG - Intergenic
957516814 3:81265352-81265374 CAGAAGCTAGAGAAATGCACTGG - Intergenic
959903467 3:111685084-111685106 CAGAATTGGGAGAAGGGCACAGG + Intronic
960763989 3:121105099-121105121 CAAAAGATGTACAAGTGGACTGG + Intronic
961825559 3:129597402-129597424 CAGAGGCTGGAGAAGGGCACAGG + Intronic
962012337 3:131404042-131404064 CAGATGTGGGAGAACTAGACAGG + Intergenic
963327719 3:143880620-143880642 CAGAAAGTGGAGAGGTGGAGGGG + Intergenic
964074715 3:152679666-152679688 CAAAACTTGGAGAACTGCACTGG + Intergenic
964330334 3:155595014-155595036 CAGAGCTTGGAGAAGTGGAGAGG + Intronic
965568658 3:170149217-170149239 CAGGTGTAGGAGAAGTGGAGAGG + Exonic
966254641 3:177904001-177904023 AAGAAATTGGAGTAGTGGGCAGG + Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967233493 3:187363488-187363510 CAGAGGTTGGACAAGTGTCCTGG + Intergenic
967237126 3:187396237-187396259 CAGGAGGTTGAGCAGTGGACTGG + Intergenic
967329327 3:188275019-188275041 TAACAGTTGGAGAAGGGGACAGG - Intronic
969338479 4:6526078-6526100 CAGAAGGTGAAGCAGAGGACGGG - Intronic
969512943 4:7629993-7630015 CAGAGGTAGGAGAACTGGAGGGG - Intronic
970132822 4:12889993-12890015 CAGGAGTTGCAGCACTGGACAGG + Intergenic
970360427 4:15303717-15303739 CAGAAGGTGGAGAGGTTGAGTGG - Intergenic
970861162 4:20704101-20704123 GAGAAGATGGAGAAGATGACAGG + Intronic
971004971 4:22362931-22362953 CAGACTTTTGAGAAGGGGACTGG - Intronic
971234970 4:24832971-24832993 CAGAAGTTGCAGATGTAGAATGG - Intronic
971666998 4:29500242-29500264 AAGAAGTTGGAGACTTGAACGGG + Intergenic
974060516 4:57029954-57029976 CAGCACTTTGGGAAGTGGACTGG - Intronic
975720752 4:77246555-77246577 CAGAAGTTCCAGAAGTGGTGGGG - Intronic
975824965 4:78309696-78309718 AAGAAGGTGAAGAAGTGGAAAGG - Intronic
976030224 4:80743094-80743116 CAAAAGTTGTACAAGTAGACCGG + Intronic
976105669 4:81614515-81614537 AGGAAGTTGGAGAGTTGGACAGG + Intronic
976757667 4:88515893-88515915 CAAAACTTGGAATAGTGGACAGG + Intergenic
976945047 4:90754931-90754953 CAGAAGCTGGAGATGAGGAAAGG - Intronic
977833210 4:101617695-101617717 CAGAACTTTGAGCAGTGCACTGG - Intronic
981731407 4:147903037-147903059 CCAAAGTTGGAGAAGGGGCCTGG - Intronic
983769515 4:171531931-171531953 CAGAAGTTGGAGACCAGCACTGG + Intergenic
985410952 4:189683443-189683465 CAGAAGCTGGAGACGAGGAAGGG - Intergenic
986457909 5:7938871-7938893 GAGAAGGGGGAGAACTGGACAGG + Intergenic
986609331 5:9551252-9551274 CAGAAGTAGGAGAGAAGGACAGG - Intergenic
986712312 5:10496937-10496959 CAGAAGTTAGAGGAGAGGCCTGG + Intergenic
989248769 5:39283158-39283180 AAGAAGTTAGAGAAGTGGGATGG - Intergenic
989342000 5:40386557-40386579 CAAAAGCTGGAGAGGGGGACAGG + Intergenic
989749459 5:44875878-44875900 CAGGATTTGGTGAAGAGGACTGG + Intergenic
989978496 5:50613332-50613354 CAGAAGTGGAAGAGGGGGACGGG - Intergenic
990159430 5:52921274-52921296 CAGAAGTAGGAAAATTGGCCTGG - Intronic
990164694 5:52981646-52981668 CACAAGTTGTTGAAATGGACAGG + Intergenic
993212170 5:84965731-84965753 CAGAAGGAGGTGAAGTGGAATGG + Intergenic
993539075 5:89125538-89125560 CAGAAGTTAGCATAGTGGACTGG + Intergenic
994601272 5:101908551-101908573 CAGAAGCAGAAGAAGTGGAAGGG - Intergenic
995071711 5:107930215-107930237 AAGAAGTTGGATTGGTGGACTGG - Intronic
995989786 5:118223529-118223551 CAGAAGTTGGAACAGTTTACAGG - Intergenic
996122016 5:119683284-119683306 GAGAAGTTGGAGAAGGCAACTGG + Intergenic
997132174 5:131287946-131287968 CAAAAATGGGAGAAGTGGCCGGG + Intronic
997215853 5:132110118-132110140 CAGAAGCTGGAGTAGGGGATGGG + Intergenic
998400887 5:141848631-141848653 GAGAAGTTGGAGAAGAAGGCAGG - Intergenic
998984399 5:147739702-147739724 CTGAAGTTGGAGCACTGGAAAGG - Intronic
999296793 5:150464721-150464743 CAGAAGTTGGAGTAGGGGAGGGG + Intergenic
1000932576 5:167269848-167269870 CAGAAGTTGAAGAACTGGGATGG - Intergenic
1001780579 5:174365481-174365503 TAAGAGTTGGAGAAGTGGAAGGG + Intergenic
1002826892 6:782111-782133 CAGAAGTTTGAGATGGGGATGGG + Intergenic
1006865120 6:37203237-37203259 CAGAAGTTGGAGAAGGTGGATGG + Intergenic
1007513388 6:42391765-42391787 CAGAACATGGAGCAGTGGGCTGG + Intronic
1007666577 6:43516966-43516988 CGGAAGCTGGGGACGTGGACGGG + Exonic
1007902186 6:45422545-45422567 CACAAGTTAGCGAAGTGGCCGGG - Intronic
1010099944 6:72092358-72092380 AATAAGTTGGAGAAGTTGACAGG + Intronic
1011180966 6:84620198-84620220 CAGAAGCTGGAGAAGTGATGGGG - Intergenic
1011765581 6:90616021-90616043 CAGGAGTTGGAGGAGAGGTCTGG + Intergenic
1012288329 6:97421285-97421307 CAGAAGGTGGCAAACTGGACAGG + Intergenic
1012593790 6:101016673-101016695 CAGCAGTAGGAGAAATGGAAAGG + Intergenic
1013507564 6:110815214-110815236 CGGCTGTTGGAGAAGTGGAGCGG - Exonic
1013857099 6:114586104-114586126 CAGAAGTGGAGGAAGTGGAATGG + Intergenic
1015740297 6:136446545-136446567 CAGAAGTTGGGGAGGTGCAGGGG + Intronic
1016189999 6:141253438-141253460 TAATAGTTGGAGAAGTCGACTGG + Intergenic
1016437301 6:144049964-144049986 TCGAAGCTGGAGAAGTGGAGGGG + Intronic
1016696682 6:147004350-147004372 GAGAAGTTGGGGTAGTGAACTGG - Intergenic
1016747716 6:147598825-147598847 ATGAAGTTGGGGAAGAGGACAGG + Intronic
1017530902 6:155291311-155291333 CAGAAGTTGTATAAGTGCAGAGG + Intronic
1020135493 7:5585809-5585831 TCGAGGTTGGAGAGGTGGACTGG + Intergenic
1021135022 7:16954989-16955011 CCCAAGTTGTAGAAGTGGATGGG - Intergenic
1022518505 7:30990376-30990398 CTGAGGTTGGAGAGCTGGACTGG - Intronic
1023302713 7:38791171-38791193 AGAAAATTGGAGAAGTGGACAGG - Intronic
1023325540 7:39051760-39051782 TAGTGGGTGGAGAAGTGGACAGG + Intronic
1023654496 7:42406401-42406423 CAGAAGATGGAGAAATGCAGAGG - Intergenic
1023710977 7:42992279-42992301 CAGGAGTAGCAGAAGGGGACAGG - Intergenic
1023765255 7:43504560-43504582 CAGAAGTGGGGGAAGCAGACAGG - Intronic
1024219155 7:47274157-47274179 CACAAGGTGGAAAGGTGGACAGG - Intergenic
1026450578 7:70525786-70525808 CAGAAGTGAGAGAGGTGGCCTGG + Intronic
1026850117 7:73718925-73718947 CCGAAGGTGGATAGGTGGACCGG + Intronic
1027049701 7:75014276-75014298 CAAAAGGTGGAGAGGTGGCCGGG + Intronic
1027800954 7:82748251-82748273 CAGAAATTATAGAACTGGACAGG + Intergenic
1028631316 7:92937440-92937462 CAGAGGTGGGAGAAGGGGAAAGG - Intergenic
1028931056 7:96413716-96413738 CAGGAGGTGGAGAAGGGGAGAGG - Intergenic
1029383334 7:100227387-100227409 CAAAAGGTGGAGAGGTGGCCAGG - Intronic
1029895545 7:103979603-103979625 CAGAACTTTGAGCAGTGAACAGG + Intronic
1029940911 7:104479685-104479707 CAGAAGTGGAAGAAGAGGACGGG - Intronic
1031918063 7:127581727-127581749 CAGAAGTTGGAACAGTGGTAAGG - Exonic
1032355764 7:131209183-131209205 ATGAAGTTGGACAAGTGGACAGG + Intronic
1034113642 7:148562980-148563002 CAGATGTTGGAGGAGGGGCCTGG - Intergenic
1034663157 7:152790199-152790221 CAGAAGTTCGAGACCAGGACAGG - Intronic
1038167404 8:25099126-25099148 CAGGATTTGGAGAGGTAGACTGG + Intergenic
1041872152 8:62647600-62647622 CAGAAGTTAGCAAAGTGGAGAGG + Intronic
1042665724 8:71203502-71203524 GTGAAGTTGGAGAGGTGGAAGGG + Intronic
1042883692 8:73523779-73523801 TTGAAGTTGGATAAGTGGAGGGG + Intronic
1043358192 8:79438768-79438790 CAGAAGAAGGAGAACTGGTCTGG + Intergenic
1043533937 8:81179663-81179685 CAGTAGTTGGAGAAGGGGTTGGG + Intergenic
1044161380 8:88920577-88920599 CATATGTTGGAGAAGGGGCCTGG + Intergenic
1045233721 8:100330822-100330844 ATGAAGTTGGAGAGGTGGGCAGG - Intronic
1045527682 8:102955387-102955409 CAAAAGATGGAGAAGTGGCTGGG - Intronic
1045949021 8:107830539-107830561 CAGAATTGGGAGAAGGGGAAAGG - Intergenic
1046785403 8:118260537-118260559 GAAAAGTTGGAGAAGGGAACTGG - Intronic
1047268243 8:123329187-123329209 CAGCAGTATGAGAAATGGACTGG + Intronic
1047309148 8:123677349-123677371 CAGAAGCTGAAGAAATGGGCTGG + Intergenic
1049334198 8:142073937-142073959 CCGATGTTGGAGAAGGGGCCTGG - Intergenic
1049394526 8:142393659-142393681 CAGGAGGTGGTGGAGTGGACGGG - Intronic
1049699914 8:144005866-144005888 CGGAAGGTGGAGGAGGGGACGGG - Intronic
1050719321 9:8567368-8567390 CTGAAATTGGAGAAGAGGTCAGG - Intronic
1051414961 9:16829465-16829487 CACAAGTTGGACAAGTGGGTTGG + Intronic
1052379318 9:27753066-27753088 CATAAGTTGGAGAGGTGGCCAGG - Intergenic
1052508588 9:29384899-29384921 CAGATGCTGGAGAGGTGGAGAGG + Intergenic
1052618262 9:30871675-30871697 CTGAAGTTGTAGAACAGGACTGG + Intergenic
1053304983 9:36977943-36977965 CAGGAGTTGGAGGAGGGGAAAGG + Intronic
1056177917 9:84053407-84053429 CAGGAGTTGGAAATGTGGACTGG + Intergenic
1057034708 9:91803389-91803411 CAGAGGCTGGAGGAGGGGACAGG + Intronic
1059227244 9:112683256-112683278 CAGGAGTTGGAGAAGCAGCCTGG + Intergenic
1059658967 9:116382526-116382548 CACAAGCTGGAGAAGTGGGCAGG - Intronic
1059756718 9:117300734-117300756 CAGAAGGTGGAGAAGTGGCAGGG + Intronic
1060332525 9:122686092-122686114 CTGGAGTTGGAGATGTGGAGAGG - Intergenic
1061412563 9:130429440-130429462 CTGAAACTGGAGAAGGGGACAGG + Intronic
1061614093 9:131768037-131768059 CAGAAGTCCGAGACGTCGACAGG + Intergenic
1203660637 Un_KI270753v1:38775-38797 CAGAAGCTGGAGACGAGGAAGGG + Intergenic
1203671810 Un_KI270755v1:21993-22015 CAGAAGCTGGAGACGAGGAAGGG + Intergenic
1185872195 X:3673585-3673607 CAGAAGATGGATAGGTGGACAGG + Intronic
1186459961 X:9740081-9740103 CAGCAGTGGGAGAAGGGGAGAGG + Intronic
1186639285 X:11437849-11437871 CAGAAGCTGGTGAATGGGACAGG + Intronic
1186649050 X:11539619-11539641 CAGAAGTGGGAGCTGTGGTCTGG - Intronic
1187576847 X:20565877-20565899 CTGAAGATGGGGAAGTGAACAGG + Intergenic
1189181777 X:39011522-39011544 CAAAAGTTGGACAAGCGGATGGG + Intergenic
1191939419 X:66462337-66462359 CAAAAGCTGGAGAAATAGACAGG - Intergenic
1192205467 X:69093150-69093172 CAGAAGCTGGAGGAGTGCATGGG + Intergenic
1192583441 X:72302883-72302905 CAGAAGTTGGATAAATTGGCGGG + Exonic
1193413836 X:81197976-81197998 CAAGAGTTGGATAAGTGGAGAGG + Intronic
1194128771 X:90053305-90053327 CAGAAGGGGGAGAATGGGACGGG + Intergenic
1195285887 X:103383303-103383325 CAGAACTGGGAGAAGTGGGTGGG - Intergenic
1195381962 X:104279549-104279571 ATGAGGTTGGAGAGGTGGACAGG + Intergenic
1195610724 X:106863676-106863698 CAGAAGCTGGACCACTGGACTGG + Intronic
1195616301 X:106915018-106915040 CAGGAGTTGGGGTAGTGGAAGGG - Intronic
1195934216 X:110109674-110109696 AAGTCCTTGGAGAAGTGGACAGG - Intronic
1196324906 X:114391202-114391224 CAGAAGTTGGAGAAGAAGAGAGG + Intergenic
1197645152 X:129009495-129009517 CAGATTTAGGAGAAGGGGACTGG - Intergenic
1198668313 X:139049433-139049455 GAGAAGTTGGAGAGTTGGAGGGG - Intronic
1199242930 X:145569154-145569176 CAGCAGTGGCAGTAGTGGACTGG - Intergenic
1199537340 X:148917637-148917659 CAGTAGTTGGAGAAGTTGGATGG + Intronic