ID: 1162596527

View in Genome Browser
Species Human (GRCh38)
Location 19:11633762-11633784
Sequence CCCAGTAAAGACTCTGTAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162596527_1162596536 7 Left 1162596527 19:11633762-11633784 CCCCCTACAGAGTCTTTACTGGG No data
Right 1162596536 19:11633792-11633814 CCTAGTGGAGCTGTGAGAAGAGG 0: 1581
1: 2034
2: 1486
3: 837
4: 562
1162596527_1162596534 -8 Left 1162596527 19:11633762-11633784 CCCCCTACAGAGTCTTTACTGGG No data
Right 1162596534 19:11633777-11633799 TTACTGGGGGCACTGCCTAGTGG No data
1162596527_1162596537 8 Left 1162596527 19:11633762-11633784 CCCCCTACAGAGTCTTTACTGGG No data
Right 1162596537 19:11633793-11633815 CTAGTGGAGCTGTGAGAAGAGGG 0: 1665
1: 2050
2: 1368
3: 825
4: 701

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162596527 Original CRISPR CCCAGTAAAGACTCTGTAGG GGG (reversed) Intergenic
No off target data available for this crispr