ID: 1162582929

View in Genome Browser
Species Human (GRCh38)
Location 19:11541259-11541281
Sequence CAGGATCATGGTTGTTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 167}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162582929_1162582940 18 Left 1162582929 19:11541259-11541281 CCCCCAAAACAACCATGATCCTG 0: 1
1: 0
2: 0
3: 23
4: 167
Right 1162582940 19:11541300-11541322 TCTATTGGATACCTTTGGGGTGG 0: 1
1: 0
2: 0
3: 3
4: 82
1162582929_1162582938 14 Left 1162582929 19:11541259-11541281 CCCCCAAAACAACCATGATCCTG 0: 1
1: 0
2: 0
3: 23
4: 167
Right 1162582938 19:11541296-11541318 ACTTTCTATTGGATACCTTTGGG 0: 1
1: 0
2: 1
3: 19
4: 191
1162582929_1162582936 3 Left 1162582929 19:11541259-11541281 CCCCCAAAACAACCATGATCCTG 0: 1
1: 0
2: 0
3: 23
4: 167
Right 1162582936 19:11541285-11541307 CTGAGTTGAACACTTTCTATTGG 0: 1
1: 0
2: 1
3: 33
4: 314
1162582929_1162582937 13 Left 1162582929 19:11541259-11541281 CCCCCAAAACAACCATGATCCTG 0: 1
1: 0
2: 0
3: 23
4: 167
Right 1162582937 19:11541295-11541317 CACTTTCTATTGGATACCTTTGG 0: 1
1: 0
2: 1
3: 9
4: 156
1162582929_1162582939 15 Left 1162582929 19:11541259-11541281 CCCCCAAAACAACCATGATCCTG 0: 1
1: 0
2: 0
3: 23
4: 167
Right 1162582939 19:11541297-11541319 CTTTCTATTGGATACCTTTGGGG 0: 1
1: 0
2: 1
3: 13
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162582929 Original CRISPR CAGGATCATGGTTGTTTTGG GGG (reversed) Intronic
901002367 1:6155102-6155124 CAGGAAGCTGGGTGTTTTGGGGG - Intronic
901002379 1:6155142-6155164 CAGGAAGCTGGGTGTTTTGGGGG - Intronic
901137064 1:7004688-7004710 CAGGATAGTGGTTGTCTTTGAGG - Intronic
902622546 1:17658952-17658974 CAGGAGAATGCTTGATTTGGTGG + Intronic
904734805 1:32623506-32623528 CAGCATGATGGTAGATTTGGTGG - Intronic
905373181 1:37498023-37498045 CAGGTTAATGTTTGCTTTGGAGG - Intronic
908819399 1:68067959-68067981 CAGGATTATGGGTCTTTGGGAGG + Intergenic
914248548 1:145903430-145903452 CAGGATCATTGTTGGAGTGGAGG + Intronic
915389530 1:155528993-155529015 CAGGATCATGGATGGAGTGGAGG - Intronic
920727069 1:208446044-208446066 CAGACTCAGGGCTGTTTTGGTGG - Intergenic
921249858 1:213287154-213287176 CAGGATCATTGGTGCATTGGGGG + Intergenic
922911476 1:229221450-229221472 CAGGAACATGGCTGTCGTGGGGG - Intergenic
924846149 1:247774255-247774277 CAGGCTCATGTTTCTTTTGGAGG - Intergenic
924954100 1:248910949-248910971 CAGGATCTTGGTTGTGGTGGTGG - Intronic
1062946067 10:1463094-1463116 CAGGGTCATGGTGGGTTTGTGGG + Intronic
1065096739 10:22287998-22288020 TAGGATAATGGGTGTTTTTGAGG - Intergenic
1066425569 10:35304689-35304711 CTAGATCATTTTTGTTTTGGGGG + Intronic
1067244447 10:44525737-44525759 CTGTATCTTGGTTGTTGTGGTGG - Intergenic
1067848819 10:49742571-49742593 CAGGATCATGTGTGTGTGGGGGG - Intronic
1068909691 10:62366053-62366075 CAGGATGATGGTACTTTTGAGGG + Intergenic
1068917602 10:62449290-62449312 CAGAATAGAGGTTGTTTTGGGGG + Intronic
1068931975 10:62600118-62600140 CAGGTTAATGGTTGTTTTGTGGG + Intronic
1071082234 10:81826131-81826153 CAGGACCATCTTTGTTTTGGTGG + Intergenic
1071259848 10:83909763-83909785 CAGGCTGATGGTTCTTTTGAGGG + Intergenic
1071590982 10:86873002-86873024 CAGGGTCGTGGATGTTTTTGCGG + Intronic
1075549240 10:123379829-123379851 CAGGCTCATGGTTGGTTTGTTGG - Intergenic
1083420396 11:62549251-62549273 CAGGATCATGGTTTTTTAGAGGG - Intronic
1084709436 11:70834974-70834996 CAAGAACATGGCTATTTTGGGGG + Intronic
1091217202 11:133909450-133909472 CAGGTTGCTGGTTGTCTTGGCGG - Intronic
1092499035 12:9027802-9027824 CATGGTCATGGTGGCTTTGGTGG - Intergenic
1093701775 12:22229704-22229726 CAGGATCAAGGATGGTTTGATGG + Intronic
1094372754 12:29755859-29755881 CTGGATCAGGGCTGTGTTGGGGG - Exonic
1095675795 12:44916641-44916663 CAGGAAAATTGTTGTTGTGGTGG - Intronic
1098646295 12:72905579-72905601 CAGAATCATGATTGTGTTTGGGG - Intergenic
1101507065 12:105357027-105357049 CAGAGACATGGTCGTTTTGGAGG + Intronic
1103685084 12:122725748-122725770 CAGGAAAATGATTGTTTTAGAGG - Intergenic
1106337964 13:28801448-28801470 CAGGATGAAGGTTATGTTGGGGG + Intergenic
1107113165 13:36719653-36719675 CAGGATCATGGTGATATTGGTGG - Intergenic
1108815812 13:54288809-54288831 AAGAATCATAGTTATTTTGGGGG - Intergenic
1112137906 13:96603245-96603267 CGGCATCATGGTTGATTTAGGGG - Intronic
1113036974 13:106061634-106061656 CAGCATCAGGGATGTTTTGCAGG - Intergenic
1113779783 13:112969354-112969376 CAGGATCATTTTTGTTGTGTCGG + Exonic
1113981127 13:114276901-114276923 CAGCTTAATGGTGGTTTTGGTGG + Intergenic
1114213995 14:20641708-20641730 CAGGATCATGTTTTTGTTGTTGG - Intergenic
1114340677 14:21739770-21739792 GAGAATCATGGTGGTTATGGAGG + Intergenic
1114576428 14:23718736-23718758 GAGAATCATGGTTGTGTTGGTGG + Intergenic
1114763794 14:25347993-25348015 CAGGGTCATGTTTCTTCTGGAGG + Intergenic
1116073099 14:40074218-40074240 CAGGGTCATGGCTGTTCTGCTGG - Intergenic
1116471968 14:45295926-45295948 CAGGATGATTTATGTTTTGGGGG - Intergenic
1120190348 14:81435042-81435064 CAGTAGCATGGCTGATTTGGGGG - Intronic
1120474958 14:84975185-84975207 CAGGATCTTTGCAGTTTTGGTGG + Intergenic
1120987153 14:90344122-90344144 CATGATAGTGGTTGCTTTGGGGG - Intergenic
1121785792 14:96660027-96660049 CAGGATCAGGGTAGGTTGGGTGG + Intergenic
1121867224 14:97373952-97373974 CAGGAACAGGGTTGAGTTGGTGG - Intergenic
1122847547 14:104508302-104508324 CAGGATCATGTTTCTTTTCCAGG - Intronic
1130054204 15:80508250-80508272 CAGGATGAGGTCTGTTTTGGGGG + Exonic
1130194815 15:81769462-81769484 CAGGATAATGGTTGTACTGCAGG - Intergenic
1130196138 15:81781988-81782010 CAGAATCAAGGTTTTGTTGGGGG + Intergenic
1130767512 15:86886658-86886680 CATGATCATGGATGTTTTTATGG + Intronic
1131788173 15:95935275-95935297 CAGGACCATGGTTATGGTGGTGG - Intergenic
1135204328 16:20470021-20470043 CAGGTTCAGGGTTGTCCTGGGGG + Intronic
1135214671 16:20554961-20554983 CAGGTTCAGGGTTGTCCTGGGGG - Intronic
1137067548 16:35863965-35863987 CTGGATGATAGTTGTTTGGGAGG + Intergenic
1140916679 16:79500093-79500115 CGGGGTCATGGTTCTTCTGGAGG - Intergenic
1140922350 16:79550956-79550978 CAGGACCGTGGTTCCTTTGGAGG + Intergenic
1142863157 17:2775832-2775854 CAGGAGCATCCTTGGTTTGGCGG + Intergenic
1143247523 17:5499323-5499345 CAGGATTAAGTCTGTTTTGGAGG + Intergenic
1143743196 17:8969202-8969224 CAGAATGATGGTTATCTTGGGGG + Intergenic
1144391243 17:14795441-14795463 CAGGGTTGTGGTTGTTTGGGGGG - Intergenic
1145766037 17:27458755-27458777 CAGGGCCTGGGTTGTTTTGGGGG + Intronic
1147555642 17:41477293-41477315 CAGGATCAAGGTGGTTTTTAGGG - Intronic
1148593961 17:48837891-48837913 AAGTATTATGGTTGTTTGGGAGG + Intronic
1150897839 17:69234638-69234660 CAGAATTATTGTTGTTATGGGGG + Intronic
1153952121 18:10066495-10066517 CATGAACATGGTTGATTTTGCGG + Intergenic
1155274573 18:24173811-24173833 TAGGATCCTGATTGTGTTGGTGG - Intronic
1156671794 18:39479573-39479595 CAGGACCATGGAGGGTTTGGGGG - Intergenic
1157697979 18:49738904-49738926 CTGGATCCTGGTTGTGTTAGGGG - Intergenic
1157957377 18:52113421-52113443 GAGGGTCATGTTTATTTTGGAGG + Intergenic
1159596303 18:70385670-70385692 CAGGCTCATGGCAGTTCTGGGGG + Intergenic
1162582929 19:11541259-11541281 CAGGATCATGGTTGTTTTGGGGG - Intronic
1164032331 19:21418804-21418826 CAGGAGCATGCTTTTTTTTGTGG + Intronic
1164832217 19:31331464-31331486 TAGGACCGTGATTGTTTTGGTGG - Intronic
930283548 2:49400342-49400364 TAGAATCATTGTTTTTTTGGGGG - Intergenic
931426542 2:62177029-62177051 AAGGAGCATGCTTGATTTGGGGG + Intergenic
933497869 2:83073612-83073634 CAGGATCAATTTTGTTGTGGTGG - Intergenic
935435247 2:103024167-103024189 TAGGATCATGCATGATTTGGAGG - Intergenic
935891235 2:107681013-107681035 CAGGACTATGGTATTTTTGGAGG + Intergenic
943729044 2:191282370-191282392 CAGGCTCATGGTGGTGGTGGTGG + Intronic
945126174 2:206512943-206512965 TACTATTATGGTTGTTTTGGGGG + Intronic
948152624 2:235756285-235756307 CAGGATCAGGGTTTTTTTGTTGG + Intronic
948828064 2:240583719-240583741 CAGGTTCATGGGTGTTGAGGAGG - Intergenic
948998640 2:241598417-241598439 TTGGATCATGGTTGTTTTTGGGG - Intronic
1169567013 20:6865909-6865931 CAGGTTCAGGGTTAATTTGGAGG + Intergenic
1169889979 20:10441905-10441927 CTTGATATTGGTTGTTTTGGTGG + Intronic
1170397033 20:15937365-15937387 CAGGCTCATGCTTTCTTTGGTGG + Intronic
1170668120 20:18404375-18404397 CAGGATGATGGTGGTTTGGCAGG - Intronic
1170792238 20:19517722-19517744 CAGGCTCATGGCTATTTGGGTGG - Intronic
1170849469 20:19991423-19991445 CAGGATAATTCTTCTTTTGGGGG + Intronic
1172125391 20:32622510-32622532 AAGGATCTTGGGTGTTCTGGAGG + Intergenic
1172310767 20:33916552-33916574 CAGGATAATGGTTATTTTTGAGG - Intergenic
1174884821 20:54322198-54322220 AAAGGTCATGGCTGTTTTGGGGG - Intergenic
1178614707 21:34122034-34122056 CAGGCTCATGGTTTTATTTGTGG + Intronic
1178810130 21:35873892-35873914 CAGAATGATAGCTGTTTTGGGGG - Intronic
1179955550 21:44736303-44736325 CAGAATCATGGGTGTTTCTGTGG + Intergenic
1180914178 22:19473886-19473908 CAGGTTCATGCTTGGTTTTGGGG - Intronic
1181966475 22:26659477-26659499 AGGGGTTATGGTTGTTTTGGGGG - Intergenic
1184286619 22:43475508-43475530 CATGATGATGGTTGTGGTGGTGG + Intronic
1184525719 22:45021086-45021108 CTGTCTCAAGGTTGTTTTGGGGG + Intergenic
1184597727 22:45524396-45524418 CAGCCTCATGGTTGTGTTGGAGG + Intronic
1185066330 22:48633363-48633385 CAGGAGCATGGGTGTGTTTGTGG + Intronic
950798589 3:15531322-15531344 CATGATCATGGCCCTTTTGGGGG + Intergenic
953777648 3:45835784-45835806 TTGGATCATGGTTGTTTTTCAGG - Exonic
954607849 3:51927914-51927936 CAGTATCTTGGTTGTGATGGTGG + Intergenic
956669795 3:71676300-71676322 CAGGATAATGGTTATTTTAGTGG + Exonic
959954794 3:112224064-112224086 CAGGATCATCTGTGATTTGGGGG - Intronic
963502709 3:146147959-146147981 CAGAATCTTTCTTGTTTTGGAGG - Intronic
964545289 3:157827647-157827669 TAGTATTAAGGTTGTTTTGGGGG + Intergenic
965110973 3:164421675-164421697 CAGGAGAATGGTTATTTTTGGGG - Intergenic
965803952 3:172523369-172523391 CAGGATCATGGCTATGATGGAGG - Exonic
966069008 3:175851817-175851839 CAGGATCATGGTTCATGTGGAGG + Intergenic
966301587 3:178485149-178485171 CTGGATCATGGGTCTTTTGGAGG - Intronic
966954358 3:184858619-184858641 CAGGAACATGGTTGTGGTGGAGG + Intronic
967237638 3:187402007-187402029 CAGGATCATGGTGGTGCTGCTGG - Intergenic
967615810 3:191564965-191564987 CAAGATCAGGCTTGCTTTGGAGG - Intergenic
967768208 3:193305579-193305601 CTGGATGTTGGTTGTTTTAGAGG + Exonic
972404473 4:38733323-38733345 GATGATCATGGTTGTTGGGGTGG + Intergenic
973246490 4:48016292-48016314 CAGGCTCAAGTTTATTTTGGGGG - Intronic
973338300 4:48978499-48978521 AATGATCATCTTTGTTTTGGAGG - Intergenic
974778744 4:66523749-66523771 CAGGACCATTGATGTCTTGGAGG - Intergenic
974909693 4:68102147-68102169 CAGGATCTTGGTTTTTTGGGGGG + Intronic
977967219 4:103167586-103167608 CAGAATTCTTGTTGTTTTGGGGG - Intronic
978026154 4:103877318-103877340 CAGGGTAATGGATATTTTGGTGG - Intergenic
982718190 4:158830769-158830791 CAGAACCATGGTTGCTTTGGTGG + Intronic
983164781 4:164461642-164461664 CAAGATCATGGTTGCCTTTGGGG + Intergenic
984511936 4:180689494-180689516 CGGGATCAAGGGTGGTTTGGTGG + Intergenic
985604614 5:851757-851779 CAGGACCATGGTTCTTTGGCCGG + Intronic
985709192 5:1418794-1418816 CTGGATGATGGATGTTTGGGTGG - Intronic
991654396 5:68889228-68889250 CAATAGCATTGTTGTTTTGGAGG - Intergenic
993017525 5:82551796-82551818 CAGGATAATGCTTATTTTTGTGG + Intergenic
993693672 5:91034775-91034797 CAGCATAATGGGTGTTTTGGTGG + Intronic
994894915 5:105690807-105690829 CAAGATTATAGTTGTTATGGTGG + Intergenic
995663665 5:114515661-114515683 CAGAATAATGGTTGTCTTTGGGG - Intergenic
995694470 5:114864664-114864686 ACGGATAATTGTTGTTTTGGAGG + Intergenic
996314086 5:122141744-122141766 CACGATCATCTTTCTTTTGGGGG + Intronic
997498161 5:134348261-134348283 CAGTATCGTGGTTGCTTTGTAGG + Intronic
998597416 5:143547332-143547354 CAGGAGCATTGTTGTGGTGGAGG + Intergenic
1004012600 6:11703565-11703587 CAGGGGCATGGGTGTTATGGTGG - Intergenic
1005585113 6:27268801-27268823 AAGGATCATGGGTGATCTGGCGG - Intergenic
1005704830 6:28441114-28441136 GAGGATGATGGTAGATTTGGGGG - Intronic
1008389182 6:50929551-50929573 CAGCTTCATTGTTGTTTTTGTGG + Intergenic
1011312595 6:85996741-85996763 CTGGATAATTCTTGTTTTGGGGG + Intergenic
1014419770 6:121229186-121229208 CAGGATACTGGGTGTTATGGAGG - Intronic
1016918954 6:149272397-149272419 CAGGGTCATGTTCCTTTTGGAGG + Intronic
1017299451 6:152838989-152839011 CAGGAGCATTGTTGTTGTAGAGG + Intergenic
1020347284 7:7179732-7179754 TAGGTCCATGGTTGCTTTGGAGG - Intronic
1021112570 7:16712313-16712335 CAGGATCATGATTTCTTGGGTGG - Intergenic
1023032090 7:36098765-36098787 GAGATTCATGGTGGTTTTGGTGG - Intergenic
1023659970 7:42461108-42461130 CATAATCATGGTCGTTTGGGAGG + Intergenic
1023713458 7:43019239-43019261 CAGGATCACGGTTGCTCTGGGGG + Intergenic
1025031471 7:55560560-55560582 CAGGACCATGTTTCTTCTGGAGG - Intronic
1030644487 7:112044826-112044848 CAGGATAATTGTAGTTGTGGTGG - Intronic
1032500351 7:132395255-132395277 CAGGACCATGGGTTTTATGGGGG + Intronic
1032895026 7:136240818-136240840 CAGAATCTTGACTGTTTTGGAGG + Intergenic
1037748702 8:21666141-21666163 CAGTATCCTGATGGTTTTGGAGG - Intergenic
1040062460 8:43115599-43115621 CAGGGTCAGGGTGGTTTGGGGGG - Intronic
1041548285 8:59071410-59071432 AAGGAACATCTTTGTTTTGGAGG - Intronic
1044270203 8:90232888-90232910 CAGCAGCTTGGGTGTTTTGGTGG + Intergenic
1044555049 8:93553919-93553941 GGGGATCATGGCTGGTTTGGGGG - Intergenic
1046091685 8:109510782-109510804 CAGGATCATGGCTGGTGTGCTGG + Exonic
1048970271 8:139641486-139641508 CATGACCATTGCTGTTTTGGAGG + Intronic
1049518974 8:143078733-143078755 GTGGATCAGGGCTGTTTTGGGGG - Intergenic
1051576549 9:18622464-18622486 CAGGTTCATTATCGTTTTGGTGG - Intronic
1053387800 9:37708439-37708461 CAGGCTCATTGTTCATTTGGAGG - Exonic
1062716709 9:138014288-138014310 CAGGATCAGGGCTGGTATGGGGG - Intronic
1186121911 X:6372538-6372560 CAGGATAATGGTGATTTTGGTGG - Intergenic
1186504477 X:10080197-10080219 CTGGATCATTCTTGTCTTGGGGG + Intronic
1189080661 X:37968538-37968560 CTGGATCATGGTAAATTTGGGGG - Intronic
1189200565 X:39192319-39192341 CAGAATAGTGGTTGTTTTGGTGG - Intergenic
1190820040 X:53965267-53965289 CAGGTTGATGGTTGTTTCAGTGG - Intronic
1192254708 X:69446078-69446100 CAGTATCTTTGTTTTTTTGGGGG + Intergenic
1193703209 X:84789422-84789444 CAAGATCGTGGTTGTTTGGGAGG + Intergenic
1193798241 X:85903415-85903437 CATGAACGAGGTTGTTTTGGTGG + Intronic
1194426627 X:93746901-93746923 CAGTATCCTGATTGTTTTTGAGG - Intergenic
1196046974 X:111266830-111266852 GAGTATCATGTTTGCTTTGGAGG - Intronic
1196471000 X:116026988-116027010 CAGGATCTTGGTTTTTTTAAAGG + Intergenic
1197878617 X:131139687-131139709 CAGTAAAATGGTTGTTTTGCTGG + Intergenic
1198517719 X:137426127-137426149 CATGGTCAAGGTTGTCTTGGGGG - Intergenic
1198699378 X:139381450-139381472 CAGCTTGATGGTTATTTTGGGGG + Intergenic
1198821211 X:140650468-140650490 CAGGCTCAGGGCTGTTTGGGAGG - Intergenic
1201320373 Y:12691943-12691965 CAGCACCATGGGTGTTATGGGGG + Intergenic
1202115323 Y:21465974-21465996 CAAAACTATGGTTGTTTTGGGGG + Intergenic