ID: 1162584036

View in Genome Browser
Species Human (GRCh38)
Location 19:11548160-11548182
Sequence CCAGCTGATGCGTGGCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 162}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162584031_1162584036 11 Left 1162584031 19:11548126-11548148 CCCGGAGAAGCTGGCTCGCTTTT 0: 1
1: 0
2: 0
3: 9
4: 132
Right 1162584036 19:11548160-11548182 CCAGCTGATGCGTGGCAGGCTGG 0: 1
1: 0
2: 1
3: 22
4: 162
1162584032_1162584036 10 Left 1162584032 19:11548127-11548149 CCGGAGAAGCTGGCTCGCTTTTG 0: 1
1: 0
2: 0
3: 4
4: 105
Right 1162584036 19:11548160-11548182 CCAGCTGATGCGTGGCAGGCTGG 0: 1
1: 0
2: 1
3: 22
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162584036 Original CRISPR CCAGCTGATGCGTGGCAGGC TGG Intronic
900773079 1:4561399-4561421 CTGGCGGATGCGTGGCAGGCAGG + Intergenic
901533342 1:9867233-9867255 CCAGCAGAGGCCAGGCAGGCTGG + Intronic
902115030 1:14114266-14114288 TCAGCTGCTGCGTGGGGGGCCGG + Intergenic
902124922 1:14201440-14201462 CCAGCTGCTCCGGGGCAGCCAGG - Intergenic
907276078 1:53317277-53317299 GCAGCTGATGAGAGGCAGGAAGG - Intronic
911470831 1:98316285-98316307 CACGCTGGTGCGGGGCAGGCAGG - Intergenic
912881646 1:113422556-113422578 CCAGCTGCTGCGGGGCAGGGTGG + Intronic
915250184 1:154582520-154582542 CCAGCAGATGCGTGGAATTCAGG + Exonic
919131450 1:193455990-193456012 TCAGCTGCTGAGTGGCAGGCAGG + Intergenic
919928190 1:202203701-202203723 CCAGATACTGCGTAGCAGGCGGG + Intronic
920902895 1:210129308-210129330 GCAGCTGATGCATGGAAGGCAGG - Intronic
922584045 1:226720413-226720435 ACAGCTGATGGGTGGCAGAGAGG + Intronic
1064007173 10:11707947-11707969 CCAGCTGCTTCTTGGCTGGCAGG + Intergenic
1065557521 10:26931480-26931502 CCAGAGGAGGCGGGGCAGGCTGG + Intergenic
1066485428 10:35838425-35838447 CCAGATGCTGAGTGCCAGGCTGG - Intergenic
1067123726 10:43497473-43497495 CCAGCTGAGGGGTGGCAGATTGG + Intergenic
1067224408 10:44366190-44366212 CCAGGTGCTGGGTGGCAGGGAGG + Intergenic
1067224593 10:44367423-44367445 ACAGCTGATGCTGGGCAGGCAGG + Intergenic
1072636295 10:97180599-97180621 CCAGCTGCTGAGTGGCAGAGTGG + Intronic
1072726248 10:97815904-97815926 CCTGCTGCTGTGTAGCAGGCTGG - Intergenic
1075614404 10:123881077-123881099 CCAGCAGGAGCATGGCAGGCAGG - Intronic
1075729762 10:124629169-124629191 CCAGCACATGCCAGGCAGGCTGG - Intronic
1076605797 10:131689200-131689222 CACGCTGATGGGTGGCAGGCAGG - Intergenic
1076679284 10:132163406-132163428 TCAGCAGGTGTGTGGCAGGCGGG + Exonic
1078165202 11:8876932-8876954 ACTGCTGATGCTGGGCAGGCTGG + Intronic
1078446537 11:11409143-11409165 CCTGCTGAGGCGTGGGAGGCTGG + Intronic
1083322232 11:61854901-61854923 CCTGCTGCTGCCTGGCAAGCAGG + Intronic
1086588012 11:88478586-88478608 CCAGCTGTTACGTGCCATGCTGG - Intergenic
1086959722 11:92969748-92969770 CCAACTGCTGCGAGGCGGGCGGG + Exonic
1087470042 11:98561576-98561598 TCAGCTCATGTGTGGCAGCCTGG + Intergenic
1088080539 11:105906650-105906672 CCAGCTAATACGTGGTAAGCTGG + Intronic
1089248982 11:117144214-117144236 CACGCTGAGGCGTGGCAGGATGG + Intergenic
1089299615 11:117490702-117490724 ACAGCTGGTGAGTGGCAGGAAGG + Intronic
1089352365 11:117828818-117828840 CCCTCTGAGGTGTGGCAGGCAGG - Intronic
1091168133 11:133498506-133498528 CCAGATGGTGCGAGGAAGGCTGG - Intronic
1092184082 12:6465906-6465928 CGAGCTGATGCCTTGCAGGCAGG - Exonic
1092194601 12:6541639-6541661 CCAGCTGTGGTGGGGCAGGCAGG + Exonic
1096427613 12:51517341-51517363 CCAGATGATTCTTTGCAGGCAGG + Intergenic
1100246635 12:92764962-92764984 CCAGCTGAGGCCAGGCAGGTGGG + Intronic
1103207052 12:119138130-119138152 TCAGCTGATTCTTGCCAGGCAGG + Intronic
1103971297 12:124674404-124674426 CCATCTGCTGCGTAGGAGGCTGG - Intergenic
1103971333 12:124674534-124674556 CCATGTGCTGCCTGGCAGGCAGG + Intergenic
1105532147 13:21229899-21229921 ACAGTTGAGGCCTGGCAGGCGGG - Intergenic
1105854655 13:24362743-24362765 TCAGCTGGCGTGTGGCAGGCTGG + Intergenic
1108346817 13:49554517-49554539 CCAGCTCATGAGCCGCAGGCCGG + Intronic
1113760505 13:112843054-112843076 CCGGGTGATGCGTGGCTGGGTGG + Intronic
1115704973 14:35989488-35989510 CCAGGTGATGCCTGGCTGCCCGG - Intergenic
1116796878 14:49400858-49400880 CCAGGTGATGCATGGCAGAAGGG - Intergenic
1120357373 14:83452048-83452070 CCAGCTCCTGTGTGGCTGGCTGG - Intergenic
1122235403 14:100328485-100328507 CCAGGAGAAGCCTGGCAGGCTGG + Intronic
1122833734 14:104421032-104421054 ACAGGTGCTCCGTGGCAGGCTGG - Intergenic
1122909722 14:104821532-104821554 CCCGCTCCTGCGTTGCAGGCCGG - Intergenic
1123042757 14:105497081-105497103 GCAGCTCTTGCCTGGCAGGCAGG + Intronic
1125477362 15:40056054-40056076 CCAGCTGCAGGGTGGCAGCCAGG + Intergenic
1127816034 15:62609601-62609623 TCAGCTGATGCGTCGTTGGCGGG + Intronic
1128418592 15:67469906-67469928 TCAGCTGATGCAAGGCAGGTTGG - Intronic
1131072798 15:89476683-89476705 CCAGCTGATGCAGTGGAGGCAGG + Intronic
1131283389 15:91038787-91038809 CCAGCAGATGCAAGGGAGGCTGG + Intergenic
1133238555 16:4401456-4401478 GCACCTGCTGCGTGCCAGGCGGG + Intronic
1134096299 16:11421057-11421079 CCAGCAGAGGCCTAGCAGGCAGG - Intronic
1136072459 16:27796125-27796147 CCAGCTGATCTGTGCCAAGCTGG - Intronic
1137237271 16:46626183-46626205 CCAGCTGCTGGCTGGCAGGGTGG + Intergenic
1137447424 16:48540241-48540263 ACACCTGAGGCGTGGGAGGCAGG + Exonic
1138127678 16:54452340-54452362 CCAGCTCATGCCTGTCAGGACGG + Intergenic
1142041272 16:87896030-87896052 CCTGGGGATGTGTGGCAGGCAGG - Intronic
1142560795 17:807764-807786 CCAGCTGAGGGGAGGCAGCCTGG - Intronic
1143656067 17:8294482-8294504 CCAGCTGCTGCGCTGCGGGCAGG + Exonic
1144738317 17:17567184-17567206 CCACCTGGAGCCTGGCAGGCAGG - Intronic
1145932383 17:28695202-28695224 CCAGCTGCTGAATGGCAGACTGG - Intronic
1146957451 17:36943673-36943695 CCACCTGATGCACGGCAGGTCGG - Exonic
1148161517 17:45453097-45453119 CCCACTGATGGGCGGCAGGCTGG - Intronic
1148386980 17:47241159-47241181 GAAGCTGGTGAGTGGCAGGCTGG + Intergenic
1149396082 17:56245404-56245426 CCAGCAGAAGTGTGGCAGGAAGG - Intronic
1149538657 17:57452189-57452211 CCAGCTGGTGTCTGGGAGGCAGG + Intronic
1150286954 17:63960128-63960150 GCAGCTGGTGCCTGGCAGGAGGG - Intronic
1151933664 17:77248353-77248375 GAAGCTGATGGGTGGGAGGCAGG - Intergenic
1153915553 18:9741535-9741557 ACAGATGGTGCGTGGCTGGCAGG - Intronic
1158615294 18:58981527-58981549 CCAGCTGATGCATGGCATCAAGG + Exonic
1160862982 19:1245422-1245444 CCAGCTGGTGTGTGGACGGCGGG + Intergenic
1161014912 19:1978744-1978766 CCAGCTGGTGCGCGGCGGGCGGG + Exonic
1161232203 19:3179977-3179999 CCACCGGGTGCGTGCCAGGCAGG + Exonic
1161927614 19:7312916-7312938 CCAGCTGGTGTGTCTCAGGCAGG - Intergenic
1162312404 19:9914724-9914746 CCGGCTGATGCGTGGGCGGACGG - Intronic
1162584036 19:11548160-11548182 CCAGCTGATGCGTGGCAGGCTGG + Intronic
1165188484 19:34042099-34042121 CCTGCTGGTGAGTGGCAGCCAGG - Intergenic
1167851531 19:52206057-52206079 CCTGCTGGTGAGTGGAAGGCAGG + Exonic
1168398162 19:56066417-56066439 CCAGCTACAGCGTGGCTGGCAGG - Intergenic
925323145 2:2992621-2992643 CCAGCTGACGTTTGACAGGCAGG + Intergenic
925730243 2:6914965-6914987 CCTGCTCATGCGAAGCAGGCTGG - Intergenic
929531974 2:42758443-42758465 GCAGCTCATGGGTGGCAGGAGGG - Intergenic
929792137 2:45031145-45031167 CCAGCTGCTCTGGGGCAGGCAGG + Intergenic
929824835 2:45302009-45302031 CCAGCTGATGCTGGGAAGGCTGG - Intergenic
930736174 2:54781211-54781233 ACAGCTAGTGAGTGGCAGGCTGG + Intronic
933588973 2:84210632-84210654 TCAGCTAATGAGTGGCAAGCTGG - Intergenic
936271655 2:111053840-111053862 CCAGCTTATCCGAGGGAGGCAGG - Intronic
937993892 2:127679170-127679192 CCAGCTGCAGAGGGGCAGGCAGG + Intronic
938448493 2:131395221-131395243 CGAGCAGATGCGGGCCAGGCCGG + Intergenic
940751260 2:157628961-157628983 CCTGCTGCTGCAGGGCAGGCAGG + Exonic
945250338 2:207760551-207760573 TCAGCTGATGAGAGGCAGGTGGG - Intronic
945254164 2:207790208-207790230 CCAGCTGTTGGGAGGCTGGCAGG - Intergenic
945944727 2:215983790-215983812 CCTGCTGATGAGTGACAGGCAGG + Intronic
948783830 2:240340666-240340688 GCAGCTGGTGAGGGGCAGGCAGG + Intergenic
1172650240 20:36497397-36497419 CCAGCTGACCCGTGGGAGGCGGG + Intronic
1172763270 20:37336696-37336718 TCAGCTGGTGAGTGGGAGGCAGG + Intergenic
1172765315 20:37347609-37347631 CCAGCTGCTGGCTGGCAGGACGG - Intronic
1173984034 20:47247260-47247282 CCAGCCAATGCCTGGCAGGCTGG - Intronic
1179008026 21:37531637-37531659 CCAGCTGGAGGGAGGCAGGCAGG - Intergenic
1179152582 21:38821640-38821662 CCAGCTGATGAATGACTGGCAGG - Exonic
1180083267 21:45496443-45496465 CCAGCTGCTGCCTGACAGGCAGG + Intronic
1180147536 21:45929624-45929646 CCAGCTGGTGAGAGGGAGGCTGG + Intronic
1180629087 22:17214880-17214902 CCAGCTGAGGATTGACAGGCAGG - Intronic
1180872981 22:19157746-19157768 CCAGCTGAAGCCAGGCATGCTGG - Intergenic
1182509295 22:30807581-30807603 CCAGCTGCTGTGTGAGAGGCAGG - Intronic
1185276871 22:49953675-49953697 CCTGCTGAGGCCTGGCAGGCAGG - Intergenic
950742865 3:15063968-15063990 CCAGCTGATTCCAGGCAAGCAGG + Intronic
954294670 3:49667627-49667649 CCAGGTGGGACGTGGCAGGCAGG + Exonic
955803968 3:62714578-62714600 CCACCTGATACTTTGCAGGCAGG - Intronic
955998158 3:64699576-64699598 CCATCTGAAGGCTGGCAGGCTGG + Intergenic
956025366 3:64977463-64977485 CCAGGGGATGCATGGCTGGCTGG - Intergenic
956875632 3:73459876-73459898 CCAGCTAATACGTGGCAGGCAGG + Intronic
961413940 3:126743916-126743938 CCATCTGATGCGAGCCAGGAGGG - Intronic
961423525 3:126827334-126827356 CCAGATGACGCATGGCAGCCTGG - Intronic
961643004 3:128376519-128376541 CCAGCTGATGGGTGGGACCCTGG - Intronic
961750390 3:129090875-129090897 CCAGCTGCTGGCTGGCAGGGTGG + Exonic
964518904 3:157542912-157542934 CCGGCTGCTGCGTGGCACACGGG + Intergenic
966324118 3:178735230-178735252 CCAGCTGGTGGGTGGCAGACTGG - Intronic
968264602 3:197353186-197353208 CCACCTGCTGCCTGGAAGGCAGG + Intergenic
968483187 4:845899-845921 GCAGCAGATCCGTGGCTGGCGGG - Intergenic
968520722 4:1033627-1033649 CCCTCTGATGTGTGGCAGGGAGG + Intergenic
968630466 4:1648287-1648309 TCAGGTGATGCGGTGCAGGCAGG + Intronic
968703097 4:2065970-2065992 CCAGTTGGTGCGGGGCATGCTGG + Exonic
974549117 4:63349215-63349237 GCAGCTGAGACGTAGCAGGCCGG - Intergenic
980585004 4:134801054-134801076 AGAGGTGATGCGTGGTAGGCAGG + Intergenic
983510632 4:168606332-168606354 CCAGCTGACGCGGGGCAAGTAGG - Intronic
985619880 5:948641-948663 CCTTCTGAAGCGTGGGAGGCGGG + Intergenic
986096098 5:4555329-4555351 TCACCTGCTGAGTGGCAGGCAGG + Intergenic
986501701 5:8407672-8407694 CCAGCTGGCGGGTGGCAGGGGGG + Intergenic
992423607 5:76632433-76632455 CCAACTGATCCCTTGCAGGCTGG - Intronic
993010520 5:82477432-82477454 CCAGCTCATTCCAGGCAGGCAGG + Intergenic
994503748 5:100613462-100613484 ACAGCAGATGAGTGGCAGGCAGG + Intergenic
997293348 5:132753468-132753490 CCATGTGAGGAGTGGCAGGCAGG - Exonic
997465224 5:134083620-134083642 CCAGCTGAGGCCTGGAAGTCTGG - Intergenic
998390069 5:141781640-141781662 CCAGCAAGTGAGTGGCAGGCAGG + Intergenic
999271081 5:150296751-150296773 CCAGCTGAAGCATGGCAATCTGG - Exonic
1000306763 5:160001807-160001829 CCAGCTGATGAGTGCGAGGGTGG + Intergenic
1001409348 5:171499299-171499321 CCAGCTGCTGCGGGACAGACAGG - Intergenic
1001412525 5:171521018-171521040 CCTGCTGTTGCGGGGCAGGTGGG - Intergenic
1002839394 6:893012-893034 CCCGCAGATGGGTGGCAGGTGGG - Intergenic
1006793163 6:36716657-36716679 CCAGGTGTTGTGAGGCAGGCAGG + Intronic
1007685723 6:43666281-43666303 CCAGCTGCTGCCTGCCTGGCAGG - Intronic
1013394077 6:109716885-109716907 CCAGCTGACGAATGGCAGGGTGG - Intronic
1013499580 6:110734685-110734707 CCAGCTCATACTTGGCAGTCTGG - Intronic
1018844637 6:167547225-167547247 CCAGCAGCTGCCTGGCTGGCTGG + Intergenic
1019625669 7:2014552-2014574 CCAGCTGACGCGGCGCATGCGGG - Exonic
1020117015 7:5481649-5481671 CCAGGTGGGGCGTGGCTGGCCGG + Exonic
1021118846 7:16774410-16774432 CTGGATGATGCGTGGCAGGAGGG - Intronic
1021563117 7:21988484-21988506 CCTGCTGACCCGTGCCAGGCAGG - Intergenic
1024247947 7:47484703-47484725 CCTCCTGATGCATGGGAGGCAGG - Intronic
1025143306 7:56483594-56483616 CCCGCTGTCGCCTGGCAGGCAGG + Intergenic
1027199414 7:76053754-76053776 ACAGCCGATCCCTGGCAGGCAGG - Intronic
1032083552 7:128872188-128872210 CCAGCTGAAGGGTGGCAAACAGG + Intronic
1034138144 7:148790748-148790770 ACAGCTGATGTGTGTCAGGCAGG - Intronic
1035881273 8:3246209-3246231 ACAGTGGATGTGTGGCAGGCAGG - Intronic
1037150015 8:15626021-15626043 CCAGCTGTGGCGAGGGAGGCTGG + Intronic
1040794473 8:51273816-51273838 CAATCTGAGGCGTGGCATGCAGG + Intergenic
1043940745 8:86192938-86192960 GCAGCTGAGGAGTGGCAGGCAGG - Intergenic
1044123704 8:88431192-88431214 CCAGCTGATCCTAGCCAGGCTGG - Intergenic
1045327270 8:101126587-101126609 CTGGCTGTTGCGGGGCAGGCTGG + Intergenic
1045489386 8:102656843-102656865 CCAGCTGGTGGGAGGCAGGCTGG + Intergenic
1049232943 8:141493640-141493662 CCAGCTGGTGGGTGGCAGGTGGG - Intergenic
1049596228 8:143484733-143484755 CCAGCTACTGAGGGGCAGGCTGG + Intronic
1055595978 9:77864553-77864575 CCTGCTGCTGCGTGGGAGGATGG + Intronic
1056203217 9:84296336-84296358 CCAGCAGTTTAGTGGCAGGCTGG - Intronic
1056834665 9:89944708-89944730 CCAGCTGAGGCATGGGAGCCAGG + Intergenic
1058047809 9:100375811-100375833 TCAGCTCATGTGTGGCAGCCTGG - Intergenic
1058790123 9:108436179-108436201 CCAGCTGATGGTTGCCAGGCAGG - Intergenic
1061002949 9:127912674-127912696 CCAGCGGCTGCAGGGCAGGCAGG + Exonic
1062123499 9:134847121-134847143 CCACCTGCTGTGTGCCAGGCGGG + Intergenic
1187213696 X:17254219-17254241 CCAGCAGCTGCCTGGCAGCCTGG + Intergenic
1187386354 X:18852256-18852278 GTAGCTGAGGCGGGGCAGGCAGG + Intergenic
1191922389 X:66270664-66270686 CAAGCTGATGGGTGGCAGAAGGG + Intergenic
1192158924 X:68768551-68768573 GCAGCTGTTGAGGGGCAGGCTGG - Intergenic
1195755089 X:108192125-108192147 CCAGCTGATGCTTGCCAAGAGGG - Intronic
1198332060 X:135631132-135631154 CCACTTCATGGGTGGCAGGCTGG + Intergenic
1198334189 X:135651199-135651221 CCACTTCATGGGTGGCAGGCTGG - Intergenic
1199715708 X:150506156-150506178 CCTTCTGCTGTGTGGCAGGCTGG + Intronic