ID: 1162613564

View in Genome Browser
Species Human (GRCh38)
Location 19:11776494-11776516
Sequence ATGACAAAAAGGTCTGTTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 217}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162613564 Original CRISPR ATGACAAAAAGGTCTGTTTA GGG Intronic
900918330 1:5653815-5653837 AAAACAGAAAGTTCTGTTTATGG - Intergenic
902578751 1:17395097-17395119 AGGGCAAAAAGGTCTGCTTTGGG + Exonic
906414010 1:45605396-45605418 ATCAGAATAAGTTCTGTTTAGGG + Intronic
910127840 1:83863353-83863375 AAAACAAAAAGGCCTGTTTGTGG - Intergenic
910535619 1:88294303-88294325 CTGACAAAAAAGTATGATTATGG + Intergenic
911813570 1:102313676-102313698 ATGAGCAAAAGGTCAGTTTTAGG - Intergenic
912840821 1:113037631-113037653 ATGCCAAAAAGGCATGTTTTGGG - Intergenic
915210775 1:154307508-154307530 AGGACAACAATGTTTGTTTATGG - Intergenic
916515830 1:165515625-165515647 ATGCCAAAAAGGTCTATTTTTGG - Intergenic
916888965 1:169097993-169098015 AAAAAAAAAAGGTCAGTTTAGGG + Intergenic
917269148 1:173254474-173254496 AGGATAAAATGGTCTGTTTTGGG + Intergenic
917579929 1:176365781-176365803 ATGACAACAAGGTCTTATTGAGG - Intergenic
918397121 1:184124567-184124589 ATGTCAAAAAGGTCTGCATATGG + Intergenic
918990924 1:191696247-191696269 CAGACAAGAAGGTTTGTTTAGGG - Intergenic
920813795 1:209311782-209311804 ATTTCAAAAAGATCTGTCTAGGG - Intergenic
920966884 1:210708497-210708519 ATGACTATAAAATCTGTTTACGG - Intronic
921492598 1:215796872-215796894 AAGAGAAGAAGGTCTGTTGAAGG - Intronic
921506768 1:215981080-215981102 CTGACAATAAGGTCTTTTTGAGG - Intronic
921889453 1:220339241-220339263 ATGCCAAAAAGGCCTATTTTGGG + Intergenic
922893244 1:229077986-229078008 TTGACAAAAAGGTGTGTGTGTGG + Intergenic
923032419 1:230260047-230260069 ATGACAAAATTGACAGTTTAAGG - Intronic
1067917997 10:50421522-50421544 ATGTCTGAACGGTCTGTTTAAGG - Intronic
1068087013 10:52386701-52386723 ATGATGAAAAGGTTTGTTTTTGG - Intergenic
1069312804 10:67060013-67060035 ATGATAAAAATGTCTTTTTTAGG + Intronic
1071554253 10:86590264-86590286 ATGTTAAAAACGTCTCTTTATGG + Intergenic
1073575694 10:104621039-104621061 ATAACAAAAGTGTCTGTTTGTGG - Intergenic
1073738233 10:106375317-106375339 ATGACAAAATGGTATTTTTTAGG + Intergenic
1074584733 10:114756435-114756457 ATGGCAACAAGGTCTGTTTTAGG - Intergenic
1078883823 11:15480012-15480034 ATCACCAAAAGTTCTGTTTTAGG - Intergenic
1079940886 11:26678917-26678939 ATGACAAAAAGTTATGATTTAGG - Intronic
1085327184 11:75615540-75615562 CTGACAACAAGGTCTGTGGAGGG - Intronic
1089206008 11:116763226-116763248 GTGACGAAAATGTCTGTTTGAGG + Exonic
1090738646 11:129635636-129635658 ATGACAAAATTGTCCATTTAGGG - Intergenic
1092766538 12:11858115-11858137 ATCATAAAAAGCTCAGTTTAAGG + Intronic
1096304111 12:50459353-50459375 ATGCCTAAAAAGGCTGTTTAGGG - Intronic
1096410942 12:51376820-51376842 ATGGCAAAAAGGGCTGGTTGGGG + Intronic
1097564935 12:61255130-61255152 TTGATAAAAAGTTATGTTTAAGG - Intergenic
1098895241 12:76052211-76052233 ATGACAAAACAGTCTAGTTAAGG - Intronic
1100769640 12:97907673-97907695 ATGAAAAAAAGGGCTGTCAAAGG + Intergenic
1101509081 12:105376487-105376509 ATGCCCAAAAGGTCTGTGTCTGG - Intronic
1106010891 13:25821289-25821311 ATGTCAACAAGGTCAGTTCATGG + Intronic
1107219529 13:37965642-37965664 TTGAGAAAAAGGTATGCTTATGG - Intergenic
1108700475 13:52939783-52939805 ATCTCAAAAGGGTCTGTTTTTGG - Intergenic
1108978867 13:56484159-56484181 ATGATTATAAGGTCTGTCTAAGG - Intergenic
1109053374 13:57513447-57513469 ATGACATAATGGACTTTTTATGG - Intergenic
1109988408 13:70020175-70020197 TGGACAAAAAGATCTATTTAAGG + Intronic
1110174399 13:72538541-72538563 AAGACAAAAAGGACTGCTTTGGG - Intergenic
1111069136 13:83140530-83140552 ATAACAAAAGGGTCTATGTAAGG + Intergenic
1111200134 13:84926044-84926066 AAGACAAAAAGGTTAGTTGATGG + Intergenic
1111705043 13:91738291-91738313 ATGACAAAAAGTTATATTTTGGG + Intronic
1111817427 13:93170986-93171008 ATGACAAATAAGTCACTTTATGG + Intergenic
1111893311 13:94109901-94109923 ATGACACTAAGGTCTGTTGATGG - Intronic
1111971176 13:94918434-94918456 TTGACCAAAAGCTCTGTATAAGG + Intergenic
1115380734 14:32735904-32735926 TTGATAAAAAGCTCTTTTTATGG + Intronic
1115699289 14:35934205-35934227 ATGACAACAACGTCTGGTTTTGG - Intergenic
1118244918 14:64100795-64100817 ATTACAAAAATGTCTGTCAAAGG - Intronic
1119049380 14:71351246-71351268 ATGCCTAAAAAGTCTCTTTAGGG + Intronic
1120732178 14:88016119-88016141 CTGACAAAATGGACTCTTTATGG + Intergenic
1120749547 14:88185434-88185456 TGGACTAAAAAGTCTGTTTAAGG + Exonic
1122468941 14:101952897-101952919 ATGACAAAAATGTCTGGAAATGG + Intergenic
1122502364 14:102209291-102209313 AGGACACACAGCTCTGTTTATGG + Exonic
1124435683 15:29647182-29647204 ATGAGCAAAAGCTCTGTTAATGG + Intergenic
1125002744 15:34788182-34788204 AAGACAAAAATGTTTGCTTAAGG - Exonic
1125248156 15:37666348-37666370 ATGACAAAAAGCTCTTATCAAGG + Intergenic
1125347053 15:38728898-38728920 ATGACTAAAAGGACTTTATAGGG - Intergenic
1126194253 15:45913754-45913776 ATGACAAATAGGGCTTATTAAGG - Intergenic
1126817973 15:52472377-52472399 ATGAAAAAAATGTCTGGATAGGG - Intronic
1129872004 15:78946406-78946428 AAGACTAAAATGTCTGTTGAGGG - Intronic
1130351206 15:83093376-83093398 ATGACAAACAGTCCTGCTTAGGG - Intergenic
1132246870 15:100304022-100304044 ATGACATAAAGAGCTGATTAAGG - Intronic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1138003644 16:53309303-53309325 ATAATAAAAAGGGCTATTTAAGG - Intronic
1138986614 16:62336798-62336820 ATGAGAAATAGGTTTGTTTTTGG + Intergenic
1140842550 16:78853794-78853816 ATTACAACAAGGACTGCTTATGG - Intronic
1141670456 16:85489042-85489064 ATGACAGAAAGGTCTGCGGACGG - Intergenic
1144056798 17:11550488-11550510 TTGACAAAAAGGTCTATTATGGG + Intronic
1144596700 17:16575925-16575947 ATGATAAACAGGTCTGGTCAAGG - Intergenic
1145833721 17:27937918-27937940 GTGACAAAAAGATTTGTTAAGGG - Intergenic
1147703594 17:42411206-42411228 AAAACTAAAAGGTCTGTATATGG + Intronic
1149544859 17:57495932-57495954 ATGACATAAAGTTTTGTCTAGGG + Intronic
1151602141 17:75112838-75112860 ATGAAATGAGGGTCTGTTTAGGG - Intronic
1152047749 17:77949256-77949278 ATGACATCAAGATCTGGTTATGG - Intergenic
1153501504 18:5754747-5754769 ATGAGGAAAAGATCTGTTTCGGG + Intergenic
1155756516 18:29504379-29504401 ATGGCAAACAGGTATGTTAAAGG + Intergenic
1156041078 18:32823735-32823757 ATGCCAAAAAGGTCTCTTTCAGG - Intergenic
1156127831 18:33928719-33928741 AAAACAATAATGTCTGTTTAAGG + Intronic
1156299951 18:35827489-35827511 ATGACAAAAAGGCCTGTCTTGGG - Intergenic
1156664151 18:39385075-39385097 ATGAAAAAAATGTCTGTCAAAGG + Intergenic
1157634376 18:49135946-49135968 ATGACCAAAAGTTGTATTTATGG + Intronic
1157666714 18:49493424-49493446 AAGACAAAGAGTTCTGTTTAAGG - Intergenic
1158261159 18:55607369-55607391 ATGAGAAAAAGGTGTGTATAAGG + Intronic
1160616772 18:80136639-80136661 AGGCCCAACAGGTCTGTTTATGG - Exonic
1162276341 19:9658325-9658347 AAGAAAAAAAGTGCTGTTTAAGG - Intronic
1162613564 19:11776494-11776516 ATGACAAAAAGGTCTGTTTAGGG + Intronic
1164090250 19:21945014-21945036 ATGAGTAAAAGGTCAGTTTGAGG - Intronic
1164168780 19:22705277-22705299 ATGAGTAAAAGGTCACTTTAAGG + Intergenic
1164797591 19:31046517-31046539 ATGACAAAGTGGTCTGATGAAGG - Intergenic
1164988405 19:32666387-32666409 ATGACTGAAAGGTCTGTGAACGG + Intronic
1167812172 19:51842958-51842980 GTGAGAAAAAGTTCTGTTTCAGG + Intergenic
924963327 2:54564-54586 ATGAGAAAGAGGACTATTTATGG - Intergenic
926142564 2:10376783-10376805 ATGTAAAAATGTTCTGTTTATGG - Intronic
928193929 2:29199561-29199583 ATTAAAAACAGGTCTGTTTCTGG + Intronic
928361706 2:30667994-30668016 ATGACAAATACATTTGTTTAGGG + Intergenic
928907073 2:36379910-36379932 AAAAAAAAAAGGTATGTTTATGG + Intronic
929219778 2:39451274-39451296 ATGACAAAAATGTGTGCTTTAGG + Intergenic
929374368 2:41267508-41267530 ATGATAGAAATGTCTGTTCATGG - Intergenic
929693590 2:44095170-44095192 ATGACAGTGATGTCTGTTTATGG + Intergenic
932955015 2:76341543-76341565 ATAACCAAAATGTCTGTTGATGG - Intergenic
933287851 2:80403673-80403695 ATGACAAAAATGCCTGTTCTGGG - Intronic
934014082 2:87859580-87859602 ATGACAGAAAGTTCTGATTATGG - Intergenic
935372450 2:102361575-102361597 ATGATAAGAAGGCCTGTTTCTGG - Intronic
936530653 2:113274937-113274959 ATGTCAAAACGTTCTATTTATGG - Intronic
939603724 2:144226426-144226448 ATGACCAAAAGGTCTGCTTAAGG + Intronic
940504415 2:154534748-154534770 ATGTCAAAAAAGTATGTTTTGGG - Intergenic
940795817 2:158077539-158077561 ATGACAAGACAGTCTCTTTAAGG + Intronic
942051902 2:172147851-172147873 ATGCCAAAGAAGTCTGTTTTGGG + Intergenic
942555642 2:177170011-177170033 ATGAAAAAAAATTCTATTTAAGG - Intergenic
942626206 2:177903279-177903301 TTATCAAAAAGGTCTGTATAAGG - Intronic
944418451 2:199502721-199502743 GTAACAAAAATTTCTGTTTAGGG + Intergenic
944620958 2:201515680-201515702 TTGACCAAAAGGTCTTTATATGG - Intronic
945905968 2:215593812-215593834 ATGACAAAAATGTCTGCTTCTGG - Intergenic
1169847170 20:10006814-10006836 ATGACAAAAATGTTTGTATTTGG - Intronic
1170751751 20:19154442-19154464 ATGACCAAAAGGTCAATTTTGGG + Intergenic
1170955999 20:20979961-20979983 ATGACAGAATGGTCTGCTAAAGG - Intergenic
1172890300 20:38259749-38259771 ATGAAAGAAAAGTCTGTTTTTGG - Intronic
1175070654 20:56331005-56331027 ATGATAAAAATGTCTTGTTAGGG + Intergenic
1177057964 21:16333274-16333296 ATGACACAAAGGTGTCTTTTAGG + Intergenic
1177443436 21:21158941-21158963 ATGATAACAAGGTCTGCTTTTGG - Intronic
1177720724 21:24903347-24903369 ATTACAAAATGTTCTGCTTATGG - Intergenic
1181873210 22:25919560-25919582 ATAATAATAAGGTCTATTTAAGG + Intronic
1185120105 22:48960927-48960949 ATGAAAACAAAGTCTGTTGAGGG - Intergenic
949411538 3:3770610-3770632 GTGACACAAAGTTCTGTTTAGGG + Intronic
949706236 3:6820641-6820663 AAGAGAATAAGGACTGTTTATGG - Intronic
951227684 3:20140323-20140345 ATGACAGAAAATTCTGTGTACGG - Exonic
951779412 3:26346433-26346455 ATCACCAAAAGGTCTGTTTAGGG - Intergenic
951952614 3:28217192-28217214 TTGAGAGAAAGGTCTGTTTGCGG - Intergenic
952140298 3:30471400-30471422 TGGACAAACAGGTCTGATTAAGG - Intergenic
952347997 3:32506500-32506522 ATGAGCAAAAGGTCAGTTTGAGG + Intergenic
953603807 3:44394146-44394168 AGGAAAAAAAGGTGTTTTTATGG - Intronic
954265645 3:49469045-49469067 ATTGCAAAAAGGTATGTTTTTGG + Intronic
954360579 3:50120669-50120691 ATGTCAAAAGGGTCTAATTAGGG - Intergenic
958138713 3:89532252-89532274 ATGGGAAAAAGGTCAGTTTTTGG + Intergenic
960120406 3:113943316-113943338 ATCACAAAAAGATTTTTTTATGG - Intronic
964250250 3:154707254-154707276 ATAATAAAAATGTCTGTTTAGGG - Intergenic
964261072 3:154837766-154837788 ATGAGAGAAAAGTCTGTTTGGGG - Intergenic
964877965 3:161390810-161390832 GTGACAAAAAGTGCTATTTAGGG - Intergenic
964949421 3:162269887-162269909 ATGACATAAAAATCTCTTTAAGG - Intergenic
966034449 3:175394233-175394255 ATGAAAAAAAAGTCGGTTAATGG + Intronic
966961053 3:184939039-184939061 AAAAAAAAAAGGTCTGTTTGTGG + Intronic
969108792 4:4828501-4828523 ATGACAAAAATGTTTATTTCTGG + Intergenic
972846571 4:42998566-42998588 AGGAAAAAAATGTCTGTTTGTGG + Intronic
974391244 4:61272291-61272313 ATGACAAAAAAATCAGTATATGG + Intronic
974874755 4:67689725-67689747 ATGACAAAAAAGTCTGAAAAAGG - Intronic
975293380 4:72703707-72703729 ATCATAAAAAGGTCTGCTGATGG - Intergenic
976211458 4:82675842-82675864 ATGACAAATCGCTCTGCTTAAGG + Intronic
976986270 4:91302946-91302968 ATGACAACAAGGACTTTTTCTGG + Intronic
979589127 4:122458189-122458211 ATGAAGAAAAGGTCAGATTAGGG + Intergenic
980345401 4:131610055-131610077 ATTCAAAAAAGGTCTATTTAAGG - Intergenic
981011889 4:139933550-139933572 ACCACAAAAAGGTCTTTTTCTGG + Intronic
982604886 4:157502532-157502554 ATCACTAAAAGGTCTATTTCAGG - Intergenic
982799116 4:159680780-159680802 AAGAAATAAATGTCTGTTTAAGG + Intergenic
984653639 4:182294419-182294441 AAAAAAAAAAAGTCTGTTTAGGG - Intronic
985066994 4:186132371-186132393 TAGACAAATAGGTCTGTTTCTGG - Intronic
988948963 5:36239024-36239046 ATGTAAAACAGGTCTGTTTTAGG - Intronic
990288397 5:54324374-54324396 ATGATACAAAGTTGTGTTTATGG - Intergenic
990781686 5:59371594-59371616 CTGAAAAAAAGGTCTGTCCATGG + Intronic
991251461 5:64566633-64566655 ATGAGCAAAAGGTCAGTTTGAGG + Intronic
991251508 5:64567025-64567047 ATGAGCAAAAGGTCCGTTTGAGG - Intronic
991997907 5:72406355-72406377 GTGACAAAAAGGGGTGTTTCTGG - Intergenic
993726648 5:91375630-91375652 AAGAGAAAAAGGTCAGTGTATGG + Intronic
993740869 5:91537722-91537744 ATGACAAAAAGCACTGAGTATGG - Intergenic
995853101 5:116567274-116567296 ATGACATTATGGCCTGTTTATGG + Intronic
996881477 5:128301711-128301733 ATGAAAAAAATGTATCTTTATGG - Intronic
1001551501 5:172605519-172605541 ATCACACAAATGTCTTTTTAGGG - Intergenic
1002485712 5:179534839-179534861 ATGACAAATAGTTTTGTTTTTGG - Intergenic
1003524619 6:6887228-6887250 CTGTCAACAAGGTTTGTTTAGGG - Intergenic
1003630853 6:7785693-7785715 CTTAAAAAAAAGTCTGTTTATGG + Intronic
1004473037 6:15946138-15946160 ATGACAACAGGGTCAGATTATGG + Intergenic
1004678632 6:17869896-17869918 CTGACAAATAGGTCGGTTTCAGG + Intronic
1005995171 6:30926452-30926474 ATCCCAAACATGTCTGTTTATGG + Exonic
1006531783 6:34661698-34661720 ATGATAAAAGGGTTTCTTTAAGG - Intronic
1006544972 6:34773127-34773149 GAGAAAAAAAGGTCAGTTTAGGG + Intronic
1009943306 6:70315055-70315077 TTTAAAAAAAGGTCTTTTTATGG - Intergenic
1010326397 6:74567978-74568000 ATGAGTAAAAGGTCACTTTAAGG + Intergenic
1010382108 6:75237178-75237200 GTTTCAAAAAGGTCTATTTAGGG - Intergenic
1011396548 6:86915766-86915788 AGGAGAAAAATGGCTGTTTAAGG - Intergenic
1011686199 6:89825750-89825772 ATGTCAAAATGGTCTGTTTCGGG - Intergenic
1014713545 6:124838048-124838070 GAGACAAAAAGATCAGTTTAGGG - Intergenic
1014942947 6:127464982-127465004 ATAATAAAAAGGACTGTTTGAGG + Intronic
1016529860 6:145045629-145045651 ATGACAGAGAGGTGTGCTTATGG - Intergenic
1017219480 6:151949527-151949549 ATGACAGAAGCCTCTGTTTAAGG + Intronic
1017287209 6:152689607-152689629 ATGAGCAAAAGGTCAGTTTGAGG + Intergenic
1018886165 6:167940027-167940049 ATGGCAAAAGGATCTGTTCAAGG + Intronic
1019173082 6:170145846-170145868 ATGACAATAAGGTCAGTACAGGG - Intergenic
1020588801 7:10107519-10107541 ATAACAAAAATATCTGTTGAAGG - Intergenic
1021415289 7:20376803-20376825 ATTACTAAAAGGCCTGTGTATGG + Intronic
1021839493 7:24711204-24711226 ATAATAAAAAGGTTTGTTTTTGG + Intronic
1022905814 7:34854826-34854848 TTGAAAAAAATGTCTGTTCAGGG - Intronic
1024251383 7:47508161-47508183 AAGTCAAAAAGGTTTGTGTAGGG + Intronic
1024347854 7:48331034-48331056 ATAAGAAAAAGGTCTGAATAAGG + Intronic
1024429037 7:49264250-49264272 TTAACATAAAGGTCTGTTTGGGG + Intergenic
1027879711 7:83818857-83818879 AGGAAAAACAGGTCTGTTTTAGG + Intergenic
1029328369 7:99829754-99829776 ATGAAAGATAGGTCTGTATATGG - Intronic
1029853086 7:103484990-103485012 ATGCCTAAAAGGTCTATCTAGGG - Intronic
1033857536 7:145583065-145583087 ATGATTAAAAGGTATGTTTGCGG + Intergenic
1034908806 7:154974686-154974708 ATGAACAAAAGGACTGTTGATGG - Intronic
1035752495 8:2006406-2006428 CTTACAAAAAGTTCTGTTTTTGG + Exonic
1035829733 8:2682028-2682050 ATAATAAAAAGGTGTGTTCAAGG - Intergenic
1037441619 8:18922180-18922202 ATGAAAAAACGGTTTGTTCAGGG + Intronic
1037781301 8:21871139-21871161 ATTACAATAAAGTCTGTTAAGGG + Intergenic
1038934698 8:32235799-32235821 CTAACAAAAAAATCTGTTTAGGG + Intronic
1040591973 8:48801715-48801737 ATGTCAAAAAAGTCTGTGTCTGG - Intergenic
1041783419 8:61603974-61603996 ATGTGAAAAAGGTATGTTCAGGG + Intronic
1045287438 8:100804174-100804196 ATTACAGAAAGGTCTGGCTAAGG - Intergenic
1046568447 8:115931399-115931421 ATGTCAAAAAGGTAAGGTTAAGG - Intergenic
1046699508 8:117383919-117383941 GTGACAATGAGGTCTGTTTCAGG + Intergenic
1050204489 9:3182354-3182376 TTGAAGAAAAGGTCCGTTTATGG - Intergenic
1052973559 9:34396121-34396143 ATTACAAAATGGTGTATTTAAGG - Intronic
1058294653 9:103290499-103290521 AAGACACAAAGGGCTGTTTAAGG - Intergenic
1058758839 9:108109892-108109914 ATGGCAATAAGAACTGTTTATGG + Intergenic
1060042822 9:120315458-120315480 ATGAGCAAAAGGTCAGTTTGAGG + Intergenic
1060853049 9:126893330-126893352 ACGTTAAAAAGGTCTTTTTATGG + Intergenic
1188432941 X:30127128-30127150 AGGACATAAAGATCTATTTAAGG + Intergenic
1188726660 X:33592520-33592542 ATGAGAAAAAGAACTGCTTATGG + Intergenic
1188769447 X:34133776-34133798 ATGAGAAAATGGTATGCTTAAGG - Intergenic
1194872418 X:99148467-99148489 ATGAAAAAAAGGATTCTTTACGG + Intergenic
1195607506 X:106824611-106824633 ATGGCAAAACAGTTTGTTTATGG - Intronic
1197539115 X:127732777-127732799 ATAACAAAAAGGTCAGTATTTGG + Intergenic
1197592539 X:128426208-128426230 ATGAGAAACAGGCATGTTTAAGG - Intergenic
1198141034 X:133803607-133803629 ATGAAAAATAGGTCTGATTCAGG + Intronic
1198333644 X:135645221-135645243 ATGACAAAAAGGTCTCTCTGAGG - Intergenic
1198339187 X:135697876-135697898 TTGACAAAACTTTCTGTTTAGGG + Intergenic
1199130392 X:144178892-144178914 ATGACAGAAAGTTCTGATTATGG + Intergenic
1199288002 X:146075287-146075309 ATGACAAACAGATTTGTTTGGGG + Intergenic
1199706336 X:150428605-150428627 TGGACAGAAAGGTCTGCTTAAGG + Intronic
1199713780 X:150491555-150491577 ATGACTAGAAGGTCTTTTCAAGG + Intronic
1201895534 Y:18988842-18988864 ACGACAAAAAGGTCTTTTCAAGG + Intergenic