ID: 1162592666

View in Genome Browser
Species Human (GRCh38)
Location 19:11602857-11602879
Sequence CACTGTGAGGAGAGGAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 567
Summary {0: 1, 1: 0, 2: 0, 3: 58, 4: 508}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162592661_1162592666 -1 Left 1162592661 19:11602835-11602857 CCTGGAGGAGGGAGCATTTCCAC 0: 2
1: 2
2: 3
3: 32
4: 256
Right 1162592666 19:11602857-11602879 CACTGTGAGGAGAGGAGAGTGGG 0: 1
1: 0
2: 0
3: 58
4: 508
1162592660_1162592666 0 Left 1162592660 19:11602834-11602856 CCCTGGAGGAGGGAGCATTTCCA 0: 2
1: 0
2: 2
3: 26
4: 224
Right 1162592666 19:11602857-11602879 CACTGTGAGGAGAGGAGAGTGGG 0: 1
1: 0
2: 0
3: 58
4: 508

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162592666 Original CRISPR CACTGTGAGGAGAGGAGAGT GGG Intronic
901161092 1:7177198-7177220 CACTGTGTGGGGAGGAGCCTTGG - Intronic
901184985 1:7367214-7367236 CTCTCTGAGGAGAAGAGAGCTGG - Intronic
901561171 1:10072084-10072106 CCCTCTGGGGAGAGGTGAGTGGG - Exonic
902413427 1:16225488-16225510 AGCTGTGAGGAGGGGAGAGAGGG + Intergenic
902529685 1:17082781-17082803 CAGTGTGAGGGGAGGAGGATGGG - Intronic
902778389 1:18689358-18689380 CACTGTGGGGAGACCACAGTGGG - Intronic
903281936 1:22255065-22255087 CACTGTGGGGGTAGGACAGTGGG - Intergenic
903324482 1:22562368-22562390 CACTGGGGGGTGAGGAGAATTGG - Intergenic
903421772 1:23222847-23222869 CACAGTTAGGAGAGGAGCTTGGG + Intergenic
903774504 1:25783933-25783955 CTCTGTGAGGAGACAAGACTTGG + Exonic
905698803 1:39996223-39996245 CAGTTTGATGAGAGGAGTGTTGG + Intergenic
906029233 1:42704401-42704423 CAGTGTGAGCACAGGAGAGCAGG + Intergenic
907366391 1:53964128-53964150 CACTGTCAGGAGAGCAGGGGAGG - Intronic
907571786 1:55490728-55490750 CACGGAGAGGAGAGGAGAAAAGG - Intergenic
907967104 1:59342719-59342741 AATTGTGAGGAGCAGAGAGTGGG + Intronic
909836333 1:80260039-80260061 CACTGTGAGGAAAAGACAGTGGG + Intergenic
909893545 1:81037300-81037322 CCCTATGAGAAGAGGAGATTAGG + Intergenic
910840092 1:91553251-91553273 GACTCAGAGGGGAGGAGAGTTGG - Intergenic
912112474 1:106359906-106359928 GACTTTGAGGAGTTGAGAGTTGG + Intergenic
913049281 1:115102703-115102725 CACAGGGAGGAGAGAAGAATCGG - Intergenic
913576765 1:120183098-120183120 CACTATGAGTAGAGGAGAGATGG - Intergenic
914340228 1:146753969-146753991 CCTTATGAGGAGAGGAGATTAGG - Intergenic
914558674 1:148794533-148794555 CACTATGAGTAGAGGAGAGATGG - Intergenic
914614161 1:149335697-149335719 CACTATGAGTAGAGGAGAGATGG + Intergenic
915145478 1:153793884-153793906 CCCTGGGAGGAGGGGACAGTGGG + Intergenic
915215675 1:154339230-154339252 CAGGGTGTGAAGAGGAGAGTTGG + Intronic
915524517 1:156467720-156467742 CCCTATGGGGAGAGGGGAGTGGG - Intronic
915568823 1:156732765-156732787 ACCTGTGAGGCAAGGAGAGTGGG + Intronic
915748018 1:158180211-158180233 CAGTGTGAGAAGTGGCGAGTTGG + Intronic
915818209 1:158992731-158992753 AACTGTGAGGACATGAGATTTGG + Intergenic
916127987 1:161588480-161588502 CACTGGGAGGAGAGGAAAAGGGG - Intronic
916137905 1:161670310-161670332 CACTGGGAGGAGAGGAAAAGGGG - Intronic
916193553 1:162201962-162201984 CAGTGTGTTCAGAGGAGAGTTGG + Intronic
916318996 1:163481450-163481472 AAATGTGAGGACAGGAGATTTGG + Intergenic
916794058 1:168149626-168149648 GAGGGTGAGGAGAGGAGAGGTGG + Intergenic
916795812 1:168166163-168166185 CACTCTGAGGAGAGAAGAGCTGG - Intergenic
918306166 1:183248934-183248956 CAGTTTGAGGAGAGTAGAATTGG + Exonic
918394917 1:184103766-184103788 GGCTGGGAGGAGAGGACAGTGGG - Intergenic
918570803 1:185989558-185989580 CACCTGGAGGAGAGGAGAGTGGG + Exonic
919204340 1:194401676-194401698 CAGAGTGAGGAGAGGAAAGGAGG + Intergenic
919236032 1:194843743-194843765 CACTGTGATTACAGCAGAGTTGG + Intergenic
919281677 1:195497265-195497287 GACTGACAGGAGAGGAAAGTAGG - Intergenic
919904066 1:202065711-202065733 ACCTGGGAGGAGAGGAGAATGGG + Intergenic
920044519 1:203124802-203124824 CACTGTGGGCAGAGGTGGGTGGG - Intronic
920846276 1:209595549-209595571 CTCTGTCAGGAGAGGGGAGTTGG + Intronic
921418967 1:214923912-214923934 CAGAGTGAGGCCAGGAGAGTTGG - Intergenic
922169103 1:223140205-223140227 CATTTTGAGCATAGGAGAGTAGG + Intronic
922917039 1:229267055-229267077 CACTGTGGGGAGAAGTGAATGGG + Intergenic
923051804 1:230395160-230395182 GAGTGTGAGGAGAGGAGGGGAGG - Intronic
923051900 1:230395477-230395499 GAGTGTGAGGAGAGGAGGGGAGG - Intronic
923051969 1:230395708-230395730 GAGTGTGAGGAGAGGAGGGGAGG - Intronic
923215863 1:231847242-231847264 CCCTATGAGGAGAGGAGATGAGG - Intronic
923336749 1:232977436-232977458 CACTGTGATGGGAGCAGAGATGG + Intronic
923692734 1:236211751-236211773 AACAGTGAGGATAAGAGAGTGGG + Intronic
924148001 1:241097228-241097250 GACGGTGAGGAGAGGAGAAATGG + Intronic
924540580 1:244977126-244977148 GGCTGTGGGGAGAGGAGAATGGG + Intronic
924814553 1:247430378-247430400 CCCTGTAAGAAGAGGAGACTAGG - Intronic
924821153 1:247491847-247491869 CACTGTGAGGTGAGAAGAGCAGG - Intergenic
924832866 1:247615648-247615670 TTCTGTGAGCAGATGAGAGTTGG + Intergenic
1063089050 10:2845394-2845416 CACAGTGAGTAGATGAGAGTGGG - Intergenic
1063743877 10:8857489-8857511 CACTGCAAGGAGAGGTTAGTGGG + Intergenic
1065417239 10:25501896-25501918 CAGTGTGAGGAGATGAGAAAGGG - Intronic
1066456532 10:35577151-35577173 CCCTGTAAGGAGAGGGGAGTCGG + Intergenic
1067010852 10:42712278-42712300 CATTGTGAGGAGTGTAGAATTGG + Intergenic
1068120933 10:52781268-52781290 GACTGTGAGATGAGGAGAGAGGG + Intergenic
1068129035 10:52874617-52874639 CACTGGGAGGAAATAAGAGTGGG + Intergenic
1068197972 10:53743978-53744000 CAATGTGAGGACATGAGATTTGG - Intergenic
1068309679 10:55262145-55262167 GAGTGTGAGGAGAGGAGATGGGG + Intronic
1068487408 10:57677721-57677743 AAATGTGAGGACAGGAGATTTGG - Intergenic
1068956706 10:62824945-62824967 CACTGTGAGGAGAGGAAAAGAGG - Intronic
1069613390 10:69790394-69790416 CACTGTTAGGAAGGGAGGGTGGG - Intergenic
1069841295 10:71341039-71341061 CAGTCTGGGGAGAGGAGAGGCGG + Intronic
1071361691 10:84852410-84852432 TACTGTGAGAAGAGGAGAGGAGG - Intergenic
1073073996 10:100812047-100812069 TATTGTGTGGAGGGGAGAGTGGG + Intronic
1073471964 10:103727988-103728010 CGTTGTGAGAAGAGCAGAGTAGG + Intronic
1073526902 10:104191500-104191522 AAGTGTGAGGAGAGGAGTGGAGG - Intronic
1073788449 10:106915558-106915580 CAATGTGACTAGAGTAGAGTGGG - Intronic
1073928558 10:108546179-108546201 GACTGTGAGGAGTAGGGAGTGGG + Intergenic
1074192637 10:111150908-111150930 CACAGTGAGGACACTAGAGTTGG + Intergenic
1075469612 10:122678217-122678239 CACAGGGAGGAGAGGGAAGTAGG + Intergenic
1075979561 10:126724884-126724906 CACTGGGGTGAGAGGGGAGTGGG - Intergenic
1076496976 10:130903895-130903917 GGCGGTGTGGAGAGGAGAGTGGG - Intergenic
1077015582 11:397725-397747 CTCAGTGAGCAGAGGACAGTGGG - Intronic
1077078701 11:713044-713066 CAGAGTGAGGAGTGGAGGGTGGG + Intronic
1078254735 11:9648422-9648444 GAATGTGGGGAGAGGAGAATGGG - Intergenic
1079100007 11:17535231-17535253 GACTGGTAGGAGAGGAGATTGGG - Intronic
1080151558 11:29057558-29057580 CAATGTGAGGATATGAGATTTGG + Intergenic
1080641361 11:34160352-34160374 TTCTGTGGGGAGAGGAGAGAGGG + Exonic
1081181774 11:39992802-39992824 CAATGTGAGGACATGAGATTTGG + Intergenic
1083254934 11:61490109-61490131 CACTGGAAGGAGAGGAGGGGAGG - Intronic
1083388653 11:62332228-62332250 CACTGGGAGGTGGGGGGAGTAGG + Intergenic
1083421054 11:62553508-62553530 AACTGTAAGCAGAGGAGAGAGGG - Intronic
1083486141 11:62984046-62984068 CACTGTGGGGAGAGGAGCAAGGG + Exonic
1083858113 11:65403960-65403982 CTTGGTGAGGAGAGGAGTGTGGG + Intronic
1084192615 11:67505662-67505684 GAGAGTGAGAAGAGGAGAGTGGG - Intronic
1085012772 11:73152824-73152846 CACTGGGAGGGGTGGGGAGTAGG + Intergenic
1085516144 11:77112992-77113014 CCCTGTAAGGAGAGGAATGTTGG + Intronic
1086006878 11:82047972-82047994 AAATGTGAGGAGATGAGATTTGG + Intergenic
1086729202 11:90227344-90227366 CAATGTGAGGACATGAGATTTGG - Intergenic
1087645154 11:100800331-100800353 CACTGGGAACAGAGGGGAGTTGG + Intronic
1088116454 11:106318274-106318296 CACCGTGGGGAGAGGGGAGAGGG + Intergenic
1089649663 11:119904495-119904517 CTTTGGGAGGAGAGGAGAGGAGG + Intergenic
1089763774 11:120748406-120748428 GTCTGTGGGGAGATGAGAGTAGG + Intronic
1089960666 11:122614622-122614644 CGAGGTGAGGAGAGGAGAGGAGG + Intergenic
1090965544 11:131594823-131594845 GACAGGGAGGACAGGAGAGTAGG + Intronic
1091593392 12:1858643-1858665 AACTGTGGGGAGAGAAGAGAAGG + Exonic
1091721893 12:2820018-2820040 CACTGTTAGCAGAGGAGCGGGGG + Intronic
1091748924 12:3010661-3010683 AAGTGTGGGGAGAGGAGAGGAGG + Intronic
1091838346 12:3601799-3601821 CTCTGTGAGGGGAGAAGAGTGGG + Intergenic
1092461020 12:8686272-8686294 AAATGAGAGGAGAGGAGAGGAGG - Intronic
1092622097 12:10283372-10283394 GACAGTGAGGAGCGGAGAGTGGG + Intergenic
1094709933 12:32951946-32951968 GGCTGTGAGGAGGGGAGAGGAGG - Intergenic
1095973989 12:47926847-47926869 CCCTCTGTGGAGAGGAGAGCTGG - Intronic
1096498874 12:52053813-52053835 CACTGCGAGGGGAGGAGAAAAGG + Intronic
1097261030 12:57720365-57720387 CAGTGAGAGGAGAGGATGGTTGG - Intronic
1097570422 12:61325427-61325449 AACTGTGAGGACATGAGATTTGG - Intergenic
1097693289 12:62754244-62754266 CACTGTGAGAAGGAGAGAGTTGG + Intronic
1098065973 12:66616614-66616636 CAGTGTGGGGAGAGGATGGTGGG + Intronic
1099408033 12:82286567-82286589 CACTGTGAGGAGAATAGCATGGG + Intronic
1100246053 12:92757957-92757979 CACGGTGAGGTGAGAAGACTCGG + Intronic
1101271803 12:103155013-103155035 CACTGTGAAAAGAGGAGTGGGGG - Intronic
1101565550 12:105901739-105901761 CACTCTGTTGAGAGGAGACTAGG + Intergenic
1101614614 12:106324367-106324389 CATTGTGACGGGAGTAGAGTTGG + Intronic
1102202724 12:111068730-111068752 CCCTGAGAGGAGAGGAGACGGGG + Intronic
1102494786 12:113312051-113312073 CTCTGTGGGAAGAGGGGAGTTGG + Intronic
1102821980 12:115916206-115916228 GACTGGGAGGAGAGGAGAATGGG + Intergenic
1103121456 12:118383097-118383119 CTCTGTAAGGGGAGGAGAGTAGG - Intronic
1103303743 12:119947951-119947973 GGCTGGGAGGAGAGGAGAATGGG + Intergenic
1103330131 12:120148467-120148489 CACTGGGAGGAGGGGAGAGGGGG + Intronic
1103620350 12:122183464-122183486 CACTGCGCGGGGAGGAGAGCGGG + Intronic
1106152464 13:27118936-27118958 TACTGTGAGGACAAGGGAGTGGG - Intronic
1106333067 13:28756945-28756967 CAGTGAGAGTAGAGGAGAGAAGG - Intergenic
1107088269 13:36448712-36448734 CACTGTCAGGAGAAGAGGATGGG - Intergenic
1107212208 13:37870430-37870452 CACCTTGAGGACAGGAGAGGGGG - Intergenic
1107460654 13:40598693-40598715 CACTGGGAGTAGAGCAGAGCTGG - Intronic
1108074793 13:46668616-46668638 CATTGTCAGGAGAGGGCAGTTGG + Intronic
1108746361 13:53398828-53398850 CACAGTCAGGTGAGGAGAGAAGG - Intergenic
1108968437 13:56341568-56341590 AAATGTGAGGAGATGAGATTTGG - Intergenic
1109872160 13:68346144-68346166 AACTGTGAGGAGAATAGAGAAGG + Intergenic
1109986052 13:69986179-69986201 GACTGTGGGGAGAGAAGAATGGG + Intronic
1110149310 13:72230259-72230281 CACTGTGAAGAGATGAAAGAGGG + Intergenic
1111313146 13:86516640-86516662 AAATGTGAGGAGATGAGATTTGG - Intergenic
1111922932 13:94431317-94431339 CCTTGTGAGAAGAGGAAAGTTGG + Intergenic
1113404724 13:110027767-110027789 CTCTTTGTGGAGAGGAGAGAGGG + Intergenic
1115132810 14:30073601-30073623 AAATGTGAGGACATGAGAGTTGG + Intronic
1115447017 14:33502304-33502326 CACTGGGAGGAGAGAAGAAAAGG - Intronic
1115469150 14:33749875-33749897 CACTGTGTGGAGAGGAAGATTGG - Intronic
1115574745 14:34699927-34699949 CACTGTGATGAGAGAAGTGCAGG - Intergenic
1116232067 14:42229663-42229685 CACTGAGAGTAGAGTAGAGATGG - Intergenic
1116781441 14:49241591-49241613 CACTGTGAGGAAAAGACACTGGG - Intergenic
1117252224 14:53949449-53949471 CACTGGGATGAAAGGAGTGTAGG - Intergenic
1118016346 14:61664936-61664958 GACTGTGGGAAGAGTAGAGTAGG - Intergenic
1118032102 14:61828050-61828072 CATTGTAAGAAGAGGAGACTTGG + Intergenic
1118449847 14:65890323-65890345 CACTGAGAAGAGGGGAGATTTGG + Intergenic
1119087908 14:71754029-71754051 CAGCCTGAGGAGAGGACAGTGGG - Intergenic
1120937398 14:89910748-89910770 CACTCGGAAGACAGGAGAGTCGG + Intronic
1121032076 14:90666796-90666818 CACAGTGAGAGGAGTAGAGTGGG + Intronic
1121120392 14:91372415-91372437 CACTGGGAGCAGAGGAGAGCGGG + Intronic
1121680850 14:95791662-95791684 CACACTGAGGAGAGGGGAGTGGG - Intergenic
1121729080 14:96173864-96173886 CTCTGTGAGGAGAGGGCAGGTGG + Intergenic
1121854440 14:97253944-97253966 CCTGGGGAGGAGAGGAGAGTTGG + Intergenic
1123138353 14:106051154-106051176 CAATGTGAGGACATGAGATTTGG + Intergenic
1123932382 15:25178103-25178125 CACCTTGAGGAAAGGAGGGTGGG + Intergenic
1125477827 15:40059539-40059561 AACTGTAGGGAGGGGAGAGTGGG + Intergenic
1127525603 15:59789878-59789900 AACTGTGAGGACATGAGATTTGG + Intergenic
1127620020 15:60724894-60724916 CAGTGTGAGGAGCGGGGAGGAGG - Intronic
1127725804 15:61748470-61748492 CACTCTGAGGATAGGTGAGTAGG + Intergenic
1127866973 15:63041468-63041490 CAGTGGGAGGGGAGGAGAGGGGG - Intergenic
1128256260 15:66199334-66199356 GACTGGGAGGAGAGGAGGGTGGG - Intronic
1128767593 15:70260664-70260686 CACTGTGAGGGAAGGAGATTAGG + Intergenic
1129699592 15:77760014-77760036 CACTGTGAGAGGCGGTGAGTGGG - Intronic
1130662999 15:85845351-85845373 CACTGTGAGGGAAGGTGAGATGG + Intergenic
1131253640 15:90847016-90847038 CACTCTGATGAGAGGAGAATGGG - Intergenic
1133027631 16:2995598-2995620 GACTATGGGGAGAGGAGGGTGGG - Intergenic
1133686201 16:8167709-8167731 TACTGTGAGGAGGGGGCAGTGGG + Intergenic
1133778247 16:8915024-8915046 TCCTGTGAGGAGAGGGGAGGTGG + Intronic
1136924763 16:34361917-34361939 CACTGTGCTGATAGAAGAGTTGG - Intergenic
1136979810 16:35049889-35049911 CACTGTGCTGATAGAAGAGTTGG + Intergenic
1137588535 16:49679394-49679416 GCCTGTGAGGACAGGAGAGGGGG - Intronic
1138152244 16:54669583-54669605 CACTGTGCGGAGAAGAGACTGGG - Intergenic
1138458522 16:57134560-57134582 CACTATGAGGAGAGGGTGGTTGG + Intronic
1139276707 16:65734576-65734598 CACAGGGAGTAGAGGACAGTAGG - Intergenic
1139677060 16:68530801-68530823 CCCTGGGAGGAGAGGCGGGTGGG + Intronic
1139994060 16:70963439-70963461 CCTTATGAGGAGAGGAGATTAGG + Intronic
1141501929 16:84450443-84450465 CACGGAGAGGGAAGGAGAGTTGG + Intronic
1141541356 16:84725199-84725221 GGCTGGGAGGAGAGGAGAATGGG - Intronic
1141774685 16:86115369-86115391 CAAGGTGAGGAGGGGAGAGCAGG + Intergenic
1141946709 16:87315704-87315726 CCCTGTGGGGTGAGGAGAGCAGG - Intronic
1143003888 17:3814264-3814286 CAGTGAGAGCAGAGGACAGTGGG - Intronic
1143021921 17:3921389-3921411 CACTGTGAGGACTGGAGCGTGGG + Intergenic
1143277002 17:5719296-5719318 CACTGTGGGGAGGGCAGAGGTGG + Intergenic
1143447052 17:7015753-7015775 CACTGTCAGAAGGGGAGAGGGGG - Exonic
1143901247 17:10176365-10176387 CGCTGTGCAGGGAGGAGAGTGGG - Intronic
1144212452 17:13026852-13026874 CGCTGTGTGGAGAGGAGGGGGGG + Intergenic
1144713213 17:17416527-17416549 CTCTGTGGGGAGATGGGAGTGGG + Intergenic
1144825613 17:18104112-18104134 CACTGTGAGGGGAGGTCAGGAGG - Intronic
1145965409 17:28913281-28913303 CAATGGAAGGAGAGGAGAGGGGG + Intronic
1146167312 17:30600395-30600417 GACTGGGAGGAGACGGGAGTTGG - Intergenic
1146649787 17:34599497-34599519 CAGTGGGTGGAGGGGAGAGTAGG + Intronic
1146813641 17:35924572-35924594 CACTGGGAGTGGAGGAGGGTAGG - Intronic
1147378315 17:40036125-40036147 GGCTGTGAGGACAGAAGAGTAGG + Exonic
1148850155 17:50550687-50550709 GACTGTGGGGAGGGGAGAGTTGG - Exonic
1148975845 17:51527667-51527689 TGCTGTGGGGAGAGGAGAGGAGG - Intergenic
1149386225 17:56145716-56145738 AAATGTGAGGACAGGAGATTTGG - Intronic
1149409267 17:56388031-56388053 GACTATGAGAAGAAGAGAGTAGG - Intronic
1149466602 17:56884700-56884722 CACAGTGAGGAGTGGCGGGTCGG + Intergenic
1151138135 17:71967159-71967181 CAGAGGGAGCAGAGGAGAGTGGG + Intergenic
1151487681 17:74411621-74411643 CACTGTGATGACAGCAGCGTGGG - Intergenic
1152802858 17:82339962-82339984 CACTGGGGGGAGAGGACACTGGG - Intergenic
1153124764 18:1777763-1777785 CACTCTGAGGAGAGAATACTGGG + Intergenic
1153519947 18:5942113-5942135 AACTGAGAGGAGAGGGGAGAAGG + Intergenic
1154035818 18:10800651-10800673 CACTCTGTGGAGACTAGAGTTGG - Intronic
1154055540 18:11009805-11009827 CCTTGTAAGAAGAGGAGAGTAGG + Intronic
1154079745 18:11244181-11244203 CTCTGGGAGGAGAGGAGGCTGGG + Intergenic
1155072144 18:22325801-22325823 AACTGAGAGAAGAGGAGAGAGGG + Intergenic
1155171739 18:23271729-23271751 ACCTCTGGGGAGAGGAGAGTGGG + Intronic
1155997193 18:32342570-32342592 CACTGTGAGCTGAGGTGTGTAGG - Intronic
1156487880 18:37478106-37478128 CAGGGAGAGGAGAGGAGAGGGGG - Intronic
1156941091 18:42767634-42767656 CAATGTGAGGACATGAGATTTGG + Intronic
1157402008 18:47396475-47396497 CACTATGAGGGGAGGGAAGTAGG + Intergenic
1158419642 18:57281606-57281628 CAGTGTTGGGAGAGGAGTGTTGG - Intergenic
1158487737 18:57882742-57882764 GACTGGGAGGAGAGGAGAATGGG - Intergenic
1159383275 18:67690348-67690370 TATTATAAGGAGAGGAGAGTGGG + Intergenic
1160098425 18:75897830-75897852 AACTGTGAGTGAAGGAGAGTTGG - Intergenic
1160695977 19:484737-484759 CAGGGTGAGGAGGGGAGAGCAGG + Intergenic
1160872261 19:1282710-1282732 GAGTGTGAAGAGAGGAGAATGGG + Intergenic
1160986183 19:1839998-1840020 CACTGTGAGAGGAGGAGGGAGGG + Intronic
1161300023 19:3538025-3538047 CAGAGTGAGGAGAGGAGGGCAGG + Intronic
1161439926 19:4285149-4285171 CACAGCCAGGAGAGGAGAGCAGG - Intronic
1161493727 19:4576328-4576350 CAGAGTGTGGAGGGGAGAGTGGG - Intergenic
1161719750 19:5896227-5896249 CAGAGTGAGGAGGGGAGGGTGGG + Intronic
1162110517 19:8397410-8397432 GACTGTGAGGAGAGGAGTCGGGG + Intronic
1162549696 19:11351613-11351635 GACTGAGAGGACAGGAGACTGGG + Intronic
1162592666 19:11602857-11602879 CACTGTGAGGAGAGGAGAGTGGG + Intronic
1162704518 19:12545321-12545343 CATCATGAGGAGAGGAGAGTAGG - Intronic
1162705600 19:12552596-12552618 CACTGTGAGGAGAGGACTGGAGG - Intronic
1162850997 19:13431026-13431048 GAGTGAGTGGAGAGGAGAGTGGG + Intronic
1163639981 19:18456657-18456679 GACAGTGATGAGAGGAGATTTGG + Intronic
1163670153 19:18622874-18622896 CACTGGCAGGAGATGAGAGGAGG + Intergenic
1163842352 19:19619017-19619039 AACTCTGAGGAGATGCGAGTGGG - Intergenic
1164759124 19:30715063-30715085 CAGAGTGGCGAGAGGAGAGTTGG + Intergenic
1164821838 19:31256746-31256768 CACTGTGAGGACAGGCGGGCAGG - Intergenic
1166140606 19:40803246-40803268 CAGTTTGGGGAGGGGAGAGTAGG + Intronic
1166351493 19:42200648-42200670 CACTGTGCCAAGAGGAGAGAAGG + Intronic
1166422819 19:42652021-42652043 CAGTGTCAGGGGAGGAGAGAGGG - Intronic
1166704798 19:44902830-44902852 CACTGAGCGGAGAGCAGAGGAGG + Intronic
1166836885 19:45672830-45672852 CACTGTGGGGAAAGAAGAGAGGG - Exonic
1166893077 19:46006538-46006560 CTCTGTCAGGAGAGGAGAGGAGG - Exonic
1167713094 19:51124410-51124432 CACTGTGCGGAGGGGAGACATGG - Intergenic
1168363193 19:55760416-55760438 CACTGTTAGGAGAGAAGTGTGGG + Intronic
1168364142 19:55770417-55770439 CACTGTTAGGAGAGAAGTGTGGG + Intronic
925135757 2:1524259-1524281 CACTGTGAGGAGATTTGAGGAGG - Intronic
925749884 2:7078529-7078551 CCCAGGGAGGGGAGGAGAGTAGG - Intergenic
925897340 2:8482811-8482833 GACTGTGAGGAGAGTGGAGAGGG + Intergenic
926342300 2:11913770-11913792 CCCTGTGAGAAGAGAAGATTAGG - Intergenic
927521839 2:23703698-23703720 GTCTGTGAGGAGAGCAGAGCAGG - Exonic
927955985 2:27207640-27207662 CACAGTGAGGATATGAGTGTAGG - Exonic
928129971 2:28642337-28642359 CACTGAGAGGAGAGTGGAGAGGG + Intronic
928379383 2:30804519-30804541 CTCTCTGAGGAGGGAAGAGTAGG + Intronic
930005359 2:46892200-46892222 AACTGTGAGAAGAGCAGAGAGGG + Intergenic
930587767 2:53289546-53289568 CACTATTAGGAGATGAGAGGGGG + Intergenic
931714109 2:65015165-65015187 AACTGTGAGGAGGGGAAAGTAGG + Intronic
931743126 2:65266688-65266710 CACTGAGAGGAGGGGAGGGATGG + Intronic
932449165 2:71798703-71798725 CACTGCAGGGAGAGGACAGTGGG - Intergenic
932693059 2:73929815-73929837 GAATGGGAGGTGAGGAGAGTGGG + Intronic
933027007 2:77272093-77272115 CACTGAGAAGAAAGGAGAGATGG - Intronic
933578007 2:84092134-84092156 AAATGTGAGGAGATGAGATTTGG - Intergenic
934049643 2:88199523-88199545 GACTGTGGGGAGGGGAGAATGGG + Intergenic
935177806 2:100664588-100664610 GACAGTGAGGAGAGGAGCGGGGG + Intergenic
936562670 2:113555107-113555129 CACAGTGAGCAGAGGATATTGGG + Intergenic
936750988 2:115641345-115641367 GACTGTGAGGAGATGACACTGGG - Intronic
937470197 2:122168016-122168038 TCCTATGAGAAGAGGAGAGTGGG - Intergenic
937632332 2:124117046-124117068 CTCTGTTAGGAGAGGAGGATAGG - Intronic
937924947 2:127160867-127160889 CAGTCTGAGGACAGGAGAGGAGG - Intergenic
938320445 2:130359055-130359077 CTCTGGGAGGAGAGCACAGTGGG - Intronic
938595800 2:132785969-132785991 CCCAGTGGGGAGAGGAGAATTGG + Intronic
939270668 2:139935349-139935371 GTCTGTGAGGAGAGGAAAGAGGG - Intergenic
940621836 2:156122401-156122423 AAATGTGAGGAGATGAGACTGGG + Intergenic
940655967 2:156488293-156488315 CACTGTGAGGAGATGCTTGTTGG + Intronic
940897060 2:159090820-159090842 CACGGAGAGGAGAGGAAACTAGG + Intronic
941630931 2:167883433-167883455 CCATGCGAGGAGAGCAGAGTAGG - Intergenic
942193316 2:173492957-173492979 GACTATGGGGAGAGGAGAATGGG - Intergenic
942471668 2:176267329-176267351 CACTGTGAGGAGAACAGACAGGG + Intergenic
942502945 2:176611134-176611156 CCCTGGGAGGTGAGGTGAGTAGG + Intergenic
942567732 2:177283153-177283175 CAGGGTGAGGAAAGGGGAGTAGG + Intronic
943623841 2:190178400-190178422 CACAGAGAGGAGAGCAGAGAGGG + Intronic
944272100 2:197795696-197795718 AACTGTGAGGACATGAGATTTGG - Intergenic
946716606 2:222559821-222559843 CACTGTGAAGAGATGAAAGGTGG + Exonic
947373704 2:229474273-229474295 CACTGTAAGGATAGGCCAGTGGG + Intronic
948231955 2:236355278-236355300 CACTGTGGGGCGGGGAGAGTGGG + Intronic
948744139 2:240073757-240073779 CACTCTGAGGAGGGGCGAGGAGG - Intergenic
1169606527 20:7326410-7326432 CTTTGTGAGGACAGGAAAGTAGG - Intergenic
1169693030 20:8354655-8354677 CCCTCTGAGCGGAGGAGAGTTGG + Intronic
1169768835 20:9179267-9179289 AACAGTGAGGAGAAGAGAGAGGG + Intronic
1170021656 20:11843176-11843198 CACTGTTTGGAGAGGACATTGGG - Intergenic
1171095164 20:22325911-22325933 AACTGGGTGGAGAGTAGAGTGGG - Intergenic
1172461227 20:35120420-35120442 GCCTGTGAGGAGAGGGGAGGAGG - Intronic
1172509387 20:35489790-35489812 AACTCTGAGTAGAGGAGAGCAGG + Intronic
1173326572 20:42038866-42038888 TACTGGGTGGAGAGGAGAGAGGG + Intergenic
1173859566 20:46273947-46273969 CACTGGGAGGAGGGAAGAGCAGG + Intronic
1173970561 20:47148989-47149011 CCCTGTGAGAAGAAGAGATTGGG + Intronic
1174177648 20:48655281-48655303 TGCTGTGGGGAGAGGTGAGTGGG - Exonic
1174271834 20:49374991-49375013 ATCTGTGAGGAGAAGAGAGTGGG + Exonic
1175243484 20:57567045-57567067 CACTGGGAGTAGAGGAGAGCAGG - Exonic
1175404523 20:58717687-58717709 CACTGTGAGAACAGGTGAGCAGG + Intronic
1177051463 21:16240022-16240044 GCCTGGGAGGAGAGGAGAATTGG + Intergenic
1177448388 21:21230573-21230595 CATCGTGATGAGATGAGAGTGGG - Intronic
1177736008 21:25091187-25091209 CACTGTGATGAGAAGAGCATGGG - Intergenic
1177865652 21:26509887-26509909 CTCTGGAAGGAGAGGAGACTTGG + Intronic
1178013809 21:28318598-28318620 AAATGTGAGGACAGGAGATTTGG + Intergenic
1178743633 21:35226618-35226640 CTCTGAGAGGTGAGCAGAGTGGG - Intronic
1179090276 21:38258801-38258823 AAGTGTGAGGAGAGGAAATTGGG - Intronic
1179420917 21:41236229-41236251 CACTGTGGAGAGAGGACAGCAGG - Intronic
1179511606 21:41877451-41877473 CACTGTGAGGGGAGCTGAGCAGG + Intronic
1179570905 21:42278507-42278529 CCCTGTAAGAAGAGGAGAGGAGG + Intronic
1179658468 21:42860109-42860131 CACTGTGATGAAAGGAGCCTTGG + Intronic
1180046434 21:45308416-45308438 CACTGTGCGAGGACGAGAGTAGG - Intergenic
1180741625 22:18057112-18057134 CTCTGTCAGGTGAGGAGAATGGG + Intergenic
1181324418 22:22033741-22033763 CACAGTGAGGAGAGCTCAGTTGG + Intergenic
1181692782 22:24574439-24574461 TACTGTGAGGCAAGGAAAGTGGG - Intronic
1181740157 22:24914542-24914564 CACTGGGAGGACAGGAGTGATGG - Intronic
1182102751 22:27669596-27669618 CACTGTGAGGAGGGGCCAGGGGG + Intergenic
1182471001 22:30548208-30548230 CAGTGGGAGGAGACAAGAGTAGG - Intergenic
1182548475 22:31088961-31088983 CAGTGTGAGGTAAGGAGGGTGGG + Exonic
1182557253 22:31135935-31135957 AGCTGTAAGGAGAGAAGAGTGGG + Exonic
1183696994 22:39429089-39429111 CACAGGCAGGGGAGGAGAGTGGG - Intronic
1184133730 22:42533707-42533729 CCATGTGAGGAGACGAGAGATGG - Intergenic
1184713106 22:46264572-46264594 AAATGTGAGGAGATGAGATTTGG - Intergenic
1184732724 22:46379711-46379733 CACAGTGAGGAGCCGTGAGTGGG - Intronic
949271423 3:2222382-2222404 GGCTGGGAGGAGAGGAGAGTAGG + Intronic
949816785 3:8067613-8067635 GACTTTGAGGAGTGGAGAGAAGG - Intergenic
950198688 3:11027898-11027920 GACTGTGTGGTGAGCAGAGTGGG - Intronic
950199908 3:11035507-11035529 CACGGGGAGAAGTGGAGAGTCGG + Intronic
950285574 3:11742218-11742240 CAGTGGGAGGGGAGGGGAGTGGG - Intergenic
950419775 3:12892040-12892062 CACTGTTAGCAGGTGAGAGTCGG - Intergenic
951210442 3:19968860-19968882 TAGTGTGAGGGCAGGAGAGTAGG - Intronic
951509385 3:23484834-23484856 CACTGTCAGGAGAACAGAATGGG + Intronic
952364536 3:32663462-32663484 GACTGTGGGGAGAGGCGAGAGGG - Intergenic
952397198 3:32931252-32931274 AAATGTGAGGAGATGAGATTTGG + Intergenic
952726814 3:36595210-36595232 CTCTGTGGGCAGAGTAGAGTGGG - Intergenic
953215275 3:40912493-40912515 CACTGTGAGGTGGGAACAGTAGG + Intergenic
955199012 3:56832760-56832782 CACTGAGGGGAGGGGAGATTTGG - Intronic
955964810 3:64378313-64378335 CAAGGTGAGGAGAGGAGAGGAGG + Intronic
956025274 3:64976788-64976810 CACTGTTAGAAGAGGATTGTGGG + Intergenic
956149325 3:66224615-66224637 AAATGTGAGGATAGGAGATTTGG - Intronic
956487686 3:69739759-69739781 CACTCTGGGGCGAGGAGAGCGGG + Intronic
956551297 3:70462350-70462372 AAATGTGAGGAGATGAGATTTGG + Intergenic
956732602 3:72210459-72210481 CACTTTGGGGTGAGAAGAGTTGG + Intergenic
957134736 3:76271749-76271771 GTTTGTGAGGAGAGGAGAGAAGG - Intronic
957929859 3:86863719-86863741 CAATGTGAGGACAAGAGATTTGG + Intergenic
957981832 3:87520314-87520336 AAATGTGAGGACATGAGAGTTGG + Intergenic
958156566 3:89762476-89762498 CACTGAGAGGAGAAGATACTGGG - Intergenic
959250580 3:103938062-103938084 CCTTGTAAGGAGAGGAGATTAGG + Intergenic
959908915 3:111740917-111740939 AACAGTGGGGAGAGGAGAGGGGG + Intronic
960440564 3:117682268-117682290 CACTAGGAGTAGAGGAGAGTGGG + Intergenic
960493995 3:118353629-118353651 CACTGTGGGGAAAGAAGAATGGG + Intergenic
961137971 3:124529682-124529704 AACTGTGTTGAGAGAAGAGTTGG - Intronic
961185443 3:124910962-124910984 CAGAGTTAGGAGAGGAGAATGGG - Intronic
961257900 3:125572407-125572429 AAATGTGAGGAGATGAGATTTGG + Intronic
961445295 3:126977829-126977851 CACTGGGTGGAGAGGACATTGGG - Intergenic
961445419 3:126978770-126978792 CACAGTGTGGAGAGCAGAGTTGG + Intergenic
962353135 3:134670425-134670447 CAGTGTGAAGAGAACAGAGTGGG + Intronic
962468037 3:135678709-135678731 CCCTGTGAGAAGGGGAGAGCCGG - Intergenic
962731911 3:138291408-138291430 GACTCAGAGGAGAGGAGACTGGG - Intronic
963383164 3:144557512-144557534 CACTGTGAATAGAAGAAAGTGGG - Intergenic
964423749 3:156531388-156531410 CGCTGGGAGGAGAGGACACTGGG - Exonic
965012039 3:163106798-163106820 AAATGTGAGGAGATGAGATTTGG - Intergenic
965089398 3:164143713-164143735 ATCTGTGAGGAGAGAAGAGAGGG - Intergenic
966731833 3:183158115-183158137 CACAGGGAGAAGAGGAGAGTGGG - Intronic
966775869 3:183542139-183542161 CAGTGAGAGGAGATGAGGGTTGG - Intronic
967932464 3:194700297-194700319 CACTGTGAGCTGCAGAGAGTGGG + Intergenic
967936245 3:194730132-194730154 GTGTGTGTGGAGAGGAGAGTAGG + Intergenic
968058648 3:195712093-195712115 CCCAGTGATGAGAGGAGAGACGG + Intergenic
968727895 4:2256708-2256730 CTCTGGGAGGAGAGGACAGAGGG + Intronic
968819411 4:2838237-2838259 CACTGTGAGGGGAGGGCACTTGG - Exonic
968833010 4:2942901-2942923 CACGGGGAGGGGTGGAGAGTGGG + Intronic
969169302 4:5347092-5347114 CAATGTGAGGACATGAGATTTGG + Intronic
969188961 4:5501718-5501740 CACTGTCAGGACAGGAGGATGGG - Intergenic
970150125 4:13080914-13080936 AACTGTGAGGAGAAAAGAGAAGG - Intergenic
970433547 4:16011222-16011244 CAAGGTGAGGAGAGGCTAGTGGG - Intronic
970450764 4:16164956-16164978 AAGAGGGAGGAGAGGAGAGTTGG - Intronic
970484010 4:16506359-16506381 CACCGTTAGGAAATGAGAGTTGG - Intronic
971212197 4:24629611-24629633 CAATGTCAGGAGAGGTGTGTAGG - Intergenic
971486442 4:27165365-27165387 CACTCTGAGGCCATGAGAGTTGG - Intergenic
972177042 4:36420445-36420467 CCCTGTCAGGGGAGGCGAGTGGG - Intergenic
972214819 4:36884536-36884558 TACTTTGGGGAGAGGAGAGATGG + Intergenic
972316599 4:37932695-37932717 CTCTGTGAGGAGAGGAGCACTGG - Intronic
972775663 4:42237668-42237690 CACTGGGAGGAGTGCAGAGCAGG - Intergenic
972955293 4:44382143-44382165 CAATGTGGAGAGTGGAGAGTGGG - Intronic
973726859 4:53785742-53785764 CTCTGTCAGGAGAGGAGAGATGG - Intronic
975514621 4:75232824-75232846 AGCTGTGAGGAGAGGAGAGACGG + Intergenic
975919757 4:79371118-79371140 TTCTGTAATGAGAGGAGAGTTGG + Intergenic
976004743 4:80416384-80416406 ACCTTTGAGGAGAGGACAGTAGG - Intronic
978059344 4:104317078-104317100 GACTGAGAAGTGAGGAGAGTGGG - Intergenic
978627670 4:110705477-110705499 CACTATGAGGAGAACAGTGTTGG - Intergenic
979177235 4:117679816-117679838 AAATGTGAGGAGATGAGATTTGG + Intergenic
979447530 4:120832320-120832342 CACTGTCATGAGAACAGAGTAGG + Intronic
979464540 4:121021614-121021636 AAATGTGAGGACAGGAGATTTGG - Intergenic
980153599 4:129079181-129079203 CAGTGTGAGGATATGAGATTTGG - Intronic
980750324 4:137078735-137078757 CTCTGGGAAGAGAGGGGAGTAGG - Intergenic
981891885 4:149747930-149747952 CACTGTGATGAGAGCAAACTTGG + Intergenic
982832833 4:160085683-160085705 AAATGTGAGGACAGGAGATTTGG - Intergenic
983766455 4:171490134-171490156 AACTGTGAGGACATGAGATTTGG + Intergenic
983802701 4:171954784-171954806 CACTGTCAAGAGAGAAGAGAGGG - Intronic
984049040 4:174841293-174841315 CACAGTGAGGCGAGGTGAGAAGG - Intronic
984706540 4:182851266-182851288 CACTCTGAGGAGTGGAGGGGGGG - Intergenic
984741894 4:183173052-183173074 CCCTGTGGGGTGAGGAGAGGAGG - Intronic
984884767 4:184440466-184440488 CACTGTGTGGGAAGGAGAATGGG - Intronic
985226100 4:187763479-187763501 CCCTCTGAGGATAGGTGAGTAGG + Intergenic
985913439 5:2900464-2900486 AGCTGGGAAGAGAGGAGAGTGGG - Intergenic
986419847 5:7568721-7568743 CACTGTGCTGTGAGGAGAGGTGG - Intronic
986492306 5:8306022-8306044 CACCCTGAAGAGAGGAGAGCCGG + Intergenic
988378885 5:30476450-30476472 AAATGTGAGGACAGGAGATTTGG - Intergenic
988616057 5:32776031-32776053 CACAGTGGGGAGAGGGGACTAGG - Intronic
990126044 5:52518720-52518742 AAATGTGAGGACATGAGAGTTGG + Intergenic
990980029 5:61593930-61593952 CACAGTCAGGAGCTGAGAGTAGG - Intergenic
991399256 5:66236261-66236283 CTCTGGGAGGGGAGAAGAGTTGG + Intergenic
992566973 5:78006536-78006558 CTCTTTAGGGAGAGGAGAGTAGG - Intronic
994166094 5:96609927-96609949 AAATGTGAGGAGATGAGATTTGG + Intronic
994546831 5:101177405-101177427 CAATGTGAGGACATGAGATTTGG + Intergenic
994553272 5:101262969-101262991 AAATGTGAGGACAGGAGATTTGG + Intergenic
995700040 5:114925158-114925180 CACTGAAAGGTGAGGAGAGTGGG - Intergenic
995870205 5:116736546-116736568 GACCCTGAGGAGAGGAGAGCTGG - Intergenic
996267897 5:121564368-121564390 CACTATCAGGAGAACAGAGTAGG - Intergenic
997002293 5:129776049-129776071 AAATGAGAGGAGAGGAGAGAAGG - Intergenic
998895350 5:146792970-146792992 TACTGTGTGGAGAAGAGATTTGG + Intronic
999610346 5:153362458-153362480 CCCAGTGAGTAGAGGGGAGTGGG + Intergenic
999683018 5:154077320-154077342 CACTGGGTGGAAAGGAGAGATGG - Intronic
1000862320 5:166470928-166470950 CTCTGTCTGGAGAGGAGGGTTGG + Intergenic
1001241911 5:170077713-170077735 GACTTTGACGACAGGAGAGTGGG + Exonic
1001325389 5:170720105-170720127 CACTGTGAGGTGGAGAGATTTGG - Intronic
1001617989 5:173057330-173057352 CACTGAGAGGGGAGGAGACAGGG + Intronic
1002075689 5:176707101-176707123 CACTGTCAGGAGAACAGGGTGGG + Intergenic
1002575601 5:180172180-180172202 CCCTGTGATGAGAGCACAGTGGG + Intronic
1003123906 6:3340056-3340078 CCCTGTGGGGAGAGGAGAGGAGG - Intronic
1003995312 6:11534850-11534872 AAATGTGAGGACATGAGAGTTGG + Intergenic
1004076758 6:12350905-12350927 CAATGTGAGAACAGGAGATTTGG - Intergenic
1004387744 6:15187154-15187176 CATTGGGAGGTGAGGTGAGTAGG + Intergenic
1005019342 6:21402529-21402551 CAGTGTGGGGAGAGCAGACTGGG + Intergenic
1005218750 6:23562137-23562159 AACTGTGGGGAGAAGAGAATGGG + Intergenic
1006021489 6:31120506-31120528 CACTGTGGGGAGAGGAGGAGAGG + Intronic
1006423528 6:33949939-33949961 CACTGGGAACAGTGGAGAGTTGG + Intergenic
1007731709 6:43951473-43951495 CACTGCAAGGACAGCAGAGTTGG - Intergenic
1010327858 6:74586536-74586558 CCTTGTTAGAAGAGGAGAGTAGG + Intergenic
1011908936 6:92410443-92410465 CTCTGGGAGCAGAGGGGAGTAGG - Intergenic
1012126062 6:95429144-95429166 AACTGTGAGGACAAGAGATTTGG + Intergenic
1012621679 6:101352439-101352461 CACTGAGAGGAAATGAGAGAGGG - Intergenic
1013304467 6:108835486-108835508 GACAGTGATGAGAGGAGAGGTGG - Intergenic
1013575878 6:111483228-111483250 CACTGGGGGGAGGGGAGAGGGGG + Exonic
1016790124 6:148059548-148059570 CAATGTGAGGACATGAGACTTGG - Intergenic
1016984199 6:149882235-149882257 GACTATGAGGAGGGGAGAGATGG + Intergenic
1017084528 6:150701600-150701622 CACTGTGGGGTGAGGGGAGGGGG - Intronic
1017590296 6:155972167-155972189 AACTGTGAGGAGAGAGGAGTGGG + Intergenic
1018172875 6:161155427-161155449 AACGGGGAGGAGAGGAGAGAGGG - Intronic
1018345912 6:162899289-162899311 CAGTGTGAAGACAGGAGAGCTGG + Intronic
1018672647 6:166192597-166192619 CACTGTGAGAAGAGGAGGAGCGG + Intergenic
1018737577 6:166699109-166699131 AACTAAGAGGAGAGGAGAGGCGG + Intronic
1020061469 7:5155741-5155763 CACTATCAGGAGAGCAGAATGGG + Intergenic
1020111816 7:5451878-5451900 CCCTGGGAGGAGGGGAGAGTGGG - Intronic
1020904910 7:14052816-14052838 CACTGGGAGGAGTGGACACTGGG - Intergenic
1020942914 7:14562887-14562909 AAATGTGAGGATAGGAGATTTGG + Intronic
1021232866 7:18106785-18106807 GAATGTGAGGAGAAGAGAGTGGG - Intronic
1021829688 7:24592385-24592407 CCCTGTAAGGAGAGGCAAGTGGG + Intronic
1022861231 7:34369185-34369207 AACTGTGAGAAGGGGTGAGTGGG - Intergenic
1023055331 7:36285843-36285865 CACTGTGAGTTGATGAGGGTGGG + Intronic
1023176519 7:37440791-37440813 AACTGTGGGGTGGGGAGAGTTGG + Intronic
1023593986 7:41809704-41809726 CATTGACAGGAGAGGAGAGGTGG + Intergenic
1024132170 7:46364258-46364280 CACTGTGATTAGAGGAAAGTGGG - Intergenic
1024308757 7:47949941-47949963 CAGTGTGAGAAGAGCAGAGGTGG - Intronic
1027256729 7:76435477-76435499 CACTGAGATGAGAGGTGAGGCGG + Intronic
1027374692 7:77537735-77537757 CTCTGTGAGGAGAGGGGCGGAGG + Intronic
1027540145 7:79454771-79454793 CTCTGTGAGCAAAGGAGTGTTGG - Intergenic
1027704467 7:81511125-81511147 AAATGTGAGGAGATGAGATTTGG + Intergenic
1028441966 7:90873882-90873904 CACTGGGAGGATGGGAGACTGGG - Intronic
1029222644 7:99002653-99002675 CACTGTGAGGAATGCAGAGGAGG + Intronic
1029996571 7:105013388-105013410 CAATGTGCGGGGAGGGGAGTGGG - Intergenic
1031070237 7:117154104-117154126 CACAGTGGGGAGAGGAGCTTTGG - Intronic
1031979589 7:128116078-128116100 GACTGTCAGGCGAGGAGAGTGGG + Intergenic
1032135933 7:129277688-129277710 CTCTTTGGGGAGAGGGGAGTGGG + Intronic
1034452443 7:151144193-151144215 GCCTGTGAGGAGAGGGGAGCAGG + Exonic
1034955546 7:155332127-155332149 CCTTATGAGGAGAGGAGATTAGG + Intergenic
1035370933 7:158378493-158378515 CACTGTGGGGAGAGGACAGGGGG - Intronic
1036122838 8:6036696-6036718 CATTGTGAGAAGAGGAGAGCGGG - Intergenic
1036452969 8:8884572-8884594 CACTGTGAGGGGGAGGGAGTTGG + Intronic
1037214047 8:16426628-16426650 CAATGTGAGGACATGAGATTTGG + Intronic
1037374155 8:18210231-18210253 AACTGTGAGTACAGGAGAGTAGG + Intronic
1037480226 8:19298241-19298263 CATTGTGATGAGAGGAAAGGAGG + Intergenic
1037798579 8:22017794-22017816 CACTGGGAGGAGAGGAAAACGGG + Intergenic
1038394241 8:27235367-27235389 CACAGTGTGCAGAGCAGAGTGGG + Exonic
1038762673 8:30399116-30399138 CACTTTGAAGTGAGGAGAGGAGG - Intronic
1040500713 8:48002611-48002633 AACTGAGAGGAGAGGAGAAGGGG + Intergenic
1042131825 8:65594771-65594793 CACTGTTAGGATAGGATTGTAGG - Intergenic
1042566765 8:70119196-70119218 GACTGTGAGGGCAGGAGAGGAGG - Intronic
1042839313 8:73107852-73107874 CCCTTAGAGGAGAGGAAAGTTGG - Intronic
1043426216 8:80150931-80150953 CAATGTGAGGACATGAGATTTGG + Intronic
1043446568 8:80325293-80325315 GACTGTAAGGAGGGGAGAGAAGG - Intergenic
1045180187 8:99772452-99772474 GGCTGTGGGGAGGGGAGAGTAGG + Intronic
1045455920 8:102378851-102378873 TACTGGGAGAAGATGAGAGTGGG - Intronic
1045505973 8:102779015-102779037 CCCTGGGAGGAGAGGGGAATGGG + Intergenic
1046774973 8:118154261-118154283 CAGTGTGATGAGAGGACAGATGG - Intergenic
1046776669 8:118171672-118171694 GACTGGGAGGAGAGGAGGCTTGG + Intergenic
1047151353 8:122267101-122267123 GACAGAGAGGAGAGGAGAATGGG + Intergenic
1047542707 8:125785694-125785716 CCCTGCGAGGAAAGGACAGTGGG - Intergenic
1047647881 8:126887827-126887849 CTCTGTGAGGAAAGGAGTCTAGG - Intergenic
1047756910 8:127926112-127926134 CACTCTGGGGAGAAGAGAGCCGG - Intergenic
1048001056 8:130379990-130380012 CACTGTCAGGGGTGGGGAGTAGG - Intronic
1048293240 8:133196159-133196181 CACTGTGCCCAGAGTAGAGTGGG - Intronic
1048660786 8:136598896-136598918 CACTATGATGAGAGCAGAGCAGG - Intergenic
1048724141 8:137362433-137362455 CTTTGTGAGGCTAGGAGAGTCGG + Intergenic
1048829984 8:138466414-138466436 GCCTGTGAGGAGACGAGAGCAGG + Intronic
1049890063 9:60590-60612 CACAGTGAGCAGAGGATATTGGG - Intergenic
1050017990 9:1255776-1255798 CATTTTGAGGAGATGAGTGTGGG + Intergenic
1051432536 9:16994704-16994726 CACTCTAAGGAGAAGAGATTGGG - Intergenic
1053000713 9:34575923-34575945 CACTGTGAGGAGGGGAGGAAAGG - Intronic
1053022633 9:34706274-34706296 CAGTGACAGGAGAGGAGAGTTGG + Intergenic
1053131042 9:35615915-35615937 CGCTCTGGGGAGAGGAGAGAAGG - Intronic
1053602540 9:39624953-39624975 CACTGAGAGGTGAGGCCAGTTGG - Intergenic
1053731540 9:41061866-41061888 CACAGTGAGCAGAGGATATTGGG - Intergenic
1054250998 9:62717482-62717504 CACTGAGAGGTGAGGCCAGTTGG + Intergenic
1054565105 9:66751995-66752017 CACTGAGAGGTGAGGCCAGTTGG + Intergenic
1054696971 9:68370229-68370251 CACAGTGAGCAGAGGATATTGGG + Intronic
1056105294 9:83341266-83341288 CACTGTGGAGAAAGTAGAGTGGG - Intronic
1056235566 9:84590436-84590458 AACTGTGAGAAGATGAGAGCTGG - Intergenic
1056419259 9:86407856-86407878 AACTGGGAGGAGATGAGAATGGG - Intergenic
1057183183 9:93040667-93040689 CAGTGTGAGGAGAGCAGGGTAGG - Intergenic
1058054063 9:100432056-100432078 GACTGTGAGGATGGGAAAGTGGG + Intronic
1058095038 9:100850323-100850345 CACTGGGAGGTGTGGAGGGTGGG + Intergenic
1059408055 9:114114163-114114185 CACTATCAGGAGAAGAGTGTGGG - Intergenic
1060538168 9:124408946-124408968 CACTGTTAGGTGAGAAGACTAGG + Intronic
1060818424 9:126647971-126647993 CAGGGTCAGGAGAGCAGAGTGGG - Intronic
1061007242 9:127935166-127935188 CTCCGTGAGGAGAGGTCAGTCGG + Exonic
1061027981 9:128062921-128062943 CACAGTGAGGAGAAAAGGGTGGG + Exonic
1061637988 9:131927551-131927573 CACTCTTAGGAGAGGAGATGGGG - Intronic
1061642626 9:131971255-131971277 CACTGTGAAGAGAGCACAGCTGG + Intronic
1061886862 9:133595590-133595612 CACTTAGAGGTCAGGAGAGTAGG - Intergenic
1062081914 9:134628629-134628651 CACTGGGAGAAGAGGAGGGCTGG - Intergenic
1062087482 9:134656244-134656266 AACTCTGAGCAGAGGAGGGTGGG + Intronic
1187226837 X:17381020-17381042 CAATGTGAGGAGAGAAGGGAGGG + Intronic
1187836651 X:23437989-23438011 CAATGTGAGGATATGAGATTTGG + Intergenic
1188071444 X:25723259-25723281 GAGGGAGAGGAGAGGAGAGTTGG - Intergenic
1188385612 X:29553766-29553788 CACTGTGAGAACAGGAGGGGTGG + Intronic
1188913985 X:35887591-35887613 CACTGTGTGGACAGCAGAGAGGG + Intergenic
1189015255 X:37090355-37090377 CACTTTGAAGTGAGGAGAGGAGG - Intergenic
1189655375 X:43239413-43239435 ACCTGTAAGGACAGGAGAGTTGG + Intergenic
1190862860 X:54359979-54360001 GACAGTGAGGAAAGGAGCGTGGG - Intergenic
1191929845 X:66359241-66359263 CAGTGTGAGGTGGGGGGAGTAGG + Intergenic
1194626217 X:96229459-96229481 CACTGCCAGGAGATGAGAGCAGG - Intergenic
1195803945 X:108742031-108742053 CCATGTGAGGAGTGGAGAGAGGG - Intergenic
1196764024 X:119226702-119226724 AACTGTGAGGGGAGCAGAATGGG - Intergenic
1197088568 X:122509595-122509617 AACTGTGAGGACATGAGATTTGG - Intergenic
1197199075 X:123733137-123733159 CGCTGGGTGGAGAGGAAAGTGGG - Intergenic
1197223365 X:123933767-123933789 AAATGTGAGGACATGAGAGTTGG + Intergenic
1197753932 X:129982341-129982363 CACTGGGAGGGGAGGAGAGGAGG - Intronic
1198013670 X:132586685-132586707 GGTTGTGAGGAGAGGAGAGAGGG + Intergenic
1198727094 X:139689614-139689636 CAGAGAGAGGAGAGCAGAGTAGG - Intronic
1198942078 X:141966775-141966797 AAATGTGAGGACATGAGAGTTGG + Intergenic
1198992464 X:142530697-142530719 CACTGTGAAATGAGCAGAGTGGG + Intergenic
1199326064 X:146499817-146499839 CACTGTCATGAGAGCAGTGTAGG - Intergenic
1199609376 X:149600019-149600041 CACTCTGGGGAAAGCAGAGTGGG - Intronic
1199629741 X:149769335-149769357 CACTCTGGGGAAAGCAGAGTGGG + Intergenic
1200734829 Y:6782919-6782941 CACTGGGAGGAGAGCAGAGGAGG + Intergenic
1200760912 Y:7038422-7038444 AAATGTGAGGAGAGTAGAGCTGG + Intronic
1200775179 Y:7164151-7164173 AACAGAGTGGAGAGGAGAGTGGG - Intergenic
1201426942 Y:13861864-13861886 CACTCTCAGAAGAGGAGAGGAGG + Intergenic
1201526304 Y:14938327-14938349 CACTGGGAGGAGAACAGTGTGGG + Intergenic
1202344580 Y:23908035-23908057 CACTGAGAGGGGAGGATAGGTGG + Intergenic
1202526188 Y:25762048-25762070 CACTGAGAGGGGAGGATAGGTGG - Intergenic