ID: 1162609774

View in Genome Browser
Species Human (GRCh38)
Location 19:11739884-11739906
Sequence CTTCATAAACATATGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162609774_1162609780 19 Left 1162609774 19:11739884-11739906 CCTTTCTCCATATGTTTATGAAG No data
Right 1162609780 19:11739926-11739948 AGCGTTATGGCCGGGCGCGGTGG No data
1162609774_1162609778 11 Left 1162609774 19:11739884-11739906 CCTTTCTCCATATGTTTATGAAG No data
Right 1162609778 19:11739918-11739940 GACTTAAAAGCGTTATGGCCGGG No data
1162609774_1162609777 10 Left 1162609774 19:11739884-11739906 CCTTTCTCCATATGTTTATGAAG No data
Right 1162609777 19:11739917-11739939 AGACTTAAAAGCGTTATGGCCGG No data
1162609774_1162609776 6 Left 1162609774 19:11739884-11739906 CCTTTCTCCATATGTTTATGAAG No data
Right 1162609776 19:11739913-11739935 TACTAGACTTAAAAGCGTTATGG No data
1162609774_1162609779 16 Left 1162609774 19:11739884-11739906 CCTTTCTCCATATGTTTATGAAG No data
Right 1162609779 19:11739923-11739945 AAAAGCGTTATGGCCGGGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162609774 Original CRISPR CTTCATAAACATATGGAGAA AGG (reversed) Intergenic
No off target data available for this crispr