ID: 1162598715

View in Genome Browser
Species Human (GRCh38)
Location 19:11650127-11650149
Sequence ATTGAGTAGCCTGAAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162598711_1162598715 6 Left 1162598711 19:11650098-11650120 CCTAAAGGAATCCTTTTCATTGT No data
Right 1162598715 19:11650127-11650149 ATTGAGTAGCCTGAAGAGGAGGG No data
1162598712_1162598715 -5 Left 1162598712 19:11650109-11650131 CCTTTTCATTGTTTTCACATTGA No data
Right 1162598715 19:11650127-11650149 ATTGAGTAGCCTGAAGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162598715 Original CRISPR ATTGAGTAGCCTGAAGAGGA GGG Intergenic
No off target data available for this crispr