ID: 1162604144

View in Genome Browser
Species Human (GRCh38)
Location 19:11694299-11694321
Sequence CTTGTTCAGGCCATCATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162604144_1162604149 11 Left 1162604144 19:11694299-11694321 CCTTCCATGATGGCCTGAACAAG No data
Right 1162604149 19:11694333-11694355 AATTTTGTAGTGCCTTCGCCGGG No data
1162604144_1162604151 17 Left 1162604144 19:11694299-11694321 CCTTCCATGATGGCCTGAACAAG No data
Right 1162604151 19:11694339-11694361 GTAGTGCCTTCGCCGGGAGGAGG No data
1162604144_1162604148 10 Left 1162604144 19:11694299-11694321 CCTTCCATGATGGCCTGAACAAG No data
Right 1162604148 19:11694332-11694354 TAATTTTGTAGTGCCTTCGCCGG No data
1162604144_1162604150 14 Left 1162604144 19:11694299-11694321 CCTTCCATGATGGCCTGAACAAG No data
Right 1162604150 19:11694336-11694358 TTTGTAGTGCCTTCGCCGGGAGG No data
1162604144_1162604152 18 Left 1162604144 19:11694299-11694321 CCTTCCATGATGGCCTGAACAAG No data
Right 1162604152 19:11694340-11694362 TAGTGCCTTCGCCGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162604144 Original CRISPR CTTGTTCAGGCCATCATGGA AGG (reversed) Intergenic
No off target data available for this crispr