ID: 1162584781

View in Genome Browser
Species Human (GRCh38)
Location 19:11552087-11552109
Sequence TTGAGCTGGCCCGGAAGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 161}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162584781_1162584789 14 Left 1162584781 19:11552087-11552109 CCAGGGCTTCCGGGCCAGCTCAA 0: 1
1: 0
2: 1
3: 15
4: 161
Right 1162584789 19:11552124-11552146 GTTCACATCCGTCAGTGCCCTGG 0: 1
1: 0
2: 0
3: 8
4: 77
1162584781_1162584791 18 Left 1162584781 19:11552087-11552109 CCAGGGCTTCCGGGCCAGCTCAA 0: 1
1: 0
2: 1
3: 15
4: 161
Right 1162584791 19:11552128-11552150 ACATCCGTCAGTGCCCTGGGTGG 0: 1
1: 0
2: 0
3: 8
4: 90
1162584781_1162584792 19 Left 1162584781 19:11552087-11552109 CCAGGGCTTCCGGGCCAGCTCAA 0: 1
1: 0
2: 1
3: 15
4: 161
Right 1162584792 19:11552129-11552151 CATCCGTCAGTGCCCTGGGTGGG 0: 1
1: 0
2: 2
3: 14
4: 110
1162584781_1162584790 15 Left 1162584781 19:11552087-11552109 CCAGGGCTTCCGGGCCAGCTCAA 0: 1
1: 0
2: 1
3: 15
4: 161
Right 1162584790 19:11552125-11552147 TTCACATCCGTCAGTGCCCTGGG 0: 1
1: 0
2: 1
3: 8
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162584781 Original CRISPR TTGAGCTGGCCCGGAAGCCC TGG (reversed) Intronic
900822265 1:4898811-4898833 GTGAGCTGGTCCTGGAGCCCAGG + Intergenic
902191336 1:14765370-14765392 ATCAGCTGGCCCGGCAGCCAGGG + Intronic
902711557 1:18243447-18243469 TTCAGCTGGCTTGGAGGCCCAGG - Intronic
902785541 1:18730653-18730675 CTGAGCTGGCCCCGAGGGCCTGG - Intronic
903631970 1:24781468-24781490 TTGAGCTTGACCTGAAGCACGGG + Intronic
905009790 1:34739489-34739511 TTGAGCTGCACCAGAAGCCCCGG - Intronic
906348207 1:45034509-45034531 CTAAGGTGGCTCGGAAGCCCAGG - Intronic
906517466 1:46448175-46448197 TTGAGCTGGGCCGGACGCAAAGG - Intergenic
906839218 1:49118517-49118539 TTGAACTGGCCCTGCATCCCAGG + Intronic
912454181 1:109786884-109786906 CTGGGCTGGCCTGGGAGCCCTGG + Intergenic
913109292 1:115642644-115642666 TTGAGCCGGCCCTGGAGGCCTGG + Intronic
916935426 1:169623290-169623312 GTGAGCTGGCCCCAAAGCCAGGG - Intronic
920318433 1:205097303-205097325 GTGAGCCGGCCCGGAAGGCTGGG - Intronic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
924671277 1:246128637-246128659 TGGGGCTGGCCCTCAAGCCCAGG + Intronic
1067542773 10:47167806-47167828 TTGAGCTGGCTCAGATGCCCAGG - Intergenic
1070450070 10:76549138-76549160 TTCAGCTGCCCTGGGAGCCCAGG + Intronic
1070789477 10:79180848-79180870 GTGTGCTGGCCCCGAAGACCGGG - Intronic
1072639888 10:97203956-97203978 TGGAGCTGGAACTGAAGCCCAGG + Intronic
1074142002 10:110681187-110681209 CAGAACTGGCCCGGAATCCCAGG + Intronic
1077535051 11:3120078-3120100 TAGAGCTGGCAGGGCAGCCCCGG + Intronic
1078076052 11:8161794-8161816 TAGAGCTGGCCTGGAACTCCTGG - Intronic
1079162940 11:18011807-18011829 TTGAGGTGGCCCGGGAGCTGGGG - Intronic
1080639155 11:34148770-34148792 CTCATCTGGCCCGGAAGTCCCGG + Intergenic
1080780173 11:35421907-35421929 TTCAGCTGCCCTGGAAGACCAGG + Intergenic
1083773089 11:64879046-64879068 TCCAGCTGGCTCGGAATCCCCGG + Intronic
1084374091 11:68764218-68764240 TTGAGCTGGCCTGGTGGCCCCGG - Intronic
1086164230 11:83759233-83759255 TTGAGCTGTCCTGGAAGGGCAGG + Intronic
1089388149 11:118081298-118081320 CTGAGCCTGCCCGGAAACCCTGG + Intronic
1090396720 11:126424092-126424114 CTGAGCTGCCCCAGAAACCCCGG - Exonic
1090644665 11:128758025-128758047 TTGAGCTGGCAAGGTGGCCCAGG - Intronic
1095444989 12:42274032-42274054 TCCAGCTGGCCCGCAAGCACTGG + Intronic
1095587382 12:43863930-43863952 TCTAGCTGGCCCGCAAGCGCCGG - Intronic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1099428606 12:82553679-82553701 TTGGGGTGGCCCTGAAGCCTAGG + Intergenic
1100384361 12:94091804-94091826 TGGAGCTGGCTTGGAAGCCCTGG + Intergenic
1101951092 12:109175811-109175833 TTCCGCTGGTCCAGAAGCCCAGG + Intronic
1102250161 12:111381295-111381317 TAGTGCTGGCCCGGAATCCAGGG - Intergenic
1106169361 13:27275671-27275693 TAAAGCTGGCCGTGAAGCCCTGG - Intergenic
1112651856 13:101408281-101408303 TTGAGAGGGCCCGGAAGGACTGG - Intronic
1113805960 13:113110145-113110167 AAGAGCTGGCGAGGAAGCCCGGG + Intronic
1114614207 14:24059697-24059719 TTGCGATGTCCAGGAAGCCCAGG - Exonic
1115494160 14:33985796-33985818 TAGAGCTGGCCCTGAAGCTAAGG - Intronic
1115648441 14:35385888-35385910 GGGAGCTGGCCAGGAGGCCCAGG + Intergenic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1116653745 14:47626588-47626610 TCGCGCTGGCCCGCAAGCGCCGG - Intronic
1117176774 14:53153354-53153376 GTGCGCCGCCCCGGAAGCCCGGG + Intergenic
1118684875 14:68281510-68281532 TGGAGCTGAGCTGGAAGCCCAGG + Intronic
1120806423 14:88755988-88756010 AGGATCTGGCCCAGAAGCCCAGG - Intronic
1122200058 14:100117064-100117086 CTGTGCTGGCCTGGCAGCCCTGG - Intronic
1127287680 15:57545481-57545503 TTGAGCTGACCAGGCACCCCTGG + Intronic
1130648070 15:85745801-85745823 AGGAGCTGGCCCGGAAGGCGTGG + Intronic
1132723025 16:1326255-1326277 TGGAGCTGGCCCTGCTGCCCTGG + Exonic
1133015317 16:2936992-2937014 GTGAGGTGGCCCCGGAGCCCAGG - Intronic
1136110581 16:28062149-28062171 TAGAGCTGGCCCGAAAGACGTGG - Intronic
1136478499 16:30527153-30527175 CGGAGCTGACCCGGAGGCCCGGG - Intronic
1137405539 16:48186227-48186249 CTGAGCTGGCCTTGAAGCCTGGG - Intronic
1137666100 16:50249993-50250015 TTGAGCTGGGACTCAAGCCCAGG - Intronic
1138693633 16:58791115-58791137 TCCAGCTGGCCCAGAAGCGCCGG + Intergenic
1139392704 16:66615053-66615075 TTCAGCTGACGTGGAAGCCCTGG - Exonic
1139499493 16:67350619-67350641 TTGGGCAGCCCAGGAAGCCCAGG - Intronic
1139637023 16:68264171-68264193 TTGACCTGGGCCCGACGCCCAGG - Intergenic
1139852507 16:69959637-69959659 CTGGGCTGTCCCAGAAGCCCTGG + Intronic
1139881478 16:70182545-70182567 CTGGGCTGTCCCAGAAGCCCTGG + Intronic
1140371031 16:74412959-74412981 CTGGGCTGTCCCAGAAGCCCTGG - Intronic
1143208771 17:5167292-5167314 GTGAGCTGGCCCTCAAGCCAGGG - Intronic
1144618098 17:16795403-16795425 GTGAGCTGGCCCTCAAGCCAGGG - Intronic
1144894606 17:18520288-18520310 GTGAGCTGGCCCTCAAGCCAGGG + Intergenic
1147311750 17:39599665-39599687 CTGAGCTGGCCAGGAGGCCAAGG - Intergenic
1147664717 17:42139221-42139243 TTGAGCTGCCCATGAAGCCTGGG - Intronic
1147909381 17:43846372-43846394 CTGAGCTGGACCGGATTCCCTGG - Intergenic
1149871518 17:60186269-60186291 GTGAGCTGGCCCTCAAGCCAGGG + Intronic
1151720981 17:75855851-75855873 TTTAGCTGAGCCGGAGGCCCCGG + Intronic
1151879581 17:76887097-76887119 TTAAGCTGGCGCTGTAGCCCTGG + Intronic
1152516245 17:80826511-80826533 CTGGGCTGGGCCGGAGGCCCTGG - Intronic
1158422114 18:57304349-57304371 CTGAGCTGGACCTGAAACCCAGG + Intergenic
1161502144 19:4622215-4622237 TGGTGCTGGCCAGGAAGCCAAGG + Intergenic
1161581570 19:5083573-5083595 CTGAGCTGTCCCGGCAGGCCAGG + Intronic
1162584781 19:11552087-11552109 TTGAGCTGGCCCGGAAGCCCTGG - Intronic
1162749742 19:12821586-12821608 CTGAGCTGACCAGGAAGCCTGGG - Intronic
1166108594 19:40609831-40609853 GTGGGCCGGCTCGGAAGCCCGGG - Exonic
1166337059 19:42114660-42114682 TAGAGCCGGCCTGGAAGTCCAGG - Intronic
925226194 2:2185895-2185917 TTGGGAAGGCCCGGAAGGCCCGG - Intronic
925841630 2:7997448-7997470 TTGAGCTGGAACTGAAACCCAGG + Intergenic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
929488004 2:42372005-42372027 CGGAGCAGGCCCTGAAGCCCTGG + Intronic
933899751 2:86840977-86840999 TTGAGCTGGCCAGGAAAAGCAGG + Intronic
934950529 2:98572397-98572419 TTGAGCAGGCCTGGAAACCTTGG - Intronic
936894299 2:117409076-117409098 TTAAGCTGGCCCGGAAGCCTAGG - Intergenic
937226436 2:120372653-120372675 TAGAGCAGGCTCTGAAGCCCTGG - Intergenic
937846238 2:126582296-126582318 TTGAGCTGCCCTTGAAGCCCTGG - Intergenic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
943106185 2:183546975-183546997 TCGTGCTGGCCTGCAAGCCCAGG + Intergenic
944757079 2:202774427-202774449 TTGAGCTGGCCTGGACGAACGGG - Exonic
945924741 2:215791728-215791750 TGGAGATGCCCCTGAAGCCCAGG + Intergenic
946007181 2:216535433-216535455 TCGAGCTGTCCCTGAAGCCTGGG + Intronic
946380883 2:219348047-219348069 TTGAGCTGGCCCTGGAGGTCTGG - Intergenic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
947588298 2:231370454-231370476 CTGAGCTGGCCCTGCTGCCCCGG + Intronic
948127160 2:235572614-235572636 TTTAGCTGGGGCAGAAGCCCAGG - Intronic
1169204754 20:3733264-3733286 TCAAGCTGGCCCGGAAGACCAGG - Intronic
1170658748 20:18315931-18315953 TTGACCTGTCGCTGAAGCCCAGG - Exonic
1172194439 20:33082758-33082780 ATGAGCTGGCCAGGATGCCAGGG + Intronic
1172435986 20:34929282-34929304 CAGAGCTGGCACCGAAGCCCAGG + Intronic
1173228775 20:41178003-41178025 TTGGGGTGGCCCTGAAGGCCTGG - Intronic
1173647817 20:44644489-44644511 GTGAGCTGACCAGGCAGCCCTGG - Intronic
1174115621 20:48224665-48224687 TGGAGCTGGGCGTGAAGCCCTGG - Intergenic
1174164993 20:48578158-48578180 TGGAGCTGGGCGCGAAGCCCTGG + Intergenic
1175897638 20:62346390-62346412 CTGGGCTGGCCTGGAAGCTCAGG + Intronic
1176430014 21:6569729-6569751 CTGACCTGGGCCGGAAGCCGGGG - Intergenic
1179705408 21:43177191-43177213 CTGACCTGGGCCGGAAGCCGGGG - Intergenic
1179788809 21:43743855-43743877 TGGGGCTGGCCTGGGAGCCCGGG + Intronic
1180014095 21:45071824-45071846 TGGAGCGGGCACGGAAGGCCAGG + Intergenic
1180732456 22:17992420-17992442 TTTAACTGGCCAGGAAGCCCTGG - Intronic
1181517202 22:23421742-23421764 TTTAACTGGCCAGGAAGCCCTGG - Intergenic
1181793753 22:25288370-25288392 ATGAGATGGCCCCCAAGCCCAGG + Intergenic
1182697983 22:32209119-32209141 GTGAGCTGGCCTGGCAGGCCTGG + Intergenic
1185235837 22:49712418-49712440 TGGAGCTGGCCTGGGAGCCGCGG - Intergenic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
952877490 3:37958896-37958918 CTGAGCTGGCCCGGATGGACTGG - Intronic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
957380997 3:79429337-79429359 TTGAGCTGGACCGTAAAGCCAGG + Intronic
957983618 3:87544456-87544478 TTCAGATGGTCCTGAAGCCCAGG - Intergenic
959323633 3:104908871-104908893 TTGAACTGGCCAGTAAGCACTGG - Intergenic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
961547847 3:127647862-127647884 TTGAGCTGTCCCTGAAGCCAGGG + Intronic
962606675 3:137037905-137037927 CTGAGCTGGCCGAGAAGCCAGGG - Intergenic
962758219 3:138484680-138484702 TCCAGCTGGCCCGCAAGCACCGG - Intergenic
968547241 4:1205581-1205603 TTGGGCTGGCAGGGAAGGCCAGG - Intronic
969695059 4:8729601-8729623 ATGAGCTGGGCCTGCAGCCCTGG - Intergenic
971809536 4:31406240-31406262 TAGAGCTGCCCCGGAAGCTTAGG - Intergenic
974487051 4:62518877-62518899 TTGAGCTGTCCCAGAAGTGCAGG - Intergenic
975754795 4:77561919-77561941 TTGTGCTGGCCCACAAGCACTGG - Intronic
981123017 4:141074004-141074026 TTCTGCTGGCCCAGAAGTCCAGG - Intronic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
981531092 4:145754277-145754299 TTGAGGTGGCAAAGAAGCCCTGG - Intronic
984884989 4:184442098-184442120 CTGAGCTGGCCCGGGTGCACAGG + Intronic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
987340772 5:16936727-16936749 TTGATCTGGCCCCGCAGCCCCGG - Intergenic
988489160 5:31692293-31692315 TTGCGCTGGCCCGCAAGCACCGG + Intronic
990516187 5:56533032-56533054 GTGAGCTGTCCCAGAAGGCCAGG - Intronic
993480545 5:88419076-88419098 TAGAGCTGGGCCTGGAGCCCAGG + Intergenic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
997282087 5:132655859-132655881 TTGCTCTGGCCCCGAAGCGCTGG - Intergenic
1013796642 6:113896118-113896140 TTGAGCTGCCCTGGAAGCTCAGG + Intergenic
1014818077 6:125956919-125956941 CTGCGCGGGCCCGGTAGCCCTGG + Exonic
1015665725 6:135626357-135626379 TCCAGCTGACCCAGAAGCCCAGG + Intergenic
1018971473 6:168532325-168532347 TGGAGCTGGCCCCCAATCCCAGG - Intronic
1019517168 7:1445161-1445183 TGCAGCTGGAACGGAAGCCCTGG + Exonic
1022104876 7:27190415-27190437 AAGAACTGGCCCGGAGGCCCCGG + Intergenic
1023396236 7:39754267-39754289 TCTAGCTGGCCTGCAAGCCCCGG + Intergenic
1023680094 7:42676751-42676773 TTCTGCTGGACTGGAAGCCCTGG + Intergenic
1024704158 7:51938912-51938934 TTGAGGTGGACCTGAAGCCTAGG + Intergenic
1028364492 7:90011691-90011713 TGGAGCTGGGCCTGAAGCCCTGG + Intergenic
1029439186 7:100577853-100577875 CAGAGCTGGCCCGGGAGCCCCGG - Exonic
1029619759 7:101682732-101682754 TGGAGCTGCCGTGGAAGCCCTGG + Intergenic
1029957915 7:104659145-104659167 TGGGGCTGGCCCTGAAGCCTGGG - Intronic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1037415121 8:18641294-18641316 CTCAGCTGGCCCTGATGCCCAGG - Intronic
1038230230 8:25692776-25692798 CTGAGATGGCCCAGAAGCCCAGG + Intergenic
1041589762 8:59564238-59564260 GTCAGCTGGCAAGGAAGCCCAGG - Intergenic
1042892694 8:73630698-73630720 CTGAGCTGGCCCTCCAGCCCAGG - Intronic
1042988524 8:74611973-74611995 ATGAGCTTGCCCTGAATCCCAGG - Intronic
1048363807 8:133720883-133720905 CAGAGCTGGCCCTGAAACCCAGG + Intergenic
1049389617 8:142361014-142361036 TGGAGCTGTTCTGGAAGCCCCGG - Intronic
1055404562 9:75961144-75961166 TTGAGCTGAACCTGAAGTCCAGG + Intronic
1056552060 9:87660172-87660194 TGGAGCTGGCGTGGAGGCCCAGG + Intronic
1056820169 9:89835848-89835870 CTGAGCTGTCCTGGAGGCCCCGG + Intergenic
1057867314 9:98691790-98691812 TTGAGCTGGCCTTGAAGGACAGG - Intronic
1061326726 9:129868811-129868833 TGGAGCTGGCCTGGCTGCCCTGG + Intronic
1061339805 9:129970755-129970777 ATGAGCAGTCCTGGAAGCCCTGG - Intronic
1061815561 9:133192492-133192514 TTGAGCTGGGCCAGGAGCTCCGG + Intergenic
1062451557 9:136617846-136617868 CTGAGCTTGGCCGGAAGGCCTGG + Intergenic
1192546588 X:72019233-72019255 TGGAGCTGGCACTGAAACCCTGG - Intergenic
1195564230 X:106323323-106323345 TTGGGGTGGGCCTGAAGCCCAGG - Intergenic
1200002360 X:153068636-153068658 TTCAGCTGGCCCCAAAGCACAGG - Intergenic
1200005364 X:153081374-153081396 TTCAGCTGGCCCCAAAGCACAGG + Intergenic
1200007625 X:153098353-153098375 GTGGGCTGTCCCTGAAGCCCTGG + Intergenic