ID: 1162591692

View in Genome Browser
Species Human (GRCh38)
Location 19:11596510-11596532
Sequence CATTAAATGCAAATATTGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1104
Summary {0: 1, 1: 0, 2: 2, 3: 65, 4: 1036}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162591688_1162591692 23 Left 1162591688 19:11596464-11596486 CCAGAAGAAGACAGTGCCTACTC 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1162591692 19:11596510-11596532 CATTAAATGCAAATATTGGCCGG 0: 1
1: 0
2: 2
3: 65
4: 1036
1162591690_1162591692 7 Left 1162591690 19:11596480-11596502 CCTACTCTGGCAAGCTAGAAGCA 0: 1
1: 0
2: 1
3: 5
4: 99
Right 1162591692 19:11596510-11596532 CATTAAATGCAAATATTGGCCGG 0: 1
1: 0
2: 2
3: 65
4: 1036

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162591692 Original CRISPR CATTAAATGCAAATATTGGC CGG Intronic
900210504 1:1453496-1453518 CTATAAATACAAAAATTGGCCGG - Intronic
900218007 1:1492022-1492044 CAAAAAATGAAAAAATTGGCCGG + Intronic
900871784 1:5309370-5309392 CTTAAAATGCAAAAATTAGCTGG - Intergenic
900921511 1:5674484-5674506 CATAAAATGCAAAAATTAGCTGG - Intergenic
901009844 1:6194042-6194064 CAAAAAATACAAATATTAGCCGG + Intronic
901256518 1:7832782-7832804 CATTAAATGTTTATATTGGGGGG - Intronic
901476379 1:9492746-9492768 CATTAAACTTCAATATTGGCTGG + Intergenic
901543763 1:9939955-9939977 CAATAAATTAAAATATTAGCTGG + Intronic
902007472 1:13243743-13243765 CTTAAAATGCAAACATTAGCCGG + Intergenic
902029281 1:13409887-13409909 AATAAAATACAAAAATTGGCTGG - Intergenic
902848872 1:19137136-19137158 CAAAAAATACAAAAATTGGCCGG + Intronic
903209714 1:21810678-21810700 CTATAAATACAAATATTAGCCGG - Intergenic
903460858 1:23519914-23519936 CATAAAATACAAAAATTAGCCGG + Intronic
903622809 1:24710289-24710311 CAAAAAATACAAAAATTGGCTGG - Intergenic
903818750 1:26084728-26084750 CAAAAAATGCAAAAATTAGCCGG + Intergenic
903955202 1:27020790-27020812 CAAAAAATACAAAAATTGGCTGG - Intergenic
904743111 1:32693938-32693960 CAAAAAATACAAAAATTGGCCGG + Intronic
905030505 1:34880213-34880235 CAAAAAATGCAAAAATTAGCTGG - Intronic
906056355 1:42921059-42921081 TCTTAAATTCAAATATTTGCAGG - Intergenic
906459305 1:46025155-46025177 CAAAAAATGCAAAAATTAGCTGG + Intronic
906506346 1:46382761-46382783 CAAAAAATGCAAAAATTAGCTGG - Intergenic
906903827 1:49866600-49866622 CTAAAAATGCAAATATTAGCCGG + Intronic
908273196 1:62440779-62440801 AAATAAATGAAAATATTGGAAGG + Intronic
909010954 1:70334463-70334485 CATAAAATGAAAAAATTAGCCGG + Intronic
909349783 1:74637756-74637778 CAAAAAATGCAAAAATTAGCTGG + Intronic
909424517 1:75507062-75507084 CAAAAAATGCAAAAATTAGCTGG - Intronic
909435107 1:75631831-75631853 CAAAAAATACAAAAATTGGCTGG - Intergenic
909550424 1:76893820-76893842 CAAAAAATGCAAAAATTAGCCGG - Intronic
909571771 1:77120516-77120538 ATTTAAAAGCAAATTTTGGCCGG - Intronic
909936946 1:81562356-81562378 CTTTAAATGAAAATATGGGTGGG - Intronic
910107402 1:83646301-83646323 CAAAAAATGCAAATACTAGCTGG + Intergenic
910250212 1:85189672-85189694 CAAAAAATACAAAAATTGGCTGG + Intronic
910265772 1:85335659-85335681 TATAAAAAGCAAATGTTGGCTGG + Intronic
910596473 1:88986017-88986039 CAAAAAATACAAATATTGGCCGG + Intronic
910605514 1:89079344-89079366 CAATAAATGTAAGTACTGGCAGG - Intergenic
910879062 1:91906165-91906187 AAATAAATACAAAAATTGGCCGG + Intronic
910920483 1:92341168-92341190 CAAAAAATACAAAAATTGGCGGG - Intronic
910921631 1:92354594-92354616 CATTAAATGCAAACATTAACAGG + Intronic
910931972 1:92451924-92451946 CAAAAAATACAAATATTAGCCGG - Intergenic
910943046 1:92557884-92557906 AAATAAATACAAAAATTGGCTGG - Intronic
911028172 1:93457047-93457069 CAAAAAATACAAATATTAGCTGG - Intronic
911178032 1:94836747-94836769 CAAAAAATGCAAAAATTAGCTGG + Intronic
911628327 1:100152886-100152908 CTAAAAATGCAAAAATTGGCCGG - Intronic
911843183 1:102711264-102711286 GATTAAATCCACAAATTGGCTGG + Intergenic
913428958 1:118767682-118767704 TCTTAAATGCAAATATTGTTGGG + Intergenic
914227735 1:145735422-145735444 CAAAAAATACAAAAATTGGCTGG + Intronic
914337963 1:146733108-146733130 CAATAAATACAAAAATTAGCTGG - Intergenic
914737045 1:150427635-150427657 CAATAAATACAAAAATTAGCTGG + Intronic
914819236 1:151087149-151087171 CAAAAAATACAAAAATTGGCTGG - Intronic
915390664 1:155540605-155540627 CAAAAAATGCAAAAATTAGCTGG + Intronic
915423293 1:155802792-155802814 CAAAAAATACAAAAATTGGCCGG + Intronic
916085983 1:161269835-161269857 CAAAAAATACAAATATTAGCCGG + Intronic
916422912 1:164653026-164653048 CAAAAAATGCAAAAATTAGCCGG - Intronic
916710919 1:167407189-167407211 CAAAAAATACAAATATTAGCTGG - Intronic
917111107 1:171549002-171549024 CAAAAAATGCAAAAATTAGCTGG - Intronic
917553931 1:176064783-176064805 CAAAAAATGCAAAAATTGGCTGG - Intronic
917562871 1:176178358-176178380 TAATAAATGCAAAAATTAGCTGG + Intronic
917695533 1:177519458-177519480 CTAAAAATGCAAATATTAGCTGG + Intergenic
918034962 1:180859926-180859948 CATTAACAGAAAATATTTGCAGG + Intronic
918087268 1:181256339-181256361 CAAAAAATACAAAAATTGGCGGG + Intergenic
918474009 1:184904190-184904212 CAAAAAATACAAAAATTGGCTGG - Intronic
918623904 1:186636272-186636294 CAGAAAATGCAAAAATTAGCTGG + Intergenic
918806832 1:189059043-189059065 CATAAAATGCAAATTCTGGCCGG + Intergenic
919614877 1:199794094-199794116 CAAAAAATACAAAAATTGGCTGG - Intergenic
919720841 1:200833397-200833419 CAATAAATACAAAAATTAGCTGG + Intronic
919864655 1:201771347-201771369 CTTAAAATACAAAAATTGGCCGG + Intronic
919999337 1:202784870-202784892 CAAAAAATACAAAAATTGGCCGG + Intronic
920396615 1:205650878-205650900 CTAAAAATGCAAAAATTGGCTGG + Intergenic
920580947 1:207107224-207107246 CATTAACTGCAAATGCTTGCAGG + Intronic
920911462 1:210221563-210221585 CAAAAAATACAAAAATTGGCCGG + Intergenic
921098513 1:211908318-211908340 AATAAAATACAAAAATTGGCTGG + Intergenic
921157633 1:212450559-212450581 CATCAAATGCAATCATTGCCTGG + Intergenic
922166628 1:223120919-223120941 CAAAAAATGCAAAAATTGGCTGG + Intronic
922292718 1:224221954-224221976 CAAAAAATGCAAAAATTAGCTGG - Intergenic
923019100 1:230149040-230149062 CAAAAAATGCAAAAATTAGCTGG - Intronic
923059492 1:230457591-230457613 CAAAAAATGCAAAAATTAGCTGG + Intergenic
923133612 1:231098294-231098316 CATTAAAAGAAAATATTTGCAGG + Intergenic
923494848 1:234514966-234514988 CTAAAAATGCAAAAATTGGCTGG - Intergenic
923602589 1:235416362-235416384 AAATAAATGCAAAAATTAGCTGG + Intronic
923646342 1:235824543-235824565 GATTAAAAGCAAAGATAGGCTGG + Intronic
1062776011 10:148503-148525 GAGTGAATGCAAATATTGGACGG - Intronic
1062875146 10:937202-937224 CAAAAAATGCAAAAATTAGCTGG - Intergenic
1063632474 10:7746877-7746899 CGTTAAATGCAAATAATGACTGG + Intronic
1063634159 10:7765295-7765317 CAAAAAATACAAAAATTGGCAGG + Intronic
1063658146 10:8012013-8012035 CAGAAAATACAAAAATTGGCTGG + Intronic
1064191509 10:13210214-13210236 CAAAAAATGCAAAAATTAGCTGG - Intronic
1064450495 10:15438128-15438150 CTAAAAATGCAAAAATTGGCTGG + Intergenic
1064540354 10:16398760-16398782 CATTAAATCAGAATTTTGGCTGG + Intergenic
1064587151 10:16850767-16850789 CATTAAAAGTAAATAAAGGCTGG - Intronic
1064950830 10:20848306-20848328 CATTAAATGTAAATTTTTGTAGG + Intronic
1065572993 10:27090932-27090954 CAAAAAATGCAAAAATTAGCTGG + Intronic
1065734918 10:28743030-28743052 CATAAAATACAAAAATTAGCTGG - Intergenic
1065783614 10:29192981-29193003 CAAGAAATACAAAAATTGGCAGG + Intergenic
1065801925 10:29359940-29359962 AATTAAATGCCAGTAATGGCTGG - Intergenic
1065949801 10:30641544-30641566 CTAAAAATGCAAAAATTGGCGGG + Intergenic
1066274782 10:33857841-33857863 CGAAAAATGCAAAAATTGGCTGG - Intergenic
1066315664 10:34243672-34243694 CAAAAAATACAAAAATTGGCTGG + Intronic
1066318323 10:34272566-34272588 CAAAAAATGCAAAAATTAGCTGG + Intronic
1066344299 10:34568176-34568198 CATAAAATGCAATTTTTGGAAGG - Intronic
1066449952 10:35519937-35519959 CAAAAAATGCAAAAATTAGCTGG - Intronic
1067378220 10:45747879-45747901 CTATATATGAAAATATTGGCTGG - Intronic
1067500576 10:46801259-46801281 AATAAAATGAAAACATTGGCTGG + Intergenic
1067594010 10:47538643-47538665 AAAAAAATGAAAATATTGGCTGG - Intronic
1067885921 10:50088554-50088576 CTATATATGAAAATATTGGCTGG - Intronic
1068037193 10:51775744-51775766 TATTAAATTCAAACATTAGCCGG - Intronic
1068200117 10:53773552-53773574 CCGTAAATGCAAAAATTAGCCGG - Intergenic
1068424779 10:56845996-56846018 CAGGAAATGCAAATGTTGTCTGG + Intergenic
1068535502 10:58236906-58236928 CAAAAAATGCAAAAATTAGCCGG + Intronic
1068537960 10:58261741-58261763 CAAAAAATGCAAAAATTAGCCGG - Intronic
1069268993 10:66500095-66500117 TAAGAAATGCAACTATTGGCCGG - Intronic
1069312770 10:67059406-67059428 AATTAATTGCAAAAATTGGAGGG + Intronic
1069447778 10:68489737-68489759 CAAAAAATACAAATATTAGCTGG + Intronic
1069529269 10:69203885-69203907 CAAAAAATGCAAAAATTAGCTGG - Intronic
1069531637 10:69224044-69224066 CAAAAAATGCAAAAATTAGCTGG + Intronic
1069638917 10:69942609-69942631 CAATAAATGTTAATATTGGCAGG - Intronic
1070104836 10:73421695-73421717 CAAAAAATACAAAAATTGGCTGG + Intergenic
1070164914 10:73890045-73890067 CAAAAAATACAAATATTAGCTGG - Intergenic
1070252842 10:74788006-74788028 TAAAAAATGTAAATATTGGCCGG + Intergenic
1070968147 10:80542557-80542579 TATTAAATACAAAAATTAGCTGG - Intronic
1072061695 10:91818692-91818714 CAAAAAATACAAAAATTGGCTGG - Intronic
1072119922 10:92397127-92397149 CATGAGATGCTAATATTGGCTGG + Intergenic
1072442999 10:95473464-95473486 TATTAAATACAAAAATTAGCTGG + Intronic
1072561405 10:96578912-96578934 CTTAAAATACAAATATTAGCAGG + Intronic
1072639156 10:97197913-97197935 CAAAAAATGCAAACATTAGCTGG + Intronic
1072699594 10:97631010-97631032 CAAAAAATGCAAAAATTAGCTGG - Intronic
1072957726 10:99902050-99902072 CAAAAAATGCAAAAATTAGCAGG - Intronic
1073188425 10:101631921-101631943 TATAAAATGTAAATAATGGCTGG - Intronic
1073283632 10:102373412-102373434 CAATAAATACAAAAATTAGCTGG + Intronic
1073727977 10:106257150-106257172 CAGTATATGCAAATAATAGCGGG - Intergenic
1073760339 10:106622126-106622148 CTATAAATGCAAAAATTAGCTGG + Intronic
1074430712 10:113391904-113391926 CATGAAATGCAAATTTTAACTGG - Intergenic
1075053653 10:119202211-119202233 CTTTAAAGAAAAATATTGGCCGG + Intergenic
1075395027 10:122120924-122120946 CAAAAAATGCAAAAATTAGCTGG - Intronic
1077604931 11:3603220-3603242 CATAAAATACAAAAATTGGCCGG + Intergenic
1077624545 11:3758621-3758643 CTTTAAATACAAAAATTAGCTGG + Intronic
1077933626 11:6759589-6759611 GAAAAAATGCAAATATTAGCTGG - Intergenic
1078245569 11:9571218-9571240 CTAAAAATGCAAATATTAGCTGG + Intergenic
1078635427 11:13045309-13045331 CTAAAAATGCAAATATTGGCCGG + Intergenic
1078950957 11:16133848-16133870 TACTAAATGCAAAAATTAGCTGG - Intronic
1079057462 11:17218927-17218949 CAAAAAATACAAATATTAGCTGG - Intronic
1079063198 11:17267492-17267514 AATTAAATGCAGAAATTAGCCGG - Intronic
1079067632 11:17310473-17310495 CTTAAAATACAAATATTAGCCGG + Intronic
1079668988 11:23142551-23142573 TATCAAATGGAAATATTGACCGG + Intergenic
1079793233 11:24765920-24765942 CAAAAAATGCAAAAATTGGCCGG - Intronic
1079956291 11:26869481-26869503 CTAAAAATGCAAAAATTGGCTGG - Intergenic
1080450552 11:32375383-32375405 CAAAAAATGCAAAAATGGGCCGG + Intergenic
1080527906 11:33145511-33145533 AAAGAAATGCAAATATTGGCCGG + Intronic
1080543575 11:33294003-33294025 CTAAAAATGCAAAAATTGGCCGG + Intronic
1080624878 11:34019691-34019713 CATTACAGGAAAATATGGGCTGG + Intergenic
1080627266 11:34041886-34041908 CAAAAAATGCAAAAATTAGCTGG + Intergenic
1080665898 11:34336101-34336123 AATTAAAAACAAATATTGGATGG - Intronic
1080875294 11:36269468-36269490 CATAAAATACAAATATCAGCTGG - Intergenic
1080975520 11:37335315-37335337 CATTAAATGGAAATATTAAGAGG + Intergenic
1081630903 11:44688888-44688910 CATGAAGTGCAAACATGGGCAGG + Intergenic
1081860098 11:46328194-46328216 CTAAAAATGCAAAAATTGGCTGG + Intergenic
1082860055 11:57847013-57847035 CAGAAAATGCAAAAATTAGCTGG - Intergenic
1083098973 11:60283226-60283248 CACAAAATGCAAAAATTAGCTGG - Intronic
1084078196 11:66798908-66798930 CTAAAAATACAAATATTGGCTGG + Intronic
1084333114 11:68441237-68441259 CAAAAAATGTAAATATTAGCTGG - Intronic
1084739862 11:71132661-71132683 CATTTAAAGCAAATATTGTAAGG - Intronic
1084948155 11:72650181-72650203 CAAAAAATACAAATATTAGCCGG - Intronic
1084986486 11:72877842-72877864 CAAAAAATGCAAAAATTAGCTGG + Intronic
1085060785 11:73444961-73444983 CATAAAATGATTATATTGGCTGG + Intronic
1085141829 11:74151486-74151508 CAAAAAATACAAAAATTGGCTGG - Intronic
1085174664 11:74475370-74475392 CAAAAAATGCAAAAATTAGCCGG - Intergenic
1085187434 11:74588412-74588434 CATTCAACCCTAATATTGGCAGG + Intronic
1085426130 11:76406132-76406154 CAAAAAATGCAAAAATTAGCTGG - Exonic
1085473753 11:76775021-76775043 CAAAAAATGCAAAAATTAGCTGG - Intergenic
1085573446 11:77580657-77580679 CTTTAAATACAAAAATTAGCCGG - Intronic
1085625523 11:78069048-78069070 CATAAAATACAAAAATTAGCTGG - Exonic
1086162930 11:83743593-83743615 CAGAAAATGCAAAAATTAGCTGG - Intronic
1087389223 11:97513284-97513306 AATTAAATGCAAAGAATGCCTGG + Intergenic
1087411393 11:97794037-97794059 CAATATATGCAAATATTCGGTGG + Intergenic
1088794127 11:113252945-113252967 TATTAAATAATAATATTGGCTGG - Intronic
1089241570 11:117085821-117085843 CAAAAAATACAAAAATTGGCCGG + Intronic
1089313979 11:117578071-117578093 CTAAAAATGCAAATATTAGCTGG + Intronic
1089401611 11:118167716-118167738 CAGAAAATGCAAAAATTAGCTGG - Intronic
1090536577 11:127648101-127648123 CTAAAAATGCAAAAATTGGCTGG - Intergenic
1091113397 11:132992615-132992637 AACTAAATGGAAATATTGGATGG + Intronic
1091176036 11:133558809-133558831 CTAAAAATGCAAAAATTGGCTGG - Intergenic
1091420969 12:340035-340057 CAATAAATACAAAAATTAGCTGG - Intronic
1092234320 12:6796702-6796724 CAGTGATTGCAAATATTGACAGG - Intronic
1092591354 12:9954331-9954353 CAAAAAATACAAATATTAGCTGG + Intronic
1093280118 12:17184046-17184068 GTTTAAATGTTAATATTGGCAGG + Intergenic
1093459549 12:19395856-19395878 CAAAAAATGCAAAAATTAGCTGG + Intergenic
1093486886 12:19662039-19662061 CTTTAAATACAAAAATTAGCTGG + Intronic
1093728929 12:22545519-22545541 CAAGAAATGCAAAAATTAGCTGG + Intergenic
1094160693 12:27386789-27386811 CAAAAAATACAAAAATTGGCCGG - Intronic
1094573372 12:31661753-31661775 CATAATAAGAAAATATTGGCCGG - Intronic
1094745509 12:33340315-33340337 CTTTATATGCAAATTTTGGCAGG + Intergenic
1095116877 12:38364901-38364923 CTAAAAATGCAAAAATTGGCTGG + Intergenic
1095208316 12:39463575-39463597 CAGAAAATTTAAATATTGGCTGG - Intergenic
1095334660 12:41010790-41010812 CATTTAATGCACATATTGGAGGG - Intronic
1095638873 12:44464134-44464156 ACTTAAATGCAAATATTGAGAGG - Intergenic
1096129135 12:49143570-49143592 CAAAAAATACAAAAATTGGCTGG - Intergenic
1096146966 12:49285072-49285094 CAAAAAATGCAAAAATTAGCTGG + Intergenic
1096273355 12:50184478-50184500 CAGAAAATGCAAACATTAGCTGG + Intronic
1096358485 12:50963206-50963228 CTTAAAATACAAAAATTGGCTGG + Intronic
1096364798 12:51019804-51019826 CAACAAATACAAAAATTGGCAGG - Intronic
1096397472 12:51277138-51277160 CAAAAAATGCAAAAATTAGCCGG + Intergenic
1096723212 12:53539906-53539928 AAATAAATGCAAAAATTAGCTGG + Intronic
1096723925 12:53545894-53545916 CAAAAAATACAAAAATTGGCTGG + Intronic
1096734489 12:53642012-53642034 AATTAAAATCATATATTGGCCGG + Intronic
1096939691 12:55328431-55328453 CAACAAATGCAAAAATTAGCCGG + Intergenic
1097095086 12:56540802-56540824 AATTAAACCTAAATATTGGCTGG + Intronic
1097726216 12:63078533-63078555 TATTAAATGGAAATAGAGGCCGG + Intergenic
1097792972 12:63834221-63834243 CAAAAAATACAAAAATTGGCTGG - Intergenic
1097810298 12:64011936-64011958 CATAAAATACAAAAATTAGCTGG + Intronic
1097888678 12:64755838-64755860 CCTAAAATACAAAAATTGGCCGG - Intronic
1098540737 12:71653850-71653872 CACTAAATACAAAAATTAGCCGG + Intronic
1098925924 12:76349211-76349233 CTAAAAATACAAATATTGGCGGG - Intergenic
1099206990 12:79739979-79740001 CATAAAATACAAAAATTAGCTGG - Intergenic
1099359892 12:81687136-81687158 TTTTAAATGCAAATATAGACAGG + Intronic
1099862514 12:88238228-88238250 CAATAAATACAAAAATTAGCTGG - Intergenic
1100153631 12:91771751-91771773 CTAAAAATGCAAATATTAGCTGG + Intergenic
1100177540 12:92048194-92048216 CAAGAAAAGAAAATATTGGCTGG + Intronic
1100182222 12:92098072-92098094 CTTAAAATGAAAATCTTGGCTGG - Intronic
1100461360 12:94802829-94802851 CATTAAATGCAAAAACTCTCTGG + Intergenic
1100521094 12:95376788-95376810 CAAAAAATACAAAAATTGGCCGG - Intergenic
1100546797 12:95611167-95611189 CATAAAATGCAAAAATTAGCTGG - Intergenic
1100911613 12:99370296-99370318 CATTTAGGGGAAATATTGGCAGG + Intronic
1101146945 12:101849784-101849806 CAAAAAATGCAAAAATTAGCTGG + Intergenic
1101152298 12:101894411-101894433 CAAAAAATACAAAAATTGGCCGG - Intronic
1101165666 12:102029519-102029541 AAATAAATGTAAATATTGGCAGG - Intronic
1101464351 12:104932461-104932483 CAAAAAATGCAAAAATTAGCTGG + Intronic
1102389856 12:112540795-112540817 CAAAAAATGCAAAAATTAGCTGG - Intergenic
1102696631 12:114804851-114804873 CAAAAAATACAAAAATTGGCTGG - Intergenic
1102757125 12:115350792-115350814 CAAAAAATACAAAAATTGGCTGG + Intergenic
1103449953 12:121021647-121021669 CAAAAAATGCAAAAATTAGCCGG + Intronic
1103524017 12:121555532-121555554 CAAAAAATACAAATATTAGCCGG - Intronic
1103540983 12:121666340-121666362 CAGAAAATACAAAAATTGGCTGG + Intronic
1103580589 12:121912199-121912221 CACAAAATGCAAAAATTAGCTGG - Intronic
1103757999 12:123225280-123225302 CAAAAAATGCAAAAATTAGCTGG + Intronic
1104325410 12:127791802-127791824 CATTAAATGCAAATAGTCTAGGG + Intergenic
1104410063 12:128550464-128550486 CAAAAAATGCAAACATTAGCTGG - Intronic
1104992970 12:132636592-132636614 CAAAAAATACAAAAATTGGCTGG + Intronic
1105294075 13:19073044-19073066 CATTAAAAAAAAAAATTGGCTGG + Intergenic
1105941446 13:25151553-25151575 AATGAAAAGCAAATATTGGAAGG - Intergenic
1106092082 13:26605178-26605200 CATTAAATACAAATGTGGACTGG - Intronic
1106332137 13:28748967-28748989 CTATAAATGCAAAAATTAGCTGG - Intergenic
1106520778 13:30495772-30495794 TAGTAAAGGGAAATATTGGCCGG - Intronic
1106704560 13:32266820-32266842 CTAAAAATGCAAATATTTGCTGG + Intronic
1106720991 13:32434392-32434414 TATTAAATGAAAAAACTGGCCGG - Intronic
1107131086 13:36896292-36896314 CAATAAATCCAAAAATTAGCTGG - Intronic
1107757429 13:43639731-43639753 CAATAAATAAAAATCTTGGCCGG + Intronic
1107908973 13:45087397-45087419 CTAAAAATGCAAAAATTGGCCGG + Intergenic
1108485933 13:50924841-50924863 AATTAAAAGAAAATCTTGGCTGG - Intronic
1108621796 13:52192264-52192286 CATTTAAAGTTAATATTGGCCGG + Intergenic
1108747740 13:53412136-53412158 CATTAAATGGAAAAAATGGGAGG + Intergenic
1108883627 13:55152087-55152109 CAAAAAATGCAAAAATTAGCTGG + Intergenic
1109000925 13:56804174-56804196 GCTTAATTGCAAATATTAGCAGG + Intergenic
1109014107 13:56986416-56986438 TTTAAAATGCAAATATTGGCTGG - Intergenic
1109021633 13:57102475-57102497 CATTAATTATAAATATTGTCTGG + Intergenic
1109410976 13:61969303-61969325 CATTAAATGTAAATATTATAGGG + Intergenic
1109585370 13:64395197-64395219 CCTTAGATTCAGATATTGGCAGG - Intergenic
1109693157 13:65919593-65919615 CAATAAATACAAAAATTAGCTGG + Intergenic
1109859904 13:68183842-68183864 CAAAAAATGCAAAAATTAGCTGG + Intergenic
1110912319 13:80980422-80980444 CATTAGTTAGAAATATTGGCTGG + Intergenic
1111295269 13:86269199-86269221 CAAAAAATACAAAAATTGGCCGG - Intergenic
1111520123 13:89390545-89390567 TATTAAATATAAATATTTGCCGG + Intergenic
1111827113 13:93281515-93281537 CTTTAAATGAAAAGAATGGCTGG + Intronic
1112177176 13:97037435-97037457 CATTAAATGTTACTATTGACAGG - Intergenic
1112232151 13:97599951-97599973 CAAAAAATACAAAAATTGGCTGG + Intergenic
1112400162 13:99070081-99070103 CATTAAATGCTCATAGAGGCGGG - Intronic
1112579614 13:100667135-100667157 AATTAAAAATAAATATTGGCCGG + Intronic
1112589802 13:100752541-100752563 AAAAAAATGCAAATATTAGCCGG - Intergenic
1112602695 13:100872399-100872421 CAAAAAATACAAATATTAGCTGG - Intergenic
1112690117 13:101883899-101883921 CTATAAATGCAAAAATTAGCCGG + Intronic
1112837677 13:103535921-103535943 CAAAAAATACAAAAATTGGCTGG - Intergenic
1112920026 13:104601168-104601190 CATAAAATGCAAATTCTGTCAGG + Intergenic
1113254559 13:108493497-108493519 CATTAAATGCATAAAATGCCAGG + Intergenic
1114428880 14:22643455-22643477 CAAAAAATACAAAAATTGGCCGG - Intergenic
1114457734 14:22867609-22867631 CAAAAAATACAAATATTAGCCGG + Intergenic
1114738471 14:25068323-25068345 CAAAAAATGCAAAAATTAGCTGG - Intergenic
1114792808 14:25679013-25679035 CCTAAAATGAAAATGTTGGCAGG + Intergenic
1114864973 14:26579217-26579239 CTTAAAATACAAAAATTGGCTGG - Intronic
1114935065 14:27524867-27524889 CAATAAAAGCAAAAATAGGCCGG - Intergenic
1115086792 14:29525038-29525060 TAGTAAAGGAAAATATTGGCAGG - Intergenic
1115124063 14:29971622-29971644 GATTAAAAGAAAATATTAGCTGG - Intronic
1115221537 14:31062998-31063020 TGTTATAAGCAAATATTGGCTGG + Intronic
1115545051 14:34458343-34458365 CTAAAAATGCAAATATTAGCCGG - Intronic
1116905471 14:50399062-50399084 CATTAAATGCTTATATTAGAAGG - Intronic
1117166854 14:53043587-53043609 CAAAAAATGCAAAGATTAGCTGG - Intronic
1117537656 14:56717477-56717499 CAAAAAATACAAAAATTGGCTGG + Intronic
1118180692 14:63489569-63489591 CAAAAAATACAAAAATTGGCTGG - Intronic
1118210084 14:63757925-63757947 CAAAAAATACAAAAATTGGCTGG - Intergenic
1118505852 14:66410917-66410939 CATCATATGCAAATATCGGAAGG - Intergenic
1118617094 14:67581361-67581383 CAAAAAATGCAAAAATTAGCTGG + Intronic
1118742874 14:68753333-68753355 CAGAAAATGCAAAAATTAGCTGG - Intergenic
1118825224 14:69373940-69373962 CAAAAAATGCAAAAATTAGCTGG - Intergenic
1119106442 14:71929659-71929681 CAATAAATGCTAAAATTGGTGGG - Intergenic
1119455296 14:74750063-74750085 CAGTAAATACAAAAATTAGCTGG - Intergenic
1119455867 14:74755197-74755219 CTATAAATGCAAAAATTGGCCGG + Intergenic
1119540725 14:75436457-75436479 CATAAAATCAAAATATTCGCTGG - Intronic
1119999712 14:79289322-79289344 CATTAAAATTAATTATTGGCTGG + Intronic
1120160815 14:81142769-81142791 TAAAAAATGCAAACATTGGCTGG - Intronic
1120327118 14:83044408-83044430 CATCAAATACAAAAATTGCCAGG + Intergenic
1120385614 14:83841812-83841834 CATTAAAAGCATATTTTGACTGG - Intergenic
1120912068 14:89676352-89676374 GATTAAAGAAAAATATTGGCTGG + Intergenic
1121131568 14:91452304-91452326 CAAAAAATGCAAACATTAGCTGG - Intergenic
1121134310 14:91481168-91481190 CAAAAAATACAAAAATTGGCTGG + Intronic
1121136176 14:91500868-91500890 CAAAAAATGCAAAAATTAGCTGG + Intronic
1121176442 14:91894235-91894257 CAAAAAATACAAATATTAGCTGG + Intronic
1121179055 14:91914179-91914201 CATAAAATACAAATATTAGCTGG + Intronic
1121297166 14:92837723-92837745 CAAAAAATACAAATATTAGCTGG - Intronic
1121756754 14:96409274-96409296 CATTAAAAAGAAATATAGGCTGG + Intronic
1121944993 14:98111382-98111404 CATTGAGTGCAAATATTATCAGG + Intergenic
1122085388 14:99297811-99297833 CCTTAAAAGCAGATGTTGGCTGG + Intergenic
1122151754 14:99729638-99729660 TATTAAATACAAAAATTAGCTGG - Intergenic
1122559680 14:102603484-102603506 CAAAAAATACAAATATTAGCTGG - Intronic
1122589756 14:102839514-102839536 AACTAAAAGCAAATAATGGCTGG - Intronic
1123009328 14:105339938-105339960 CAAAAAATACAAAAATTGGCCGG - Intronic
1123487825 15:20756723-20756745 CAAAAAATACAAAAATTGGCGGG - Intergenic
1123544324 15:21325799-21325821 CAAAAAATACAAAAATTGGCGGG - Intergenic
1124803735 15:32860489-32860511 CAAAAAATACAAATACTGGCTGG + Intronic
1125217640 15:37295009-37295031 CTTTGTATTCAAATATTGGCAGG - Intergenic
1125420605 15:39500599-39500621 CATTCAAGGCAAATGGTGGCTGG + Intergenic
1125863961 15:43025932-43025954 AATTAAAGGAAACTATTGGCCGG + Intronic
1125989233 15:44089539-44089561 CAAAAAATACAAAAATTGGCCGG + Intronic
1126008953 15:44284610-44284632 CTTTAAAGGCAAAAATCGGCTGG - Intergenic
1126027255 15:44459229-44459251 CATTAAAAGTGAAAATTGGCCGG + Intronic
1126129262 15:45324677-45324699 CATAAAATACAAAAATTAGCTGG - Intergenic
1126371200 15:47949039-47949061 CATAAAATGCAAATAATGATAGG + Intergenic
1126630468 15:50729456-50729478 CAAAAAATACAAAAATTGGCTGG + Intronic
1126816295 15:52458456-52458478 CAAAAAATACAAATATTAGCTGG + Intronic
1127076468 15:55331415-55331437 TAAAAAATGCAACTATTGGCCGG + Intronic
1127187924 15:56499332-56499354 AAATAAATACAAAAATTGGCTGG + Intergenic
1127238781 15:57087248-57087270 CAAAAAATAAAAATATTGGCTGG + Intronic
1127876375 15:63114958-63114980 CAAAAAATGCAAAAATTAGCTGG - Intergenic
1127885809 15:63199742-63199764 CAAAAAATACAAAAATTGGCTGG - Intronic
1127951689 15:63813895-63813917 CAAAAAATGCAAAAATTAGCAGG + Intronic
1128022174 15:64401429-64401451 AAAAAAATGTAAATATTGGCTGG - Intronic
1128022496 15:64404480-64404502 CTATAAATGCAAAAATTAGCTGG - Intronic
1128316110 15:66660501-66660523 CAAAAAATACAAAAATTGGCCGG - Intronic
1128547123 15:68575856-68575878 TATAAAATGCATGTATTGGCTGG + Intergenic
1128960741 15:72001972-72001994 TATTAAAAGTAAATATTGGCTGG + Intronic
1128996325 15:72299044-72299066 CTAAAAATGCAAAAATTGGCAGG + Intronic
1129019143 15:72499261-72499283 CATTAAATACCATTACTGGCTGG - Intronic
1129126512 15:73446476-73446498 CAAAAAATGCAAAAATTAGCCGG + Intronic
1129314903 15:74736059-74736081 GAATAAATGCAAAAATTAGCCGG - Intergenic
1129372141 15:75104213-75104235 CTAAAAATGCAAAAATTGGCCGG - Intronic
1129836026 15:78706557-78706579 CATTAATTGCAAAAACTTGCAGG + Intronic
1130606393 15:85321191-85321213 CAAAAAATGCAAAAATTAGCTGG - Intergenic
1131009731 15:89007044-89007066 CAAAAAATACAAATATTAGCGGG - Intergenic
1131505407 15:93013771-93013793 CATAAACTACAAATATTAGCTGG + Intronic
1131681593 15:94729427-94729449 CAAAAAATGCAAAAATTAGCTGG - Intergenic
1202952669 15_KI270727v1_random:53071-53093 CAAAAAATACAAAAATTGGCGGG - Intergenic
1132459801 16:46426-46448 TATTAAATGTAAAGATTGGTGGG + Exonic
1132795030 16:1716020-1716042 CATTAAATCCAAACCTCGGCCGG - Intronic
1132955336 16:2589249-2589271 CAAAAAATGCATACATTGGCTGG - Intronic
1133052727 16:3126597-3126619 CATAAAATACAAAAATTAGCGGG - Intergenic
1133091300 16:3405843-3405865 CAAAAAATGCAAAAATTAGCGGG + Intronic
1133187200 16:4108533-4108555 CTGAAAATGCAAAAATTGGCTGG - Intronic
1133196392 16:4173823-4173845 CAAAAAATACAAAAATTGGCTGG - Intergenic
1133273548 16:4623560-4623582 CTAAAAATGCAAAAATTGGCTGG + Intronic
1134123673 16:11601719-11601741 CAAAAAATGCAAAAATTAGCCGG - Intronic
1134200688 16:12196135-12196157 CAAAAAATGCAAAGATTAGCTGG - Intronic
1134366319 16:13582586-13582608 CAAAAAATGCAAAAATTAGCTGG - Intergenic
1134478360 16:14595825-14595847 CAAAAAATGTAAAAATTGGCTGG - Intronic
1135586438 16:23675336-23675358 CAAAAAATGCAAAAATTAGCTGG + Exonic
1135862443 16:26069111-26069133 CAAAAAATGCAAAAATTAGCTGG - Intronic
1136370882 16:29835330-29835352 CAAAAAATACAAATATTAGCCGG + Intronic
1136401654 16:30022507-30022529 CAAAAAATGCAAAAATTAGCCGG + Intronic
1136493979 16:30630302-30630324 CAAAAAATGCAAAAATTAGCCGG - Intergenic
1136575705 16:31123503-31123525 CAAAAAATGAAAATTTTGGCTGG - Intronic
1136637449 16:31533780-31533802 CAAAAAATACAAAAATTGGCTGG + Intergenic
1137487867 16:48906752-48906774 CAAAAAATGCAAAAATTAGCTGG + Intergenic
1137608050 16:49800080-49800102 CAAAAAATGCAAAAATTAGCTGG + Intronic
1137629973 16:49936272-49936294 CAAAAAATGCAAAAATTAGCTGG + Intergenic
1137782388 16:51108702-51108724 CAAAAAATACAAAAATTGGCTGG - Intergenic
1138048827 16:53754474-53754496 CTAAAAATGCAAAAATTGGCCGG + Intronic
1138456509 16:57124241-57124263 CAGAAAATGCAAAAATTAGCTGG - Intronic
1138648800 16:58445245-58445267 CAAAAAATACAAAAATTGGCCGG + Intergenic
1138675220 16:58646376-58646398 CAAAAAATACAAATATTAGCCGG - Intergenic
1138686563 16:58731304-58731326 CATAAAATACAAAAATTAGCCGG - Intronic
1138732116 16:59206817-59206839 TATTAAATTCATATGTTGGCTGG + Intergenic
1138971723 16:62152308-62152330 CAACAAATGCAAAAATAGGCAGG - Intergenic
1139302706 16:65959040-65959062 CAAAAAATACAAAAATTGGCTGG - Intergenic
1139799054 16:69506425-69506447 CAAAAAATACAAAAATTGGCCGG + Intergenic
1139826275 16:69759817-69759839 CAAAAAATACAAATATTAGCTGG - Intergenic
1139996316 16:70984228-70984250 CAATAAATACAAAAATTAGCTGG + Intronic
1140110486 16:72000031-72000053 CTTTAAATATATATATTGGCGGG + Intergenic
1140168621 16:72580291-72580313 CAAAAAATTAAAATATTGGCTGG - Intergenic
1140193011 16:72834083-72834105 CAAAAAATGCAAAAATTAGCTGG + Intronic
1140264903 16:73412162-73412184 CAAAAAATGCAAAAATTAGCCGG + Intergenic
1140282226 16:73565274-73565296 CATCAGATGCAAATATTTGAGGG - Intergenic
1141182743 16:81765467-81765489 CATAAAATACAAAAATTAGCTGG + Intronic
1141201139 16:81898886-81898908 AATGAAATACAAATATAGGCTGG + Intronic
1141567550 16:84913314-84913336 CATAAAAGGCAAAGATAGGCTGG - Intronic
1141821489 16:86449288-86449310 CATCAAATGCAAGTATTGATGGG - Intergenic
1142068436 16:88075905-88075927 CAATAAATACAAAAATTAGCCGG - Intronic
1142209501 16:88802020-88802042 CAATAAATACAAAAATTAGCCGG - Intergenic
1142304278 16:89276892-89276914 CAGAAAATGCAAAAATTAGCCGG + Intronic
1142536999 17:625148-625170 CAAAAAATGCAAAAATTAGCTGG - Intronic
1143177713 17:4966137-4966159 CAAAAAATACAAAAATTGGCCGG - Intronic
1143242958 17:5459724-5459746 CATTTAAAGAAAATGTTGGCTGG - Intronic
1143428821 17:6863524-6863546 CATTAAATGCAAATTTAGAGAGG - Intergenic
1143589407 17:7872655-7872677 CATTAAAAACAAAAATTGCCCGG - Intronic
1144691956 17:17272609-17272631 CATTGAATGAAAATATTGGCTGG + Intronic
1145201851 17:20952600-20952622 CATTTATTGTAAATATAGGCTGG - Intergenic
1145213323 17:21032775-21032797 CAAAAAATGCAAAAATTAGCTGG + Intronic
1145981677 17:29016160-29016182 CAAAAAATACAAATATAGGCCGG - Intronic
1146025863 17:29320168-29320190 CTAAAAATGCAAAAATTGGCCGG + Intergenic
1146067477 17:29647822-29647844 CTTAAAATACAAATATTAGCTGG - Intronic
1146179915 17:30691343-30691365 CAAAAAATACAAAAATTGGCTGG + Intergenic
1146325737 17:31884292-31884314 GAATAAAAGCTAATATTGGCCGG - Intronic
1146736785 17:35244779-35244801 CAAAAAATGCAAAAATTAGCTGG + Intronic
1146991765 17:37280368-37280390 CAAAAAATGCAAAAATTAGCTGG - Intronic
1147011996 17:37457340-37457362 CTAAAAATACAAATATTGGCTGG - Intronic
1147379538 17:40045621-40045643 CACAAAATGCAAAAATTGGCCGG + Intronic
1147802811 17:43105963-43105985 CAAAAAATACAAAAATTGGCCGG + Intronic
1148258535 17:46158522-46158544 CAAAAAATACAAAAATTGGCTGG - Intronic
1148596631 17:48861375-48861397 CATAAAATACAAAAATTAGCTGG - Intronic
1148639820 17:49178834-49178856 CAAAAAATACAAAAATTGGCTGG - Intergenic
1149411297 17:56410235-56410257 CAAAAAATGCAAAAATTAGCTGG - Intronic
1149478072 17:56980274-56980296 CAAAAAATGCAAAAATTAGCTGG - Intronic
1149483025 17:57018648-57018670 CAAAAAATGCAAAAATTAGCCGG - Intergenic
1149656725 17:58313449-58313471 CAAAAAATGCAAAAATTAGCTGG + Intronic
1149893669 17:60412341-60412363 CAAAAAATACAAAAATTGGCCGG + Intronic
1149926544 17:60707287-60707309 CAAAAAATACAAAAATTGGCCGG - Intronic
1150014117 17:61536240-61536262 CTTAAAATGCAAAAATTAGCTGG - Intergenic
1150186904 17:63191622-63191644 CAAAAAATACAAAAATTGGCTGG - Intronic
1150361593 17:64539880-64539902 CATTAATTTTAAATATTGTCTGG - Intronic
1150750512 17:67857626-67857648 CAAAAAATGCAAAAATTAGCCGG - Intronic
1150757167 17:67924908-67924930 CAAAAAATACAAATATTAGCTGG - Intronic
1150770119 17:68033874-68033896 CAAAAAATGCAAAAATTAGCTGG + Intergenic
1150793044 17:68214943-68214965 CAAAAAATGCAAAAATTAGCCGG - Intergenic
1151611447 17:75178350-75178372 CAAAAAATACAAAAATTGGCTGG + Intergenic
1151742982 17:75996541-75996563 CAAAAAATGCAAAAATTAGCAGG + Intronic
1152125928 17:78446803-78446825 CAAAAAATGCAAAAATTAGCCGG - Intronic
1152439443 17:80296841-80296863 CAATAAATACAAAAATTAGCTGG - Intronic
1152669358 17:81592820-81592842 CAAAAAATACAAAAATTGGCCGG + Intronic
1152963123 18:92340-92362 TATTAAATGTAAAGATTGGCCGG + Intergenic
1153142199 18:1985930-1985952 CAATAAATGAAAATATTAGCTGG + Intergenic
1153205241 18:2692250-2692272 CTTTGAAGTCAAATATTGGCTGG + Intronic
1153852858 18:9112642-9112664 CAAAAAATACAAAAATTGGCCGG - Intronic
1153901697 18:9622715-9622737 CAAAAAATGCAAAAATTAGCTGG + Intergenic
1154046393 18:10909457-10909479 CAGGAAATGTAAATATTGACTGG + Intronic
1154053409 18:10985877-10985899 CATTTAAAGTAAATATTGACAGG - Intronic
1154108964 18:11549722-11549744 AATGAAATGCAAAGATAGGCTGG + Intergenic
1154150731 18:11904478-11904500 CAAAAAATGCAAAAATTGGTGGG - Intronic
1154931813 18:21005713-21005735 CAAAAAATGCAAAAATTAGCTGG + Intronic
1154973764 18:21436870-21436892 CAAAAAATGCAAAAATTAGCTGG - Intronic
1155111447 18:22719253-22719275 CATAAAAAGAAAATATTGGATGG + Intergenic
1155889338 18:31247089-31247111 CAATAAATACAAAAATTAGCCGG + Intergenic
1156018748 18:32575933-32575955 CAAAAAATGCAAAAATTAGCTGG + Intergenic
1156286451 18:35700779-35700801 CAAAAAATGCAATTCTTGGCGGG - Intronic
1157513026 18:48292034-48292056 CTATAAATACAAATATTAGCTGG + Intronic
1157790677 18:50528429-50528451 CTAAAAATACAAATATTGGCCGG - Intergenic
1157841162 18:50960146-50960168 CAAAAAATGCAAAAATTAGCTGG + Intergenic
1158450121 18:57556747-57556769 CAAAAAATACAAATATTAGCTGG + Intronic
1158475924 18:57779159-57779181 CAAAAAATGCAAAAATTAGCTGG + Intronic
1158486108 18:57867249-57867271 CAAAAAATGCAAAAATTAGCCGG - Intergenic
1158581593 18:58688988-58689010 CAAAAAATGCAAAAATTAGCCGG + Intronic
1158837047 18:61341807-61341829 CATTTAAAGCAAATAATAGCTGG + Intronic
1159236035 18:65673720-65673742 CCAAAAATGCAAAAATTGGCAGG + Intergenic
1159390883 18:67790291-67790313 CAAAAAATGAAAATATTAGCTGG - Intergenic
1159490935 18:69133335-69133357 CAAAAAATGCAAAAATTAGCTGG + Intergenic
1160028337 18:75237358-75237380 CAAAAAATGCAAAAATTAGCCGG + Intronic
1161472205 19:4463833-4463855 CTAAAAATGCAAATATTAGCTGG - Intergenic
1161488663 19:4549772-4549794 CTTAAAATACAAAAATTGGCCGG - Intronic
1161492261 19:4568451-4568473 CAAAAAATGCAAAAATTAGCTGG + Intergenic
1161541582 19:4854951-4854973 CAAAAAATACAAAAATTGGCCGG + Intronic
1161708415 19:5833325-5833347 CTAAAAATGCAAAAATTGGCCGG + Intronic
1162309637 19:9898358-9898380 CTAAAAATGCAAATATTAGCTGG + Intronic
1162485092 19:10955269-10955291 CAAAAAATACAAAAATTGGCCGG - Intergenic
1162587195 19:11567385-11567407 CAAAAAATACAAAAATTGGCTGG + Intronic
1162591692 19:11596510-11596532 CATTAAATGCAAATATTGGCCGG + Intronic
1162608847 19:11733535-11733557 CAAAAAATACAAAAATTGGCTGG + Intronic
1162861781 19:13511183-13511205 CTTAAAATGCAAAAATTAGCCGG + Intronic
1162978694 19:14224210-14224232 CAAAAAATACAAAAATTGGCCGG - Intergenic
1163281367 19:16320059-16320081 CAAAAAATACAAAAATTGGCTGG - Intergenic
1163303270 19:16461458-16461480 CAAAAAATACAAAAATTGGCAGG + Intronic
1163559665 19:18011291-18011313 CAAAAAATACAAAAATTGGCCGG - Intronic
1163613891 19:18315172-18315194 CAAAAAATGATAATATTGGCCGG - Intronic
1163706910 19:18819833-18819855 CATAAAATGCATATGGTGGCTGG - Intergenic
1163766948 19:19168885-19168907 CAAAAAATGCAAAAATTAGCTGG + Intronic
1163970435 19:20788564-20788586 CTAAAAATGCAAAAATTGGCTGG - Intronic
1164099060 19:22038216-22038238 CATGAAATACTAATATTAGCTGG - Intergenic
1164119241 19:22250871-22250893 CATGAAATACTAATATTAGCTGG - Intergenic
1164308080 19:24022543-24022565 CTAAAAATGCAAAAATTGGCTGG + Intergenic
1164315552 19:24085091-24085113 TATTAAATACAAAAATTAGCTGG - Intronic
1164697856 19:30260338-30260360 CATAAAATGCAGATATTTCCTGG - Intronic
1164853765 19:31504907-31504929 CTAAAAATGCAAATATTAGCAGG - Intergenic
1165306761 19:35007394-35007416 CAAAAAATGCAAAAATTAGCGGG + Intronic
1165460552 19:35941728-35941750 AATAAAATGCAAACATTAGCTGG - Intronic
1165592799 19:36985682-36985704 CTTAAAATGCAAAAATTAGCCGG - Intronic
1165593941 19:36995881-36995903 CATTATAAGCCAATATTGGCAGG + Intronic
1165702359 19:37948302-37948324 CAAAAAATACAAAAATTGGCTGG + Intronic
1165990692 19:39811108-39811130 CAAAAAATGCAAAAATTAGCTGG - Intergenic
1166077845 19:40424314-40424336 CATTAAGTGTACTTATTGGCAGG - Intronic
1166146349 19:40838973-40838995 CAAAAAATACAAAAATTGGCTGG - Intronic
1166150396 19:40869597-40869619 CAAAAAATACAAAAATTGGCTGG - Intronic
1166184804 19:41133049-41133071 CAAAAAATACAAAAATTGGCAGG + Intergenic
1166462809 19:43004245-43004267 CTAAAAATGCAAAAATTGGCTGG + Intronic
1166672101 19:44716764-44716786 CAAAAAATGCAACAATTGGCCGG - Intergenic
1166680719 19:44764916-44764938 GATTAAACATAAATATTGGCTGG - Intergenic
1166786760 19:45371949-45371971 CAAAAAATGCAAAAATTAGCTGG + Intergenic
1166970969 19:46567536-46567558 CAAAAAATGCAAAAATTAGCGGG - Intronic
1167303088 19:48690849-48690871 CAAAAAATGCAAAAATTAGCTGG - Intergenic
1167451504 19:49572810-49572832 CTAAAAATGCAAAAATTGGCTGG + Intronic
1167626034 19:50589987-50590009 CAAAAAATGCAAAAATTAGCTGG - Intergenic
1167823467 19:51951050-51951072 TCTTAAATCCAAATATTTGCTGG + Intergenic
1168023986 19:53630388-53630410 CAAAAAATGCAAAAATTAGCTGG + Intergenic
1168283263 19:55317482-55317504 CAAAAAATACAAATATTGCCAGG + Intronic
925555217 2:5123223-5123245 CAAAAAATACAAAAATTGGCTGG + Intergenic
925701884 2:6647113-6647135 CATAAAATCCAATTGTTGGCTGG + Intergenic
925743199 2:7023310-7023332 CATTTAATGCTCATATTGACTGG + Intronic
925748966 2:7070330-7070352 CAAAAAATACAAAAATTGGCTGG - Intergenic
926015458 2:9447315-9447337 CAAAAAATACAAATATTAGCCGG + Intronic
926236247 2:11046528-11046550 CAAAAAATGCAAAAATTAGCTGG - Intergenic
926381204 2:12291842-12291864 CAAAAAATGCAAAAATTAGCTGG + Intergenic
926909431 2:17836956-17836978 CAAAAAATGCAAAAATTAGCAGG - Intergenic
927168436 2:20348759-20348781 CAAAAAATGCAAAAATTAGCCGG + Intronic
927236176 2:20877021-20877043 CATAAAATGAAAATAGTTGCTGG + Intergenic
927594733 2:24386485-24386507 AATTAAATACAAAGATTAGCCGG + Intergenic
927771422 2:25865469-25865491 TTTTAAATCCAAATATAGGCTGG + Intronic
927979252 2:27363584-27363606 CACTAAATACAAAAATTAGCTGG - Intergenic
928070748 2:28213063-28213085 CAAAAAATACAAATATTAGCTGG + Intronic
928168720 2:28989699-28989721 TATAAAATACAAAAATTGGCTGG - Intronic
928220703 2:29400676-29400698 CAATAAAAGCAGATGTTGGCTGG + Intronic
928574676 2:32642827-32642849 CAAAAAATGCAAAAATTAGCCGG - Intronic
928617050 2:33051253-33051275 CAAAAAATACAAAAATTGGCTGG + Intronic
928672839 2:33620251-33620273 CAAAAAATGCAAAGATTAGCTGG + Intergenic
928727143 2:34187507-34187529 CATAAAATATAAATATTGTCAGG + Intergenic
929148435 2:38727052-38727074 CAAAAAATACAAAAATTGGCTGG + Intronic
929513846 2:42587761-42587783 CAAAAAATGCAAAAATTAGCTGG - Intronic
929658456 2:43757712-43757734 TCTTAAATAAAAATATTGGCTGG - Intronic
929726927 2:44439540-44439562 CAAGAAATGCCAATATGGGCCGG + Intronic
929814877 2:45222813-45222835 CATTAAAAACAAATTTTGGCCGG + Intergenic
930084385 2:47483788-47483810 AAATAAATGCAAAAATTAGCCGG + Intronic
930479504 2:51928111-51928133 AATTAAATGGAAATATTACCTGG + Intergenic
930702045 2:54468143-54468165 CTAAAAATGCAAAAATTGGCTGG + Intronic
930703666 2:54484031-54484053 CAAAAAATACAAAAATTGGCTGG + Intronic
930887175 2:56339291-56339313 CATTCACTGCAAATATGGGCTGG - Intronic
930900499 2:56501163-56501185 CATTTATTGCAAATTGTGGCTGG + Intergenic
931313100 2:61101435-61101457 CTTTAAAAGAATATATTGGCTGG + Intronic
931405271 2:61971068-61971090 CAAAAAATGCAAAAATTAGCCGG - Intronic
931406449 2:61983484-61983506 CATTAAAAGCCATTATAGGCCGG - Intronic
932044901 2:68338762-68338784 CAAAAAATTCAAAAATTGGCTGG + Intergenic
932097238 2:68862084-68862106 CATGAGAAGCAAATATTGTCAGG - Intergenic
932268303 2:70387091-70387113 CCAAAAATTCAAATATTGGCTGG + Intergenic
932514425 2:72330307-72330329 CATTAAATGCTACTATTTACAGG - Intronic
932810375 2:74820600-74820622 CAAAAAATACAAAAATTGGCAGG - Intergenic
932832775 2:75007061-75007083 CACTAAATCCAAAAATTAGCTGG - Intergenic
932864390 2:75326083-75326105 CCTTAAATACAAAACTTGGCTGG - Intergenic
932901143 2:75701455-75701477 GAGGAAATGCAAATATTGGGAGG + Intronic
932990764 2:76783306-76783328 AATTAAAGGCAAATAATGGTTGG + Intronic
933309503 2:80643006-80643028 CATGAAAAGCAAATAGGGGCAGG - Intronic
933693213 2:85195706-85195728 CAAAAAATACAAAAATTGGCCGG - Intronic
933739471 2:85522085-85522107 CAAAAAATGCAAAAATTAGCTGG + Intergenic
933791991 2:85890144-85890166 CTAGAAATACAAATATTGGCCGG + Intergenic
935053062 2:99540399-99540421 CAAGAAATACAAAAATTGGCCGG - Intergenic
935347809 2:102124752-102124774 TATTAAATACAAAAATTAGCTGG + Intronic
935375502 2:102391972-102391994 TATGAAATGCAAATATTCCCAGG + Intronic
935488911 2:103693391-103693413 CAAAAAATGAAAATATTAGCTGG - Intergenic
935986689 2:108680203-108680225 TATTAAATACAAAAATTAGCTGG + Intronic
936416770 2:112322405-112322427 CAAAAAATGCAAAAATTAGCTGG - Intronic
936433657 2:112484559-112484581 CATAAAAACCAAATGTTGGCCGG - Intronic
937139049 2:119582615-119582637 CATAAAATACAAAAATTAGCTGG - Intronic
937403814 2:121609644-121609666 CCTTAAAAGCAAGTAATGGCCGG + Intronic
937409064 2:121657043-121657065 CATAAAATACAAAAATTAGCTGG - Intergenic
937972679 2:127562780-127562802 AAAAAAATGCAAAAATTGGCTGG - Intronic
938740055 2:134222546-134222568 AATTAAATGCAAAAAGTGCCTGG + Intronic
938829583 2:135037156-135037178 CTAAAAATGCAAATATTAGCCGG - Intronic
938918143 2:135964677-135964699 CTAAAAATGCAAATATTAGCCGG + Intronic
938989378 2:136612241-136612263 CAAAAAATGCAAAAATTAGCCGG - Intergenic
939490578 2:142871546-142871568 CAAAAAATGCAAAAATTAGCCGG + Intergenic
939985395 2:148825179-148825201 CTAAAAATGCAAATATTAGCTGG - Intergenic
939987392 2:148843851-148843873 CAAAAAATACAAAAATTGGCTGG - Intergenic
940000922 2:148965431-148965453 CTTTAAATACAAATGTTAGCTGG - Intronic
940284869 2:152023729-152023751 TATTAAATGCTATTACTGGCTGG - Intronic
940329380 2:152457879-152457901 TATTCAATGCAAATAATGTCAGG + Intronic
941136867 2:161728412-161728434 CATAAAATACAAAAATTAGCTGG + Intronic
941170406 2:162129029-162129051 CATTAAATAGAAAAATTAGCTGG + Intergenic
941290659 2:163669371-163669393 TACAAAATGCAAATATTAGCTGG - Intronic
941903813 2:170702265-170702287 CTAAAAATGCAAAAATTGGCCGG + Intergenic
941925369 2:170888983-170889005 TAATAAAAGGAAATATTGGCTGG + Intergenic
941927268 2:170908684-170908706 CAAAAAATACAAATATTGGCGGG + Intergenic
942748220 2:179260352-179260374 CAAAAAATGCAAAAATTAGCTGG + Intronic
942966458 2:181899680-181899702 CAAAAAATGCAAAAATTAGCTGG + Intronic
943646355 2:190410759-190410781 TATTAAATGAAAAAAATGGCTGG + Intronic
943742466 2:191425308-191425330 CATTAATTGAAAATATTTTCTGG + Exonic
943818237 2:192283566-192283588 AAATGAATGCAAGTATTGGCTGG + Intergenic
944080251 2:195779765-195779787 CATAAAATACAAAAATTAGCCGG - Intronic
944243465 2:197508113-197508135 CAAAAAATACAAAAATTGGCTGG - Intronic
944636987 2:201684056-201684078 CATAAAATAGAAAAATTGGCTGG + Intronic
944818423 2:203403911-203403933 AATAAAATACAAATATTAGCTGG - Intronic
945459078 2:210083488-210083510 TAATAAATTCAGATATTGGCAGG - Intronic
945625901 2:212205319-212205341 CTAAAAATGCAAAAATTGGCTGG - Intronic
945654119 2:212603130-212603152 AAATAAATGCAAAAATTAGCCGG + Intergenic
946156631 2:217811174-217811196 TAAAAAATGCAAATATTGGCTGG - Intronic
946243984 2:218375050-218375072 CAAAAAATGCAAAGATTAGCTGG - Intergenic
946476225 2:220009131-220009153 AATTAAATGCAAAAATCGACAGG - Intergenic
946728935 2:222690091-222690113 CAAAAAATGCAAAAATTAGCTGG + Intronic
946798387 2:223382137-223382159 CATCAAAAACACATATTGGCTGG - Intergenic
946833486 2:223748595-223748617 CAAAAAATACAAAAATTGGCTGG + Intergenic
946854683 2:223941116-223941138 CTATAAATACAAAAATTGGCTGG - Intronic
946910454 2:224455667-224455689 CAAAAAATGCAAAAATTAGCTGG + Intergenic
947203078 2:227633585-227633607 CAAAAAATACAAAAATTGGCTGG + Intergenic
947205132 2:227654018-227654040 CATTAAAGGCAATTCTGGGCCGG + Intergenic
947425749 2:229981542-229981564 CAAAAAATACAAAAATTGGCTGG + Intronic
1168783405 20:514601-514623 CAAAAAATACAAATATTAGCTGG - Intronic
1169079751 20:2789920-2789942 CAAAAAATGCAAAAATTAGCTGG + Intergenic
1169697764 20:8410094-8410116 CATTATATGCATATATTGTTGGG + Intronic
1170282631 20:14667984-14668006 CAAAAAATACAAATATTTGCTGG + Intronic
1170718271 20:18851201-18851223 CAGAAAATGTAAAAATTGGCTGG - Intergenic
1170887060 20:20349583-20349605 TATTAAATGCTAATATGGTCTGG - Intronic
1171773113 20:29341814-29341836 CATAAAATGCAAAAATTAGCTGG + Intergenic
1171903235 20:30876653-30876675 CATAAAATGCAAAAATTAGCTGG - Intergenic
1172049470 20:32105608-32105630 CAAAAAATACAAATATTGGCCGG + Intergenic
1172077239 20:32308570-32308592 CAAAAAATACAAAAATTGGCTGG - Intronic
1172150911 20:32789753-32789775 CTAAAAATGCAAATATTAGCAGG - Intronic
1172166330 20:32901847-32901869 CTAAAAATGCAAATATTAGCCGG - Intronic
1172418218 20:34789609-34789631 CAGAAAATACAAATATTAGCTGG + Intronic
1172422759 20:34831361-34831383 CAGAAAATGCAAAGATTGGCCGG - Intergenic
1172611189 20:36253652-36253674 CATTTAATACAAACATGGGCAGG - Intronic
1173135640 20:40436527-40436549 CAAAAAATGCAAAAATTAGCTGG + Intergenic
1173496127 20:43519173-43519195 CAAAAAATACAAATATTAGCTGG + Intronic
1173612896 20:44383713-44383735 CTTAAAATGCAAAAATTAGCTGG - Intronic
1174015407 20:47484113-47484135 CAAAAAATGCAAAAATTAGCTGG - Intergenic
1174394304 20:50237212-50237234 CAAAAAATACAAAAATTGGCTGG - Intergenic
1174427615 20:50443850-50443872 CAAAAAATACAAAAATTGGCTGG - Intergenic
1174552876 20:51374301-51374323 CCTAAAATCAAAATATTGGCAGG + Intergenic
1174562907 20:51444141-51444163 CTTGAAATGCAAAAATTAGCCGG - Intronic
1175084984 20:56450870-56450892 CTAAAAATACAAATATTGGCTGG + Intronic
1175127117 20:56760647-56760669 TAAAAAATGCAAATGTTGGCTGG - Intergenic
1175581586 20:60104024-60104046 CCTTGAATGCAAGTAGTGGCTGG - Intergenic
1175867729 20:62189957-62189979 CATTAAATGTTAATGTTGGCTGG - Intronic
1176003899 20:62848870-62848892 TATTAAATACAAAAATTAGCTGG + Intronic
1176651958 21:9557263-9557285 CATTTAGTGCAAATAGTAGCTGG + Intergenic
1177148245 21:17429508-17429530 TATTAAATTTAAAAATTGGCTGG + Intergenic
1177485211 21:21747189-21747211 CTTAAAATACAAATATGGGCCGG + Intergenic
1177674152 21:24273840-24273862 CATTAGATGAACATTTTGGCTGG - Intergenic
1178333585 21:31723288-31723310 CTTAAAATACAAAAATTGGCCGG + Intronic
1178640882 21:34344052-34344074 AATTAACTGCAATAATTGGCAGG - Intergenic
1178671232 21:34593516-34593538 CAGTAAATGCAAAAGGTGGCAGG - Intronic
1178733982 21:35132146-35132168 CATTAAGAGAAAACATTGGCTGG + Intronic
1179679485 21:43008615-43008637 CAAAAAATACAAATATTAGCCGG + Intronic
1179708582 21:43196483-43196505 CCATAAATACAAATATTAGCCGG - Intergenic
1180336634 22:11582625-11582647 CATAAAATGCAAAAATTAGCTGG - Intergenic
1181092229 22:20481763-20481785 CAAAAAATACAAATATTAGCTGG - Intronic
1181129676 22:20723532-20723554 TATTAAATACAAAAATAGGCTGG + Intronic
1181642146 22:24207721-24207743 CAGAAAATGCAAAAATTAGCTGG - Intergenic
1181715553 22:24724731-24724753 CAAAAAATGAAAAAATTGGCCGG - Intronic
1181958014 22:26602285-26602307 CAATAAATGCATTTATTGGCCGG + Intronic
1182440457 22:30360749-30360771 TACTAAATACAAAAATTGGCCGG + Intronic
1182526008 22:30920165-30920187 CATTAAATACAAAAATTAGCTGG - Intergenic
1182641246 22:31769619-31769641 CTTTAAATTCAAAAAGTGGCTGG + Intronic
1182975231 22:34617883-34617905 CAAAAAATGCAAAAATTAGCTGG + Intergenic
1183778278 22:39982266-39982288 CTAAAAATGCAAAAATTGGCTGG + Intergenic
1183853857 22:40615979-40616001 AATTAAATGAAAATATTGGCCGG - Intronic
1184005407 22:41704573-41704595 CTAAAAATGCAAAAATTGGCCGG - Intronic
1184173262 22:42771919-42771941 CAAAAAATGCAAACATTAGCTGG - Intergenic
1184375670 22:44110894-44110916 TCTTAAATGCATATATAGGCCGG - Intronic
949541188 3:5033454-5033476 CAAAAAATACAAAAATTGGCCGG + Intergenic
949810992 3:8005896-8005918 CTTTAAATGAAATTTTTGGCCGG - Intergenic
950314403 3:11987800-11987822 CAAAAAATGCAAAAATTAGCTGG + Intergenic
950671251 3:14527023-14527045 CAAAAAATGCAAAAATTGGCCGG + Intronic
950810155 3:15643337-15643359 CAATAAATACAAAAATTAGCTGG + Intronic
951066082 3:18267186-18267208 CATGAAATGCAAATATTGTAGGG - Intronic
951524564 3:23641459-23641481 TTTTAAATTAAAATATTGGCTGG - Intergenic
951544843 3:23814085-23814107 CAGTAAATACAAAAATTAGCCGG + Intronic
951863476 3:27280003-27280025 CCTAAAATACAAAAATTGGCTGG + Intronic
952062222 3:29524587-29524609 AATAAAATGCAAAAGTTGGCTGG - Intronic
952699412 3:36310234-36310256 CCTTAGCTTCAAATATTGGCTGG - Intergenic
952762950 3:36931541-36931563 CAAAAAATGCAAAAATTAGCTGG + Intronic
953233484 3:41085251-41085273 AAATAAATGCAAAAATTCGCTGG + Intergenic
953502023 3:43445859-43445881 CAAAAAATACAAATATTAGCTGG - Intronic
953994656 3:47510619-47510641 CAAAAAATGCAAAAATTAGCTGG - Intronic
954374524 3:50187128-50187150 CGTTAAATGGAAATTCTGGCTGG + Intronic
954394046 3:50283329-50283351 CAAAAAATACAAAAATTGGCCGG + Intronic
954573432 3:51661121-51661143 CAAAAAATGCAAAAATTAGCTGG - Intronic
955200935 3:56851547-56851569 CATAAAATACAAAAATTAGCTGG - Intronic
955308046 3:57854298-57854320 TTTTAAATGTATATATTGGCCGG + Intronic
955308186 3:57855738-57855760 CTTTAAATAAAAATATTAGCTGG + Intronic
955328123 3:58025289-58025311 CAAAAAATGCAAAAATTAGCCGG - Intronic
955448821 3:59044732-59044754 CATTAAATGAAAATACAGGTGGG + Intronic
955521870 3:59783172-59783194 TATTAAAAGCAAATAATAGCTGG + Intronic
955541648 3:59983098-59983120 CAAAAAATACAAATATTAGCTGG - Intronic
955590099 3:60525939-60525961 CAAAAAATGCAAAAATTAGCTGG + Intronic
956151480 3:66247604-66247626 CATTTAAGGTCAATATTGGCAGG - Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956671207 3:71692753-71692775 CAAAAAATGCAAAAATTAGCTGG - Intronic
957452552 3:80398755-80398777 GATTGAATGTAAATATTGTCTGG + Intergenic
958091622 3:88884126-88884148 ACTTGAATGCAAATATTGTCTGG - Intergenic
958581975 3:96038758-96038780 CACTAAATTCAAAAATTAGCTGG - Intergenic
958645414 3:96865518-96865540 CAATAAATGAAAAAATTAGCTGG + Intronic
960104191 3:113776195-113776217 CAATAAATGTAAAAATTAGCTGG + Intronic
960288421 3:115855770-115855792 GAATAAAAGGAAATATTGGCAGG - Intronic
960436680 3:117634887-117634909 CAAAAAATGCAAAAATTAGCTGG - Intergenic
960605727 3:119502854-119502876 CATTAAATGCTAAAACTGCCTGG - Intronic
961291095 3:125847715-125847737 CTAAAAATGCAAATATTAGCAGG - Intergenic
961538140 3:127582402-127582424 CAAAAAATACAAAAATTGGCCGG + Intronic
962509127 3:136081152-136081174 CTATAAATACAAATATTAGCTGG - Intronic
962573528 3:136735285-136735307 CAGAAAATGCAAAAATTAGCTGG - Intronic
963683919 3:148414087-148414109 TTTTAAATGCATATAGTGGCAGG + Intergenic
963938734 3:151080361-151080383 CATGAAATGCAAAATGTGGCTGG + Intergenic
963943669 3:151121255-151121277 CTTTCAAAGCAAATATTTGCAGG - Intronic
964009315 3:151871141-151871163 CAAAAAATGCAAAAATTAGCTGG - Intergenic
964205167 3:154166344-154166366 CATTAAAAATAAATACTGGCTGG - Intronic
964356935 3:155859542-155859564 CTACAAATGCAAATATTAGCCGG - Intergenic
964854682 3:161133942-161133964 TACTAAATGCAAAAATTAGCTGG - Intronic
965830200 3:172777735-172777757 CAAAAAATGCAAAAATTAGCTGG + Intronic
966414979 3:179680011-179680033 CAAGAAATGCAAAAATTAGCTGG + Intronic
966714753 3:183004024-183004046 CAAAAAATGCAAAAATTAGCCGG + Intergenic
966718085 3:183034152-183034174 CATAAAATGCAAGTGCTGGCCGG + Intronic
966805685 3:183805625-183805647 CAAAAAATGCAAAAATTAGCCGG + Intronic
967008980 3:185413658-185413680 CAAGAAATGCAAAAATTAGCTGG + Intronic
968256369 3:197277051-197277073 CAAAAAATGCAAAAATTAGCTGG - Intronic
968557946 4:1258972-1258994 CATAAAATACAAAAATTAGCTGG - Intergenic
968745026 4:2355441-2355463 CAGAAAATACAAAAATTGGCCGG - Intronic
968745761 4:2359285-2359307 CAAAAAATACAAAAATTGGCTGG - Intronic
968821668 4:2857444-2857466 CATAAAATACAAAAATTAGCCGG + Intronic
970892994 4:21068495-21068517 CATTAGAAGAAAATTTTGGCTGG - Intronic
971483836 4:27139680-27139702 CTAAAAATGCAAATATTAGCTGG - Intergenic
972403643 4:38727199-38727221 CAAAAAATGCAAAAATTAGCTGG - Intergenic
972511680 4:39772847-39772869 CAAAAAATGCAAAAATTAGCTGG - Intronic
972542520 4:40051864-40051886 CAACAAATGCAAAAATTAGCTGG - Intergenic
973154555 4:46934533-46934555 AATTAAATGCCAACATTGGGAGG - Intronic
973562207 4:52148595-52148617 CAAAAAATGCAAAAATTAGCTGG - Intergenic
973686562 4:53376422-53376444 CTATAAATACAAAAATTGGCTGG + Intergenic
973746432 4:53967851-53967873 CAAAAAATGCAAAAATTAGCTGG - Intronic
974004667 4:56544148-56544170 CAAAAAATACAAATATTAGCCGG - Intronic
974607122 4:64167740-64167762 CAAAAAATGCAAAAATTAGCCGG + Intergenic
975226926 4:71883505-71883527 CCAAAAATGCAAAAATTGGCCGG - Intergenic
975334363 4:73158430-73158452 CAGCAAATGCAAATATTTGGAGG - Intronic
975419704 4:74148547-74148569 CAAAAAATACAAAAATTGGCTGG - Intronic
975640302 4:76493682-76493704 CGTAAAGTGAAAATATTGGCCGG + Intronic
975659513 4:76674714-76674736 CAAAAAATGCAAAAATTAGCTGG - Intronic
976153753 4:82120115-82120137 CAATAAATACAAAAATTAGCAGG + Intergenic
976241407 4:82960897-82960919 CAAAAAATACAAATATTAGCTGG + Intronic
976296644 4:83479239-83479261 CTAAAAATACAAATATTGGCTGG + Intronic
976629751 4:87224243-87224265 CTTAAAATGCAAATGTTGGCCGG - Intronic
977659822 4:99570909-99570931 GATAAAATGAAAGTATTGGCAGG - Intronic
977857581 4:101912647-101912669 TATAAAATATAAATATTGGCAGG + Intronic
978069424 4:104448398-104448420 CTAAAAATGCAAAAATTGGCCGG + Intergenic
978343639 4:107742684-107742706 CAAAATATGCAAAAATTGGCTGG + Intergenic
978387064 4:108186814-108186836 CAAAAAATACAAACATTGGCCGG - Intergenic
978417711 4:108494878-108494900 CATTCAATGTAATTATTGGTAGG - Intergenic
978432505 4:108647698-108647720 AATTATATGCAAGTAATGGCTGG - Intergenic
979333890 4:119445755-119445777 CAAAAAATACAAAAATTGGCCGG + Intergenic
979468194 4:121065495-121065517 TTTTAAATGCAAATATTCACTGG + Intronic
979515046 4:121598090-121598112 CAGAATATGCAAATATTGGGAGG - Intergenic
979533384 4:121792868-121792890 CAAAAAATACAAAAATTGGCCGG - Intergenic
979601238 4:122588349-122588371 AATTTAAGGCAAATTTTGGCTGG - Intergenic
980984331 4:139681176-139681198 CAAAAAATACAAATATTAGCAGG - Intronic
981063590 4:140455973-140455995 CATAAAATACAAAAATTAGCTGG + Intronic
981105262 4:140873835-140873857 CAAAAAATGCAAAAATTAGCTGG - Intronic
981220780 4:142231258-142231280 CATTGAGTGGAAATGTTGGCAGG - Intronic
981971680 4:150669860-150669882 AATTAAGTGAAAATATTGGCCGG - Intronic
982404099 4:155001513-155001535 CATTTAATCCAAACATTGGAGGG - Intergenic
982436997 4:155391172-155391194 CAAAAAATGCAAAAATTAGCTGG + Intergenic
982563750 4:156963306-156963328 AAATAAATACAAATATTAGCAGG + Intronic
982694000 4:158579427-158579449 TATTAAATACAAAAATTAGCTGG - Intronic
982708962 4:158740610-158740632 CATAAAATACAAAAATTAGCCGG + Intergenic
982878503 4:160677894-160677916 CAATAAATACAAAAATTAGCTGG + Intergenic
983311014 4:166061406-166061428 TACTAAATGCAAAAATTAGCTGG - Intronic
983405888 4:167329325-167329347 CAAAAAATGCAAAAATTAGCTGG + Intergenic
983909728 4:173224714-173224736 TTAAAAATGCAAATATTGGCCGG + Intronic
984246212 4:177277966-177277988 CATTAAAAGAAAATACAGGCTGG - Intergenic
984318991 4:178166904-178166926 TATTAAATACAAAAATTAGCCGG - Intergenic
984871638 4:184330659-184330681 CAAAAAATGCAAAAATTAGCTGG + Intergenic
986038616 5:3964636-3964658 CAAAAAATGCAAAAATTAGCTGG - Intergenic
986270200 5:6223573-6223595 AAATAAATGCAAATAGTGGAAGG + Intergenic
986691906 5:10320171-10320193 CTTAAATTGCAAATATAGGCAGG - Intergenic
986797739 5:11228645-11228667 CAAAAAATGCAAAAATTAGCTGG - Intronic
986940197 5:12939236-12939258 CAAAAAATGCAAAAATTAGCTGG - Intergenic
987543297 5:19282902-19282924 ATTTAAATGCTAATATTGCCTGG + Intergenic
988235660 5:28540600-28540622 CTGAAAATGCAAAGATTGGCCGG + Intergenic
988578184 5:32445993-32446015 CATTAAAAGGAAATGCTGGCCGG + Intergenic
988586779 5:32513831-32513853 CAAAAAATTTAAATATTGGCTGG + Intergenic
988602259 5:32650664-32650686 AATTAAATTAAAATATTAGCTGG - Intergenic
988815342 5:34829063-34829085 CATTAAATGTAAATACTGCAAGG - Intronic
989074531 5:37550021-37550043 AAAAAAATGCAAATATTAGCTGG - Intronic
989169255 5:38458817-38458839 CAAAAAATACAAAAATTGGCTGG + Intronic
989197444 5:38729776-38729798 CAAAAAATGCAAATATTAGCTGG - Intergenic
989309182 5:39993840-39993862 CATAAAATAAAAATATTAGCTGG + Intergenic
989383626 5:40833881-40833903 CAATAAATACAAAAATTAGCTGG + Intronic
989445269 5:41520895-41520917 CATTTAAAGCAAATATTAGCAGG + Intergenic
990351061 5:54917003-54917025 TATTAATTGGTAATATTGGCAGG + Intergenic
990407417 5:55504970-55504992 CATAAAATACAAAAATTAGCCGG - Intronic
990681562 5:58250408-58250430 CAGTAAATTTAAATAATGGCAGG - Intergenic
992590472 5:78290785-78290807 CAATAAATACAAAAATTAGCTGG + Intronic
992592091 5:78306086-78306108 CAAAAAATACAAATATTAGCCGG + Intergenic
992718196 5:79532036-79532058 CAAAAAATACAAAAATTGGCCGG - Intergenic
992732324 5:79684415-79684437 CAAAAAATACAAAAATTGGCTGG - Intronic
993010302 5:82474911-82474933 AATTATATGCAAATATTTGAAGG - Intergenic
993608563 5:90026135-90026157 CTCAAAATTCAAATATTGGCAGG + Intergenic
993648830 5:90493406-90493428 CAAAAAATGCAAAAATTAGCTGG - Intronic
994399851 5:99264853-99264875 AAATAATTGCAAAAATTGGCTGG + Intergenic
994422197 5:99535397-99535419 CAAAAAATGCAAAAGTTGGCCGG - Intergenic
994460644 5:100065183-100065205 CAAAAAATGCAAAAGTTGGCCGG + Intergenic
994484794 5:100378592-100378614 CAAAAAATGCAAAAGTTGGCTGG + Intergenic
994678990 5:102862006-102862028 CAAAAAATACAAATATTAGCAGG + Intronic
994943178 5:106351009-106351031 CAGAAAATGCAAAAATTAGCTGG - Intergenic
995153922 5:108886850-108886872 CATTAAATGCAGACATTGGTAGG + Intronic
995556423 5:113334367-113334389 CAAAAAATACAAATATTAGCTGG - Intronic
995730772 5:115239202-115239224 CATAAAATACAAAAATTAGCTGG - Intronic
996363682 5:122677515-122677537 CAAAAAATACAAAAATTGGCCGG - Intergenic
996387133 5:122921020-122921042 AAAAAAATGCCAATATTGGCTGG - Intronic
996599125 5:125241362-125241384 CAAAAAATTCAAACATTGGCTGG - Intergenic
997538754 5:134643613-134643635 CTATAAATACAAATATTAGCTGG - Intronic
997558880 5:134826810-134826832 CATTAAATGGCTATCTTGGCAGG + Intronic
997894187 5:137701342-137701364 CTTGAAATGCCAATTTTGGCCGG - Intronic
997914366 5:137909694-137909716 CAAAAAATACAAAAATTGGCTGG - Intronic
997939567 5:138144738-138144760 CAAAAAATACAAATATTAGCCGG + Intronic
997960867 5:138320521-138320543 CGCTAAATGAAAATATAGGCTGG + Intronic
998450222 5:142228425-142228447 CAGAAAATGCAAAAATTAGCTGG + Intergenic
998577905 5:143336818-143336840 TATTAAATACAAAAATTAGCGGG + Intronic
999764038 5:154724826-154724848 CACAAAATGCAAAAATTAGCTGG - Intronic
1000136125 5:158352713-158352735 CAAAAAATGCAAAAATTAGCTGG - Intergenic
1000763350 5:165253953-165253975 CATTATATCTAAATATTGGCAGG + Intergenic
1001386541 5:171344037-171344059 CAATAAATACAAAAATTAGCTGG + Intergenic
1001472796 5:172026813-172026835 CAAAAAATGCAAAAATTAGCCGG - Intergenic
1001782591 5:174382891-174382913 CATAATATGCAAATTTGGGCAGG - Intergenic
1002338603 5:178498791-178498813 TATTAAAAGCAAAAAGTGGCTGG + Intronic
1002632132 5:180589306-180589328 CAAAAAATACAAAAATTGGCCGG - Intergenic
1003288742 6:4759715-4759737 CTTAAAATGCAAAAATTAGCCGG + Intronic
1003593325 6:7453854-7453876 CAAAAAATACAAAAATTGGCTGG - Intergenic
1003792975 6:9567493-9567515 CTAAAAATACAAATATTGGCTGG + Intergenic
1004066694 6:12253137-12253159 CATTTTATGAAAATCTTGGCAGG - Intergenic
1004242094 6:13933352-13933374 CAAAAAATGCAAAAATTAGCTGG + Intronic
1004630577 6:17417435-17417457 CATAAAATGGAAAAATTAGCTGG - Intronic
1004708461 6:18147163-18147185 AAATAAATGCATATCTTGGCAGG + Intronic
1004721999 6:18275829-18275851 CAAAAAATGCAAAAATTAGCTGG + Intergenic
1004885420 6:20046919-20046941 CATTGCATGCAAATGATGGCTGG + Intergenic
1005024925 6:21453509-21453531 CAAAAAATACAAATATTAGCTGG + Intergenic
1005046017 6:21643186-21643208 CAAAAAATACAAATATTAGCTGG + Intergenic
1005079784 6:21945178-21945200 CATAAAATACAAAAATTAGCTGG - Intergenic
1005292541 6:24393818-24393840 CAAAAAATGCAAAAATTAGCTGG - Intergenic
1005516456 6:26559283-26559305 CAATAAATACAAAAATTAGCTGG + Intergenic
1005732929 6:28716303-28716325 TAAAAAATGCAAAAATTGGCTGG + Intergenic
1006084082 6:31583878-31583900 CAAAAAATGCAAAAATTAGCTGG - Intergenic
1006232904 6:32600426-32600448 CAAAAAATGCAAAAATTAGCTGG + Intergenic
1006371271 6:33645170-33645192 CTAAAAATACAAATATTGGCCGG + Intronic
1006682851 6:35809663-35809685 CAAAAAATACAAAAATTGGCTGG - Intronic
1007188727 6:39995661-39995683 AATGAAATGCAAAGATAGGCTGG + Intergenic
1007876301 6:45106268-45106290 CAATAAATACAAAAATTAGCCGG + Intronic
1007886315 6:45234180-45234202 CATTATATTCAATTATTGTCTGG + Intronic
1008576000 6:52860809-52860831 CATTAAATATAAATTTTGGGGGG + Intronic
1008745962 6:54669798-54669820 CTAAAAATGCAAAAATTGGCCGG + Intergenic
1008773802 6:55009999-55010021 CAATAAATGCAAAAATTAGCTGG - Intergenic
1009240506 6:61180330-61180352 CTTTAAATGCAAGTATCTGCAGG + Intergenic
1009419083 6:63445147-63445169 CAAAAAATGCAAAAATTAGCTGG + Intergenic
1009713112 6:67349513-67349535 TATTAAATTCAAATATTATCAGG + Intergenic
1009775604 6:68201996-68202018 AATTAAATGCTAATATCTGCAGG - Intergenic
1010040909 6:71382759-71382781 GATTTAATTAAAATATTGGCAGG - Intergenic
1010316728 6:74460020-74460042 TAATAAATGTAAATATAGGCTGG - Intergenic
1010814750 6:80344298-80344320 TATTAAATGTAAATATAGCCAGG - Exonic
1011611318 6:89153761-89153783 CAAAAAATACAAATATTAGCTGG - Intronic
1011676055 6:89735182-89735204 CATTAAAACAAACTATTGGCCGG - Intronic
1011860993 6:91756039-91756061 GAATAAAGGTAAATATTGGCTGG + Intergenic
1012062658 6:94508841-94508863 CAAAAAATACAAATATTAGCCGG - Intergenic
1012781850 6:103570197-103570219 CTAAAAATACAAATATTGGCTGG + Intergenic
1012789310 6:103673695-103673717 CATCATAGGCAAATATTGGAGGG + Intergenic
1012907464 6:105084751-105084773 CAAAAAATTCAAAAATTGGCCGG - Intergenic
1013222269 6:108088996-108089018 CAAAAAATACAAAAATTGGCTGG + Intronic
1013464473 6:110405739-110405761 CAAAAAATACAAATATTAGCTGG + Intronic
1013497571 6:110713556-110713578 CAAAAAATGAAAATATTAGCTGG - Intronic
1013581225 6:111536580-111536602 CAAGAAATACAAAAATTGGCCGG - Intergenic
1014046541 6:116894884-116894906 TATAAAATGTAAATATAGGCTGG + Intronic
1014197812 6:118579055-118579077 CAATAAATACAAATATTAGCTGG - Intronic
1014791055 6:125672736-125672758 CAAAAAATGCAAAAATTAGCTGG - Intergenic
1015033427 6:128624365-128624387 CAAAAAATACAAAAATTGGCAGG + Intergenic
1015242503 6:131041047-131041069 AATTAAATGCAATCCTTGGCAGG + Intronic
1015249109 6:131108054-131108076 CAAAAAATGCAAACATTTGCTGG + Intergenic
1015585622 6:134773171-134773193 CAAAAAATGCAAAAATTAGCTGG - Intergenic
1015968687 6:138721659-138721681 CAAAAAATACAAATATTAGCTGG - Intergenic
1016006090 6:139090745-139090767 CAAAAAATGCAAAAATTAGCTGG + Intergenic
1016043846 6:139460788-139460810 TACTAAATACAAATATTAGCTGG + Intergenic
1016088658 6:139947334-139947356 CATAAAATGCAAAAGATGGCCGG + Intergenic
1016247583 6:142002308-142002330 CAGCAAATACAAATATTAGCTGG + Intergenic
1016913306 6:149220776-149220798 CAAAAAATGCAAAAATTAGCCGG - Intronic
1017094552 6:150793104-150793126 AATTAAAGGCAAGAATTGGCTGG + Intronic
1017106572 6:150893945-150893967 AATTAAATGCTAATGTGGGCCGG + Intronic
1017151806 6:151287420-151287442 CAAAAAATGCAAAAATTGGCTGG - Intronic
1017180204 6:151545121-151545143 CATTAAAACCAAATAGTGGCTGG + Intronic
1017285610 6:152672632-152672654 CATAAGTTGAAAATATTGGCCGG + Intergenic
1017499131 6:155006985-155007007 CAAAAAATACAAAAATTGGCCGG - Intronic
1017589222 6:155960402-155960424 CTTAAAATGCAATTCTTGGCGGG - Intergenic
1017772957 6:157657209-157657231 CAAAAAATGCAAAAATTAGCTGG - Intronic
1017785786 6:157756249-157756271 CAAAAAATACAAAAATTGGCTGG + Intronic
1017865949 6:158443276-158443298 CTAAAAATGCAAAAATTGGCTGG - Intronic
1018251669 6:161877762-161877784 TTTAAAATGCAAATATGGGCCGG - Intronic
1018801683 6:167227534-167227556 CAAAAAATGCAAAAATTAGCCGG - Intergenic
1019179846 6:170179415-170179437 CAGGAAATGCAAATCTAGGCAGG + Intergenic
1019493792 7:1327023-1327045 CATAAAATGTAAATATAAGCTGG + Intergenic
1019503565 7:1378065-1378087 GTATAAATGTAAATATTGGCTGG + Intergenic
1019764390 7:2839543-2839565 CAAAAAATACAAAAATTGGCTGG - Intronic
1019839617 7:3427355-3427377 CTAAAAATGCAAAAATTGGCTGG + Intronic
1020236740 7:6361829-6361851 CAAAAAATAAAAATATTGGCCGG + Intergenic
1020797996 7:12699514-12699536 CAAAAAATGCAAAAATTAGCCGG - Intergenic
1020898446 7:13972268-13972290 TATAAAATACAAAAATTGGCCGG + Intronic
1021321667 7:19220118-19220140 CAAAAAATGCAAAAATTAGCCGG - Intergenic
1021492664 7:21236450-21236472 CAAAAAATACAAATATTAGCTGG - Intergenic
1021772449 7:24019186-24019208 CAAAAAATGCAAAAATTAGCTGG + Intergenic
1022004706 7:26256818-26256840 AATTAAATGCAAAAAATGCCTGG + Intergenic
1022169700 7:27813514-27813536 CATGAAATACAAAAATTAGCTGG - Intronic
1022218253 7:28286704-28286726 CATAAAATACAAATATTAGCTGG + Intergenic
1022876227 7:34533439-34533461 AAATAAATACAAATCTTGGCCGG - Intergenic
1023431521 7:40096501-40096523 CACTAAATGGAAAAATTGACTGG + Exonic
1023546233 7:41320231-41320253 CACAAAATGCAAAAATTAGCTGG - Intergenic
1024626742 7:51214102-51214124 CTAAAAATGCAAATATTAGCTGG + Intronic
1024660646 7:51489989-51490011 CATTGAGTGAAAATGTTGGCAGG - Intergenic
1024767215 7:52673982-52674004 CAAAAAATACAAAAATTGGCCGG + Intergenic
1024775912 7:52785293-52785315 CAGAAAATGCAAAGATTGGTTGG - Intergenic
1025065138 7:55848321-55848343 CAAAAAATACAAAAATTGGCTGG - Intronic
1025801245 7:64788673-64788695 CTAAAAATGCAAAAATTGGCCGG + Intergenic
1025805874 7:64834020-64834042 CTTTAAAGGCTTATATTGGCTGG - Intergenic
1025865038 7:65373609-65373631 GGTTAAATGCAAATACTGTCTGG + Intergenic
1025955002 7:66176091-66176113 CAAAAAATACAAAAATTGGCCGG - Intergenic
1025985918 7:66451686-66451708 CATAAAATACAAAAATTAGCTGG + Intergenic
1026002769 7:66574978-66575000 CATAAAATACAAAAATTAGCTGG + Intergenic
1026089955 7:67291599-67291621 CTAAAAATGCAAATATTAGCTGG - Intergenic
1026270843 7:68835428-68835450 CTTTAAAAGAAAATGTTGGCTGG + Intergenic
1026615107 7:71895114-71895136 CAAAAAATACAAATATTAGCTGG - Intronic
1026904521 7:74055276-74055298 CATAAAATGCAAAAATTAGCTGG + Intronic
1026946885 7:74322150-74322172 CAAAAAATACAAAAATTGGCCGG - Intronic
1027119545 7:75506918-75506940 CTAAAAATGCAAATATTAGCTGG - Intergenic
1027146140 7:75696147-75696169 CAAAAAATGCAAACATTAGCCGG - Intronic
1027159594 7:75792577-75792599 CATAAAATACAAAAATTAGCCGG + Intergenic
1027173722 7:75890167-75890189 CTAAAAATGCAAAAATTGGCCGG + Intergenic
1027209143 7:76130229-76130251 CATAAAATACAAAAATTAGCTGG + Intergenic
1027249087 7:76387616-76387638 CAAAAAATGCAAAAATTGGCCGG + Intergenic
1027272280 7:76528693-76528715 CTAAAAATGCAAATATTAGCTGG + Intergenic
1027915532 7:84314993-84315015 CATTAACTGAAAATATTATCTGG + Intronic
1028139087 7:87252619-87252641 CATAAAATGCACATAATCGCAGG + Intergenic
1028219305 7:88176924-88176946 CAATAAATACAAAAATTAGCTGG - Intronic
1028404310 7:90459608-90459630 CATTAAATACAAAAATTAGCTGG + Intronic
1028678176 7:93492612-93492634 CATGAAATGTAAATATGAGCTGG + Intronic
1029154295 7:98504040-98504062 CAAAAAATGCAAACATTAGCTGG + Intergenic
1029533518 7:101141473-101141495 CAAAAAATGCAAATATTAGCAGG - Intergenic
1029536736 7:101161784-101161806 CAAAAAATGCAAACATTAGCTGG + Intergenic
1029613687 7:101642936-101642958 CTTAAAATGCAAAAATTAGCTGG + Intergenic
1029669891 7:102022454-102022476 CAAAAAATGCAAAAATTTGCCGG + Intronic
1030258781 7:107541333-107541355 CAAAAAATACAAAAATTGGCTGG + Intronic
1030261775 7:107572686-107572708 CTAAAAATGCAAAAATTGGCTGG + Intronic
1030315092 7:108106254-108106276 CATAAAATACAAAAATTAGCTGG + Intronic
1030487073 7:110182788-110182810 CATCAAATACAAAGATTAGCTGG + Intergenic
1030941177 7:115651377-115651399 CAAAAAATGCAAAAATTAGCTGG - Intergenic
1031177798 7:118374761-118374783 CATTAGTTAGAAATATTGGCCGG + Intergenic
1033567119 7:142589550-142589572 CAAAAAATGCAAAAATTAGCTGG - Intergenic
1033772768 7:144571877-144571899 CAATAAATACAAAAATTAGCTGG - Intronic
1033811088 7:145012000-145012022 CAATAAATGTAAATATTAGATGG + Intergenic
1034068527 7:148160076-148160098 CAAAAAATACAAAAATTGGCTGG + Intronic
1034140528 7:148811310-148811332 CAAAAAATGCAAAAATTAGCCGG - Intronic
1034187401 7:149189266-149189288 CATTAAAACCAAGTGTTGGCCGG - Intergenic
1034537197 7:151732852-151732874 CTAAAAATGCAAAAATTGGCCGG - Intronic
1034647742 7:152663675-152663697 CAAAAAATACAAAAATTGGCTGG + Intronic
1034653242 7:152708895-152708917 CAAAAAATACAAAAATTGGCTGG - Intergenic
1034869070 7:154667429-154667451 CATAACATACAAATGTTGGCTGG + Intronic
1035202774 7:157277836-157277858 CAAAAAATGCAAAAATTAGCTGG - Intergenic
1036141330 8:6211587-6211609 GATTAAATGAAAAAGTTGGCTGG - Intergenic
1036798410 8:11772039-11772061 CTAAAAATGCAAAAATTGGCTGG + Intronic
1036966592 8:13305673-13305695 CAAAAAATACAAAAATTGGCTGG + Intronic
1038044816 8:23757308-23757330 CAAAAAATACAAATATTAGCTGG - Intergenic
1038262369 8:26007417-26007439 CAGTAAATGACAATATTGGCAGG - Intronic
1038399216 8:27270287-27270309 CAAAAAATACAAAAATTGGCCGG - Intergenic
1038466044 8:27764428-27764450 CAATAAAAGAAAATATTAGCTGG - Intronic
1038643399 8:29345001-29345023 CAAAAAATGCAAAAATTAGCCGG - Intronic
1038719338 8:30019548-30019570 CAAAAAATGCAAAAATTAGCTGG + Intergenic
1038801839 8:30756439-30756461 AAAAAAATGCAAAAATTGGCCGG - Intronic
1038950625 8:32410340-32410362 CAAAAAATGCAAAAATTAGCTGG - Intronic
1039307271 8:36276241-36276263 CATAAAATACAAAAATTAGCTGG - Intergenic
1039521327 8:38174860-38174882 CAAAAAATGCAAAAATTAGCTGG + Intronic
1039791143 8:40876438-40876460 CAGTAGATGCAACTATAGGCAGG + Intronic
1040393421 8:46970674-46970696 CATTTTATAGAAATATTGGCCGG + Intergenic
1040421362 8:47243068-47243090 CAAAAAATGCAAAAATTAGCTGG - Intergenic
1040502245 8:48015214-48015236 CAAAAAATGCAAAAATTAGCTGG + Intronic
1040741919 8:50586271-50586293 CATTAACTGCATATATTTGTTGG - Intronic
1040812009 8:51464200-51464222 CAAAAAATGAAAATATTAGCTGG + Intronic
1040911280 8:52521602-52521624 CTAAAAATGCAAAAATTGGCCGG + Intergenic
1041732216 8:61074174-61074196 CAAAAAATGCAAAAATTAGCTGG + Intronic
1042302880 8:67304655-67304677 CATGAAATACAAATATTAGCCGG + Intronic
1042407903 8:68426355-68426377 CAAAAAATGCAAAAATTGCCTGG + Intronic
1042546715 8:69957548-69957570 TACTAAATGCAAAAATTAGCCGG + Intergenic
1042547131 8:69960851-69960873 GATTAAATACAAAAATTAGCCGG - Intergenic
1042717367 8:71789268-71789290 TATCATATGCAAATATTGGGAGG - Intergenic
1042765778 8:72320663-72320685 CTTTAAATTCAAATAATGCCAGG + Intergenic
1042838628 8:73101157-73101179 CAAAAAATGCAAAAATTAGCTGG - Intronic
1043014163 8:74917651-74917673 AATTAAATGAAAATAATGACTGG - Intergenic
1043670525 8:82879700-82879722 CAAAAAATACAAAAATTGGCCGG - Intergenic
1043860570 8:85311504-85311526 TATTAAATAGAAATATTGTCTGG - Intergenic
1043962213 8:86430035-86430057 CAAAAAATACAAATATTAGCCGG + Intronic
1044040950 8:87367873-87367895 CATTAAAAGAATATGTTGGCCGG + Intronic
1044270011 8:90230781-90230803 CATTAAATGCAAATTTTCAGAGG - Intergenic
1045051517 8:98331452-98331474 CAAAAAATGCAAAAATTAGCTGG + Intergenic
1045359197 8:101416427-101416449 AAAAAAATGCAAAAATTGGCTGG + Intergenic
1046102804 8:109633893-109633915 CAAAAAATGCAAAAATTAGCTGG - Intronic
1046599011 8:116296191-116296213 CATTTAAAGCACATGTTGGCTGG - Intergenic
1046735392 8:117771142-117771164 CAAAACATGCAAATATTAGCTGG + Intergenic
1048030634 8:130628301-130628323 CTTAAAATGCAAAAATTAGCTGG - Intergenic
1048254014 8:132891494-132891516 CAAGAAATGCAAAAATTAGCTGG - Intronic
1049211805 8:141390295-141390317 CATTAAATGCTTCTATTGCCGGG - Intergenic
1050000706 9:1074405-1074427 CAAAAAATACAAAAATTGGCTGG - Intergenic
1050157287 9:2680765-2680787 CGTTAAAATCAAATATGGGCTGG - Intergenic
1050419531 9:5449046-5449068 CATTAAATGAAAATATCAGAGGG + Intergenic
1050546664 9:6715524-6715546 CAAAAAATGCAAAAATTAGCTGG + Intergenic
1050818061 9:9840197-9840219 CAAAAAATGCAAAAATTAGCTGG - Intronic
1050914441 9:11113739-11113761 TATTAAATGCATATATTTACGGG - Intergenic
1050921658 9:11210772-11210794 TAATAAATTCAAATATTTGCAGG - Intergenic
1051000813 9:12279713-12279735 CTAAAAATACAAATATTGGCTGG + Intergenic
1051039250 9:12785978-12786000 TATAAAATGCAAATATATGCAGG - Intronic
1051541168 9:18219652-18219674 AATTAAATGTACATATAGGCTGG - Intergenic
1052110079 9:24571457-24571479 CATAAAAAACAAATATTTGCCGG - Intergenic
1052316192 9:27118470-27118492 CAAATAATACAAATATTGGCTGG + Intronic
1052578721 9:30325415-30325437 CTTTAAATGCAAATATTATTTGG - Intergenic
1052586508 9:30436018-30436040 AATTAAATGAAAATATAGGCTGG + Intergenic
1052973036 9:34389539-34389561 CAAAAAATACAAAAATTGGCAGG - Intronic
1053221760 9:36318510-36318532 CAAAAAATACAAATATTAGCTGG + Intergenic
1053321132 9:37099856-37099878 CAAAAAATACAAAAATTGGCTGG + Intergenic
1053330946 9:37206511-37206533 CAAAAAATGCAAAAATTAGCTGG - Intronic
1053400725 9:37818288-37818310 CATTAAGTTGAAATCTTGGCCGG - Intronic
1053540482 9:38968645-38968667 CATTAAATACTAAAATTCGCAGG + Intergenic
1053804829 9:41790801-41790823 CATTAAATACTAAAATTCGCAGG + Intergenic
1054625658 9:67395278-67395300 CATTAAATACTAAAATTCGCAGG - Intergenic
1054745430 9:68849525-68849547 CAAAAAATGCAAAAATTAGCTGG - Intronic
1055031503 9:71774808-71774830 CAAAAAATACAAACATTGGCTGG - Intronic
1055102129 9:72476986-72477008 CTCTCAATGCAAAGATTGGCTGG + Intergenic
1055683998 9:78750794-78750816 CATTAAAGGCACAGAGTGGCTGG - Intergenic
1056250528 9:84743095-84743117 CATCAAAAGCTAATATAGGCCGG - Intronic
1057117940 9:92543309-92543331 CAAAAAATACAAAAATTGGCTGG + Intronic
1058068249 9:100573634-100573656 TATCAAATACAGATATTGGCAGG + Intronic
1058586879 9:106517154-106517176 AATAAAATGTAAATATTGGCAGG + Intergenic
1058694792 9:107550041-107550063 CTAAAAATGCAAAAATTGGCCGG - Intergenic
1058717825 9:107738403-107738425 CATGAAAAGGAAATTTTGGCCGG + Intergenic
1059074275 9:111175114-111175136 TACTAAATACAAAAATTGGCTGG + Intergenic
1059084960 9:111290806-111290828 CAAAAAATGCAAAAATTAGCTGG - Intergenic
1059140649 9:111849780-111849802 TATTAAATGCAAATAATGAAAGG - Intergenic
1059159645 9:112021835-112021857 CAAAAAATGCAAAAATTAGCTGG + Intergenic
1059233799 9:112745248-112745270 TATGAAATGAAACTATTGGCCGG + Intergenic
1059242018 9:112814400-112814422 CAAAAAATGCAAAAATTAGCCGG - Intronic
1059261114 9:112977703-112977725 GGTTAAATACAGATATTGGCAGG - Intergenic
1059473744 9:114527188-114527210 CATTAAATCCTTATATTTGCAGG - Intergenic
1059550146 9:115220866-115220888 CATGAAATGAAAATATTTTCTGG + Intronic
1059844964 9:118265053-118265075 CATAAAATACAAAAATTAGCTGG + Intergenic
1059882234 9:118704365-118704387 CATTGAAGGCAAATGTTGGAAGG - Intergenic
1059889163 9:118782071-118782093 CACTAAATGCAAAAATTCACTGG + Intergenic
1060456850 9:123806416-123806438 CTAAAAATGCAAATATTAGCTGG - Intronic
1060592544 9:124827727-124827749 CAAAAAATGCAAAAATTAGCTGG - Intergenic
1060629008 9:125139249-125139271 CAAAAAATGCAAAAATTAGCTGG + Intronic
1060646775 9:125287374-125287396 CAAAAAATGCAAAAATTAGCTGG + Intronic
1061029904 9:128074837-128074859 CAAAAAATACAAAAATTGGCTGG + Intronic
1061171495 9:128959301-128959323 CTAAAAATGCAAAAATTGGCTGG - Intronic
1061628062 9:131853764-131853786 CAAAAAATGCAAAAATTAGCTGG + Intergenic
1061774751 9:132954252-132954274 CAAAAAATGCAAATATTATCTGG - Intronic
1062664384 9:137660171-137660193 CAAAAAATACAAATATTAGCTGG + Intronic
1062735022 9:138131783-138131805 TATTAAATGTAAAGATTGGCCGG - Intergenic
1203629687 Un_KI270750v1:60809-60831 CATTTAGTGCAAATAGTAGCTGG + Intergenic
1185884163 X:3767280-3767302 CAAAAAATGCAAAAATTAGCCGG - Intergenic
1186449631 X:9661361-9661383 CAATAAATACAAAAATTAGCCGG + Intronic
1186596553 X:10987689-10987711 CTCTAAATGAAAATATTGGCCGG - Intergenic
1187047061 X:15657150-15657172 CAAAAAATGCAAAAATTAGCTGG - Intronic
1187131631 X:16508953-16508975 CAAGAAATACAAAAATTGGCTGG + Intergenic
1187227248 X:17385350-17385372 CAAAAAATACAAAAATTGGCCGG + Intronic
1187381868 X:18809541-18809563 CATAAAATACAAAAATTAGCTGG + Intronic
1187510392 X:19912495-19912517 CAAAAAATACAAATATTAGCTGG - Intergenic
1187529157 X:20080884-20080906 CATTACAGGAAAATACTGGCTGG - Intronic
1187781635 X:22833138-22833160 CAAAAAATGCAAAAATTAGCCGG + Intergenic
1189105384 X:38230213-38230235 CTAAAAATGCAAATATTAGCCGG + Intronic
1189312785 X:40031965-40031987 CAAAAAATGCAAACATTAGCTGG - Intergenic
1189820171 X:44862562-44862584 CTTAAAATACAAAAATTGGCCGG + Intergenic
1189975022 X:46452104-46452126 CAAAAAATACAAAAATTGGCTGG - Intronic
1190080488 X:47353361-47353383 CAAAAAATACAAATATTAGCTGG - Intergenic
1190093849 X:47463295-47463317 CATTACATCTAACTATTGGCTGG + Intronic
1190806735 X:53844889-53844911 CTAAAAATACAAATATTGGCCGG - Intergenic
1190860979 X:54344145-54344167 AATTAAAAGCAAATTCTGGCTGG + Intronic
1190869151 X:54410691-54410713 CAAAAAATTCAAATATTAGCTGG + Intergenic
1191717965 X:64205873-64205895 CTTTAAATGCAAATAAGTGCAGG + Intergenic
1191795296 X:65015500-65015522 CATAAAATCCAAATGTTGGCTGG + Intronic
1192370238 X:70506919-70506941 CAGAAAATGCAAAAATTAGCTGG - Intergenic
1192487147 X:71537597-71537619 TATTAAATAAAATTATTGGCTGG - Intronic
1192615386 X:72615852-72615874 CATTAAAGGTAATTATTGGTAGG - Intronic
1193435042 X:81463120-81463142 GATTCAATGGAAATCTTGGCAGG - Intergenic
1194357534 X:92904104-92904126 CAAAAAATGCAAAAATTAGCTGG + Intergenic
1195003043 X:100660677-100660699 AATTAAATACAAAAATTAGCTGG + Intronic
1195648937 X:107264469-107264491 CATAAAATACAAAAATTAGCAGG - Intergenic
1195816964 X:108898528-108898550 AATTAAAGGTAATTATTGGCAGG - Intergenic
1196462654 X:115946187-115946209 CTGGAAATGCAAAAATTGGCTGG - Intergenic
1196508092 X:116473308-116473330 CATTAAATGTTATTATTGGTAGG + Intergenic
1196580826 X:117377051-117377073 CTAAAAATGCAAAAATTGGCAGG - Intergenic
1196682394 X:118482496-118482518 CAAAAAATGCAAAAATTAGCCGG - Intergenic
1196831699 X:119780932-119780954 CAATAAATGCATTTGTTGGCTGG - Intergenic
1196903306 X:120408230-120408252 CATTAAAACCAAATTTTGGATGG + Intergenic
1197244332 X:124152754-124152776 CAATTAATACAAATATTTGCAGG - Intronic
1197414729 X:126161539-126161561 CATAAAATACAAAATTTGGCCGG - Intergenic
1198516139 X:137409270-137409292 CATAAAATACAAAAATTAGCAGG - Intergenic
1199749230 X:150798910-150798932 CAAAAAATGCAAAAATTAGCTGG - Intronic
1199756053 X:150865957-150865979 CAATAAATACAAAAATTGGCTGG + Intronic
1199820571 X:151441744-151441766 CACTAAATGCACATATTGGAAGG - Intergenic
1200051935 X:153437508-153437530 CAATAAATACAAAAATTGGCAGG + Intergenic
1200249367 X:154544454-154544476 CTTAAAATACAAAAATTGGCTGG - Intronic
1200335494 X:155346902-155346924 AATCAAATGCAAAAATAGGCCGG - Intergenic
1200350974 X:155494323-155494345 AATCAAATGCAAAAATAGGCCGG + Intronic
1200388715 X:155919960-155919982 CCTTAAATTCAAATATTTGGTGG + Intronic
1200665707 Y:6019713-6019735 CAAAAAATGCAAAAATTAGCTGG + Intergenic
1200755642 Y:6987604-6987626 CTTGAAATGACAATATTGGCTGG - Intronic
1201144653 Y:11057501-11057523 CATTTAAAGCAAATATTGTAAGG - Intergenic
1201361254 Y:13152253-13152275 TACTAAATGCAAAAATTAGCGGG + Intergenic
1201382353 Y:13395799-13395821 CTTAAAATGCAAATTTAGGCTGG + Intronic
1201533470 Y:15018678-15018700 CTTAAAATGCAAAAATTAGCCGG - Intergenic
1201595990 Y:15669835-15669857 CAAAAAATACAAAAATTGGCTGG - Intergenic
1202097646 Y:21268335-21268357 AATAAAATGCAAAAATTAGCAGG + Intergenic