ID: 1162581867

View in Genome Browser
Species Human (GRCh38)
Location 19:11536218-11536240
Sequence CGCCCCTCCCGGGCCGCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162581853_1162581867 5 Left 1162581853 19:11536190-11536212 CCGCCTGGACCTCGCCAGGTCCC No data
Right 1162581867 19:11536218-11536240 CGCCCCTCCCGGGCCGCCAGGGG No data
1162581855_1162581867 -4 Left 1162581855 19:11536199-11536221 CCTCGCCAGGTCCCGCCCCCGCC No data
Right 1162581867 19:11536218-11536240 CGCCCCTCCCGGGCCGCCAGGGG No data
1162581856_1162581867 -9 Left 1162581856 19:11536204-11536226 CCAGGTCCCGCCCCCGCCCCTCC No data
Right 1162581867 19:11536218-11536240 CGCCCCTCCCGGGCCGCCAGGGG No data
1162581854_1162581867 2 Left 1162581854 19:11536193-11536215 CCTGGACCTCGCCAGGTCCCGCC No data
Right 1162581867 19:11536218-11536240 CGCCCCTCCCGGGCCGCCAGGGG No data
1162581852_1162581867 8 Left 1162581852 19:11536187-11536209 CCGCCGCCTGGACCTCGCCAGGT No data
Right 1162581867 19:11536218-11536240 CGCCCCTCCCGGGCCGCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162581867 Original CRISPR CGCCCCTCCCGGGCCGCCAG GGG Intergenic