ID: 1162616531

View in Genome Browser
Species Human (GRCh38)
Location 19:11805505-11805527
Sequence ATGTTTAAACAATTCAGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 354}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162616528_1162616531 4 Left 1162616528 19:11805478-11805500 CCATCTTGTAGAATGTGTGATCC 0: 1
1: 0
2: 1
3: 7
4: 124
Right 1162616531 19:11805505-11805527 ATGTTTAAACAATTCAGACAGGG 0: 1
1: 0
2: 1
3: 33
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162616531 Original CRISPR ATGTTTAAACAATTCAGACA GGG Intronic
901253329 1:7798396-7798418 ATGTTTAAACATTTTAGATGTGG + Intronic
901384064 1:8895478-8895500 TTGTTTTAAAAATTCAGACCGGG + Intergenic
904653708 1:32026146-32026168 ATTTTTAGAGAATTCAGAGAAGG - Intronic
905314087 1:37070035-37070057 ATCTTTAAAGAAATCAAACAAGG - Intergenic
905520523 1:38595969-38595991 AAGTCTGAACAATGCAGACATGG + Intergenic
905895651 1:41544421-41544443 GTGTTTAATCAATTCAAAGAGGG - Intronic
907125262 1:52044623-52044645 ATGTTTAAAGAAATAACACATGG + Intronic
908123568 1:61008089-61008111 ATGTCTAACCAATGCAGGCAAGG + Intronic
908349771 1:63273503-63273525 ATTTTTAAAAAATACAGACAGGG - Intergenic
908381151 1:63597974-63597996 ATTTTTAAAAATTTGAGACATGG + Intronic
908982868 1:69979490-69979512 ATGTTTTAAAAGTTCAGAGAAGG - Intronic
909005817 1:70274971-70274993 ATGTATAAGAAATTAAGACAAGG + Intronic
909229223 1:73063544-73063566 ATCTTTAAACAAATAAAACATGG + Intergenic
909390886 1:75120312-75120334 ATGTTTGAAAAATTCAGAATTGG + Intergenic
909634220 1:77797481-77797503 ATTTTTAAAAAATTAAGAAAAGG - Intronic
910063271 1:83119464-83119486 GTGTTTGAGCATTTCAGACAAGG + Intergenic
910893450 1:92042185-92042207 ATTTTTAAAAAATTGAAACAGGG - Intronic
911400849 1:97373421-97373443 ATATTTAAACAATGCAGACCTGG + Intronic
911723545 1:101217638-101217660 ACGTTCCCACAATTCAGACAAGG - Intergenic
913046253 1:115075826-115075848 ATGTTAAAACAAATAAGAAATGG + Intronic
913312507 1:117515426-117515448 ATGTTTTAGAAATTCAGAGAAGG + Intronic
914740874 1:150463968-150463990 ATTTTTAAAAAATAGAGACAGGG - Intronic
915632813 1:157164932-157164954 ATGATTATAAAATTCAGACATGG + Intergenic
916488856 1:165283712-165283734 GTGTTTTAGCCATTCAGACATGG - Intronic
918507084 1:185267596-185267618 ATATTTAAAAAAATAAGACATGG - Intronic
919357259 1:196538956-196538978 ATTTTTAAAAAATTCAAAAAAGG - Intronic
919566152 1:199191382-199191404 ATATTTAAAAAATCCACACAAGG + Intergenic
921647174 1:217632227-217632249 GTGTCTAAACCATTCTGACACGG + Intronic
921681567 1:218039090-218039112 ATGTTTAATCATTTGAGAAACGG - Intergenic
922263893 1:223966236-223966258 ATTTTTAAAAAATCAAGACAGGG + Intergenic
924462666 1:244273123-244273145 ATGTTTCAAAAAGTAAGACATGG - Intergenic
924526196 1:244852184-244852206 GTGTTTAAGGAATTCAGAGAAGG - Intronic
924850685 1:247827335-247827357 ATTTTTTAACAATTCATAAATGG + Intergenic
1063212279 10:3891681-3891703 TTATTTAGACAATTCAGAAAGGG + Intergenic
1063674236 10:8125768-8125790 ATGTTTTAATATTTCAGTCAAGG + Intergenic
1063886518 10:10585160-10585182 ATGTATAATCAATTCATACGAGG + Intergenic
1064536199 10:16360211-16360233 TTGTTTAAAGAATTCAACCAAGG - Intergenic
1066730600 10:38433583-38433605 ATTTTTAAAAAATCAAGACAGGG - Intergenic
1067870425 10:49955269-49955291 ATATTTTAAAAATTCAGAAATGG - Intronic
1068198600 10:53751252-53751274 ATGTATAAATAATTTAGATAGGG + Intergenic
1068679348 10:59802883-59802905 ACGTTTAAATAAATCAAACAGGG + Intronic
1069178521 10:65325933-65325955 ATGTGGAAACCATTCAGTCAGGG + Intergenic
1070077229 10:73148848-73148870 ATGGCTAAATAATTCAAACAGGG + Intronic
1071302630 10:84267833-84267855 AAGTTTAAACAAGACAGACAAGG + Intergenic
1071464911 10:85930716-85930738 AAGTTAAAAAAATTCATACATGG - Intronic
1071626192 10:87173403-87173425 ATATTTAAACAGTAAAGACAAGG - Intronic
1071930554 10:90465081-90465103 ATGATTAAACAATTGAGATCTGG - Intergenic
1072085013 10:92070474-92070496 CTGTTTAAAAAATTCAGATATGG + Intronic
1072954527 10:99877031-99877053 ATGGTTAAGCAACGCAGACAGGG + Exonic
1073911327 10:108348506-108348528 TTGTTTAAACAATAATGACATGG + Intergenic
1074830934 10:117248263-117248285 ATATTTAAAAAAAACAGACAGGG - Intronic
1074937848 10:118203700-118203722 ATGTTCAAACAAGTAAGACCTGG + Intergenic
1076066788 10:127455096-127455118 ATGTTTAAATAATTCTGAAAAGG - Intergenic
1078327232 11:10390518-10390540 CTGTGTAAACAACTCAGGCATGG + Intronic
1078517136 11:12032214-12032236 TTTTTTAACCAATTCAGAAATGG - Intergenic
1079487941 11:20955056-20955078 ATTATTGATCAATTCAGACATGG + Intronic
1081951559 11:47048452-47048474 ATTTTTAAATAATAGAGACAGGG - Intronic
1083161738 11:60858663-60858685 ATGTTTAACAAATACAGCCAAGG + Intergenic
1084300425 11:68246944-68246966 ACTTTTAAAAAATTCAGAAAAGG + Intergenic
1085604082 11:77881824-77881846 ATATATAAACAATTAAAACAGGG + Intronic
1086794382 11:91082559-91082581 ATGTTTATTCACTTTAGACATGG - Intergenic
1087993939 11:104780316-104780338 ATATTTAAAAAATTCAGGCCTGG - Intergenic
1088145697 11:106673820-106673842 ATGTTTAAAAAATTCAAAATTGG + Intergenic
1088371890 11:109099301-109099323 ATGTTTAAAGAAATCAAAAATGG - Intergenic
1089849383 11:121483098-121483120 ATTTTTAAAAAATAGAGACAGGG + Intronic
1090061424 11:123467308-123467330 TTTTTTAAAAAATTGAGACAGGG - Intergenic
1093092501 12:14937438-14937460 ATTTTCCAACATTTCAGACAAGG + Intronic
1093129303 12:15370563-15370585 AGGCTAAAACAATTCAGGCAAGG + Intronic
1093280116 12:17184033-17184055 ACATTTAAACTATCCAGACATGG - Intergenic
1093848186 12:24001095-24001117 ATTTTAAAAAAATTGAGACAGGG + Intergenic
1094093764 12:26679955-26679977 ATGTTTATATAATACAGAAATGG + Intronic
1095089425 12:38089737-38089759 ATGTTAAAAAAATTCAAGCACGG - Intergenic
1098012208 12:66065467-66065489 ATTTTTCAATAACTCAGACAAGG - Intergenic
1098483394 12:70992284-70992306 CTGTTTAAAATATTCAGAAATGG - Intergenic
1099302838 12:80919429-80919451 ATGTTTAACAAATTCAGGAAGGG + Intronic
1099397405 12:82157947-82157969 ATATTTAAACAATACAAACCTGG - Intergenic
1101039934 12:100745067-100745089 AAGTCTAAACACTTCATACAGGG + Intronic
1102111646 12:110369754-110369776 ATGTTTAAAAAATTCAGGCCAGG - Intergenic
1102848499 12:116214653-116214675 TCCTTTAAACAATTCAGACAGGG + Intronic
1103262733 12:119602518-119602540 ATGATGACACACTTCAGACAGGG - Intronic
1103663390 12:122540455-122540477 ATGTATAAAAAATACAGAAAAGG - Intronic
1107399098 13:40051356-40051378 ATGTTTAATTAATTCAAAGAAGG + Intergenic
1107499677 13:40960608-40960630 ATGTTCATACTATTGAGACAGGG + Intronic
1107691981 13:42962472-42962494 ATGTTTAAACAGTTTAGGCCAGG + Intronic
1107754323 13:43603186-43603208 ATGTTTAAAAAAGTAAGATATGG - Intronic
1108753022 13:53467919-53467941 AGGATTCAACAATTCAGACTTGG - Intergenic
1110094696 13:71502480-71502502 ATGGTTAAACAGCTCCGACAAGG - Intronic
1110658849 13:78034189-78034211 ATGAATAAACAATTGATACATGG + Intergenic
1110682475 13:78332730-78332752 ATTTTTAAATAATTAAGTCAAGG + Intergenic
1112753806 13:102608567-102608589 AATTTTAAAAAATTCACACAAGG - Intronic
1114572349 14:23680802-23680824 AAATTTAAATTATTCAGACATGG - Intergenic
1115679711 14:35722970-35722992 TTGTTTAAATAATTGAGTCAGGG - Intronic
1115681493 14:35743947-35743969 AAATTTACACAATCCAGACAGGG + Intronic
1116037107 14:39639857-39639879 ATTTTTAAGCACTTCAAACAAGG - Intergenic
1117090959 14:52249744-52249766 ATGTCTAAATAATTCAGAACAGG - Intergenic
1118393402 14:65315566-65315588 AGGTTGAAGCAATTCACACAAGG - Intergenic
1118831346 14:69436229-69436251 ATTTTTAAAAAATAGAGACAGGG - Intronic
1119919170 14:78430229-78430251 ATTTTTCAAAAATTGAGACAGGG - Intronic
1120379581 14:83758701-83758723 TTGTTTAAACAGTTTAGACAAGG + Intergenic
1120399971 14:84018515-84018537 ATGCTTAATAAAGTCAGACAAGG - Intergenic
1121154969 14:91674720-91674742 ATTTTGAAACAAATCAGACATGG + Intronic
1121155885 14:91683549-91683571 ATTTTGAGACAAATCAGACATGG + Intronic
1121421311 14:93817557-93817579 ATGTTTAAAAAATACTAACATGG + Intergenic
1122471961 14:101974705-101974727 ATTATTAAAAAATTGAGACATGG + Intronic
1123806485 15:23879184-23879206 CTGTTGAATCAATTCACACAAGG - Intergenic
1123824871 15:24071026-24071048 ATATTTAATCCTTTCAGACAGGG + Intergenic
1126459817 15:48903073-48903095 ATGTTTGAACAATTAAAAAATGG - Intronic
1126711326 15:51460134-51460156 ATGTTTAATAAAATCAGGCACGG + Intronic
1128231770 15:66040220-66040242 GTGGTTTAACAATTCAGAGAGGG + Intronic
1128502397 15:68236043-68236065 ATGTTTAAATAAATAAAACATGG + Intronic
1130626979 15:85525351-85525373 ACATTTAAACAATTCAGGCTGGG - Intronic
1130740844 15:86598110-86598132 GTGTTTAACCCATTCAGAGAAGG + Intronic
1130743415 15:86625286-86625308 ATGTCTAACCAAATAAGACATGG - Intronic
1131021533 15:89103448-89103470 ATGTTTAGATAATTCACCCAAGG + Intronic
1131884349 15:96894881-96894903 ATGTTTAAACAAAGCAGTAAAGG - Intergenic
1133409166 16:5553613-5553635 AGTTTTAAAATATTCAGACATGG - Intergenic
1135275481 16:21108734-21108756 CTTTTTAAAAAATTGAGACAGGG - Intronic
1135948667 16:26890876-26890898 TTTTTTAAAAAATTGAGACAGGG + Intergenic
1136698160 16:32105279-32105301 ATTTTAAAAAAATTAAGACAGGG - Intergenic
1136798658 16:33048564-33048586 ATTTTAAAAAAATTAAGACAGGG - Intergenic
1137088773 16:36162277-36162299 ATTTTTAAAAAATTAAGAGAGGG - Intergenic
1137093298 16:36221507-36221529 ATTTTTAAAAAATTAAGAGAGGG - Intergenic
1138928519 16:61622231-61622253 ATGATGAAAAAATTCAGACAAGG - Intergenic
1139792415 16:69450041-69450063 ATTTTTAAAAAATAGAGACAGGG - Intronic
1140021907 16:71246988-71247010 ATGTTAAAATTATTCAGACGTGG - Intergenic
1140089754 16:71828011-71828033 ACATTTAAACAATACAGAAAGGG - Intergenic
1140137632 16:72221670-72221692 ATGTTTAAACTCTTCTGACCAGG + Intergenic
1140273173 16:73484332-73484354 ATCTCTTAACAATTCAGACATGG + Intergenic
1140290721 16:73653644-73653666 ATTTTTACACAATTTAGAAATGG - Intergenic
1140823329 16:78683206-78683228 ATTTTTAAAAAATAGAGACAAGG + Intronic
1141378242 16:83551359-83551381 ATGTTAAAAGAATTAAGCCAGGG - Intronic
1141926095 16:87170595-87170617 ATATTTAAAGAAGTTAGACAGGG - Intronic
1144125567 17:12199480-12199502 TTGTTTAAACTCATCAGACAGGG - Intergenic
1145884998 17:28375801-28375823 AATTTTAAAAAATTGAGACAGGG - Intronic
1147190693 17:38736318-38736340 ATGTTGGAACAACTCTGACAGGG - Intronic
1148886580 17:50777682-50777704 ATCATTAAACAAAACAGACAAGG - Intergenic
1149897541 17:60440661-60440683 TTTTTTAAAAAATTGAGACAGGG + Intergenic
1150310934 17:64129484-64129506 ATTTTTAAAAAGTTCAAACAAGG + Intronic
1150505219 17:65691901-65691923 TTGTTTAAGCATTTCAGTCAGGG - Intronic
1152237096 17:79144293-79144315 ATTTTTAAACAAGGCAGCCATGG - Intronic
1153019484 18:613752-613774 CTTTTTAAAAAATTCAGACTAGG - Intronic
1153152900 18:2114778-2114800 ATGTTTCAACAAATAAGAGATGG - Intergenic
1154063034 18:11081474-11081496 ATGTTTAAAAAAATTATACATGG - Intronic
1154456988 18:14538812-14538834 ATGTTTTAACATTTCTTACACGG + Intronic
1155301129 18:24430078-24430100 ATTTTTAAACCATTAAAACAGGG + Intronic
1155554269 18:27000899-27000921 GTGATTAGACAATTCAGAGATGG - Intronic
1157761719 18:50270217-50270239 AGCTTTAAGTAATTCAGACATGG - Intronic
1158281160 18:55829433-55829455 ATGTTTAAAAAATCAATACAAGG - Intergenic
1158528821 18:58239809-58239831 GGGTTTAAAGAATTCAGAGATGG - Intronic
1158961183 18:62588784-62588806 ATGTTTAAACCGTTAGGACAAGG + Intergenic
1159817008 18:73086660-73086682 ATGTTTGAACATTTCAAATATGG + Intergenic
1162225914 19:9222338-9222360 ATGTTTTTACAATTTTGACAGGG + Intergenic
1162616531 19:11805505-11805527 ATGTTTAAACAATTCAGACAGGG + Intronic
1162619633 19:11831232-11831254 ACCTTCAAACAATTCAGACAGGG + Intronic
1162623871 19:11867170-11867192 ACCTTCAAACAATTCAGACAGGG + Intronic
1162628364 19:11904513-11904535 ACCTTCAAACAATTCAGACAGGG + Intronic
1162633613 19:11948140-11948162 ACCTTCAAACGATTCAGACAGGG + Intronic
1162637130 19:11977987-11978009 ACCTTCAAACAATTCAGCCAGGG + Intronic
1162641873 19:12017087-12017109 ATATTCAAACAATTCAGACAGGG - Intronic
1162663143 19:12186442-12186464 ATGCTCAAACAAATCAGACTTGG + Intronic
1162668338 19:12234160-12234182 ACTTTCAAACAATTCATACATGG - Intronic
1162715291 19:12627280-12627302 GTTTTTAAACAAGTCAGACGGGG + Intronic
1163857173 19:19713199-19713221 ACTTTAAAACAATTCAGACAGGG - Intronic
1164240717 19:23386144-23386166 ATGCTTAAAGAAGTCAGAAATGG + Intronic
1164316590 19:24093941-24093963 ATGCTTAAAGAAGTCAGAAATGG - Intronic
1164559402 19:29278720-29278742 ATGTGTAAACTATGCATACAAGG - Intergenic
1165652633 19:37504856-37504878 TTATTTAAAGAATTCAGAAATGG + Intergenic
1166210387 19:41303074-41303096 AACTTGAAACAAGTCAGACACGG + Intronic
1167548712 19:50144799-50144821 ATTTTTTAATAATACAGACAGGG + Intergenic
1167695704 19:51014672-51014694 AGGTTTGAACAGTGCAGACAAGG + Exonic
1167866608 19:52334156-52334178 ATATTTAAAAAATTCAAAAAAGG - Intergenic
925519123 2:4721734-4721756 AAGTTAAAACAATTCAAAAAAGG - Intergenic
925946505 2:8869053-8869075 ATTTTTAAAAAATAGAGACAGGG + Intronic
925985210 2:9209528-9209550 ATGTTTAAACAAATGAATCACGG + Intronic
926874453 2:17459108-17459130 AGGTAGAAACAATTCAGACATGG - Intergenic
928301471 2:30129324-30129346 ATGTTTAAAAATTTGAGACGGGG - Intergenic
928629596 2:33177347-33177369 ATAGTTAAAAAATGCAGACAAGG + Intronic
930029324 2:47048756-47048778 ATGTTTAAATTAACCAGACATGG - Intronic
931274248 2:60730340-60730362 ATTTTTAAAAAAATCAGGCATGG + Intergenic
931589970 2:63871980-63872002 ATGATTACTCAATTCAGCCATGG + Intronic
932884879 2:75540667-75540689 ATGTTTAACTAAGTCAGTCATGG + Intronic
934303426 2:91798673-91798695 ATTTTAAAAAAATTAAGACAGGG - Intergenic
934329833 2:92054084-92054106 ATTTTAAAAAAATTAAGACAGGG + Intergenic
934468051 2:94283989-94284011 ATTTTAAAAAAATTAAGACAGGG + Intergenic
934997172 2:98974570-98974592 ATGTTTAAAGAATTTACATAAGG + Intergenic
936266556 2:111014733-111014755 ATGCTTCAATAATACAGACATGG + Intronic
936947879 2:117946900-117946922 ACTTTTACAAAATTCAGACAAGG + Intronic
937147753 2:119661887-119661909 ATTTTTAAAAAATTGAGACAGGG - Intronic
937681031 2:124645030-124645052 ATGTTTATACAAAGAAGACAAGG - Intronic
937779699 2:125822908-125822930 ATCTTGAAACAAACCAGACATGG - Intergenic
938827486 2:135020324-135020346 TTTTTTAAAAAATTGAGACAGGG + Intronic
938904776 2:135827345-135827367 AGGTTTAAACAATTTAACCAAGG - Intronic
939392072 2:141581278-141581300 GTTTTTAAACAATTCTCACATGG - Intronic
939791249 2:146580063-146580085 ATGTTTTAACTACTCTGACAAGG - Intergenic
940268564 2:151866512-151866534 ATGTTTTACCAATTGATACAAGG - Intronic
941319446 2:164036466-164036488 ATGTTGAAACAATACAGAGTTGG - Intergenic
942126633 2:172832342-172832364 AAGTTCAAACAGTACAGACAAGG + Intronic
942850638 2:180480975-180480997 ATGATTAAATAAATTAGACAAGG - Intergenic
943864126 2:192906931-192906953 ATTTTTAAACTATTCTGAAATGG - Intergenic
945732660 2:213559216-213559238 ATGTGTAGATAATTCAGAGACGG - Intronic
945981072 2:216311222-216311244 ATGATTTAAAAATTCAGACATGG - Intronic
947971105 2:234326088-234326110 ATTCCTAAACAATTCTGACAAGG + Intergenic
949075358 2:242054329-242054351 ATGTTTAAACACCTCAGGCAGGG + Intergenic
1169538005 20:6567278-6567300 TTCTTAAAACAATTCTGACATGG - Intergenic
1169813170 20:9629492-9629514 ATATTTAAAAAATACACACAGGG + Intronic
1170308276 20:14963998-14964020 TTGTTTAAACAATATAGAGATGG + Intronic
1170735890 20:19013896-19013918 ATGTTTAAGAAATTGAGCCAAGG + Intergenic
1173155628 20:40606229-40606251 ATGTTTAAGTAATTGACACAAGG + Intergenic
1173342831 20:42168636-42168658 ATGTTGAATCAATTGAGAGAGGG - Intronic
1173762670 20:45577705-45577727 ATGTTTAAAAAATAAAGACAGGG + Intronic
1174328055 20:49795475-49795497 AGGTTTAAAAAATTCACACAGGG - Intergenic
1174929792 20:54800601-54800623 ATGTTAAAACAAGTGATACAGGG + Intergenic
1175587930 20:60160386-60160408 ATTTTTATACACTTCAGAAATGG + Intergenic
1176427533 21:6558006-6558028 ATGTTTAAACAAATCAAAATGGG + Intergenic
1176742531 21:10617133-10617155 ATTTTAAAACAATTAAGAGAGGG - Intergenic
1177063821 21:16404509-16404531 ATTTTGAAAAAATTCAGAAAAGG - Intergenic
1177577675 21:22979612-22979634 ATTTTTAAACAAGTTAAACAAGG + Intergenic
1178150126 21:29785056-29785078 ATTCATAAACAATTCAGAAATGG + Intronic
1178262015 21:31108317-31108339 ATGTTTAAGAAATTTTGACATGG - Intergenic
1179359604 21:40693610-40693632 ATGAATAAAAAATTCAGGCAAGG + Intronic
1179703024 21:43166323-43166345 ATGTTTAAACAAATCAAAATGGG + Intergenic
1181184341 22:21091868-21091890 ATGTTTAAAAAAATCTGACTGGG + Intergenic
1181492119 22:23267128-23267150 AGTGGTAAACAATTCAGACACGG - Intronic
1183843679 22:40522151-40522173 ATGTTAAAAAAATTAAGAGAGGG - Intronic
1184085425 22:42259938-42259960 ATTTTTAAAAAATAGAGACAAGG - Intronic
1184711485 22:46252230-46252252 ATGTTTAAACAGTGTAGAAAGGG - Intergenic
949821359 3:8119482-8119504 TTGTGTAAACAAATCTGACATGG - Intergenic
951098887 3:18663661-18663683 ATATTTAGAAAATTCAAACAAGG + Intergenic
951927917 3:27929946-27929968 ATGTACAAACAATTCATAGAGGG + Intergenic
951946140 3:28138609-28138631 ATGTATAAACAAATGAGAAAGGG + Intergenic
952109012 3:30100956-30100978 ACTTTTAAACAATTCAGATCTGG + Intergenic
952595224 3:35009444-35009466 AATTTTAAACAATACACACATGG + Intergenic
952703101 3:36347334-36347356 ATGTTTAAAGAATTAAAATAAGG - Intergenic
952818739 3:37467825-37467847 ATGTTTCAGCAGTTTAGACAGGG + Intronic
953580282 3:44147824-44147846 AGGTTCAAACAATACAGATAAGG + Intergenic
954022160 3:47751692-47751714 ATTTTTAAATAATATAGACAAGG - Intronic
954906377 3:54066613-54066635 ATTTTTAAAAGAGTCAGACATGG - Intergenic
956783512 3:72623456-72623478 ATATGTAAATAATTTAGACATGG - Intergenic
956978612 3:74611528-74611550 TTGTATAAACATTTCAGAAATGG - Intergenic
957405731 3:79773931-79773953 ATGTTGAAAAAATTCAAAAAGGG + Intergenic
957464432 3:80568787-80568809 TTGATTAAACTATTCTGACATGG + Intergenic
957517341 3:81272912-81272934 ATGTTTAAAATATTAACACATGG + Intergenic
958158507 3:89786691-89786713 ATGCATAAACAATTAACACAGGG - Intergenic
958671214 3:97207645-97207667 ATGTTTAAAATATTTACACATGG + Intronic
959805329 3:110545499-110545521 ATGTCTAAGCAATTCATATAAGG + Intergenic
961254601 3:125537517-125537539 ATTTTTAAAGAATTCTTACAGGG - Intronic
963093903 3:141515173-141515195 ATTTTTAAAAAATTAAAACAAGG - Intronic
964249850 3:154700431-154700453 ATGTTTACACAATTCAAGGAAGG + Intergenic
965248537 3:166309475-166309497 ATATTTAAAAAATTCAGTAAAGG - Intergenic
965510248 3:169561011-169561033 ATGAACAAACAATTCAGAAAAGG + Intronic
965796391 3:172444294-172444316 ATTTTTAAACATTTCATATAAGG + Intergenic
967252481 3:187555247-187555269 ATGGTGAAAGAATTCAGAAAGGG - Intergenic
970077744 4:12244091-12244113 ATTTTTTAAAAATTCAGAGAAGG + Intergenic
971734903 4:30435225-30435247 ATGTTTATACAAGTGAGAGAAGG - Intergenic
973169875 4:47128692-47128714 ATGTTTAAACATTTCAAAAGGGG - Intronic
976153817 4:82120930-82120952 ATTTTTAAACATTTCACACATGG + Intergenic
977735556 4:100410761-100410783 CTGTTTAAATAATTCAGTGAGGG + Intronic
978452606 4:108851592-108851614 ATGTTTGATCAATTAACACATGG - Intronic
979560623 4:122097521-122097543 ATGTTTACAAAATTGAAACAGGG - Intergenic
980327928 4:131372295-131372317 ATGTTTGAAAAATGGAGACAAGG - Intergenic
980779586 4:137479343-137479365 ATGTTTAAAAATTTCAGAAAGGG + Intergenic
982148188 4:152421523-152421545 ATGTTTAAAAAGTAGAGACAGGG - Intronic
982296280 4:153832961-153832983 ATGTTTAAATAAGGCAAACATGG + Intergenic
982401862 4:154976982-154977004 ATTTTTAAACAATTCAGGACCGG - Intergenic
982839785 4:160169330-160169352 TTGTTTAATCTATTCACACATGG + Intergenic
984969746 4:185177477-185177499 ATGTTTAAAAAATTAACATAAGG - Intronic
987930729 5:24396981-24397003 ATGTTAAAAAAATTCAAAAAGGG - Intergenic
988219649 5:28326983-28327005 GTGGTTAAAAATTTCAGACAGGG + Intergenic
988492209 5:31714428-31714450 ATGTTTAAAGACTCCAGAAAGGG + Intronic
989188958 5:38650966-38650988 AAGTTGAAACAATTCGTACAAGG - Intergenic
990402729 5:55455612-55455634 ATTTTTAAAAAATTAAGACAGGG - Intronic
991075289 5:62529630-62529652 ATGTTTGAACAATTAAGAAAAGG + Intronic
992704339 5:79373525-79373547 ATGTTTATATAATACAGAAATGG + Exonic
993534851 5:89070653-89070675 CTGTTTGAAGAATTCAGTCACGG - Intergenic
993623162 5:90191924-90191946 ATGTAAAAACAAGTGAGACATGG - Intergenic
993784365 5:92110326-92110348 ATGATTGAATAATTGAGACAAGG + Intergenic
994216447 5:97143414-97143436 TTTTTTAAAAAATTGAGACAGGG - Intronic
994238866 5:97396601-97396623 ATGTTGAAAAACTGCAGACATGG - Intergenic
994740138 5:103607828-103607850 ATTTTTAAAAAATTCATAAAAGG - Intergenic
995272959 5:110243466-110243488 ATTTTTAAAAAAATCAGAAAAGG + Intergenic
995382074 5:111546872-111546894 ATTTTTAAAAAATTCACTCACGG + Intergenic
995660299 5:114475039-114475061 ATGTTTTAATAATTAAGATATGG - Intronic
995879515 5:116828175-116828197 ATCTTTAAAAAATTCAGTCCTGG + Intergenic
996230594 5:121059197-121059219 ATTTTTAAAAAATTGAGATATGG - Intergenic
996761076 5:126986199-126986221 ATTATTAAACATTTCAGACAGGG + Intronic
997915204 5:137917895-137917917 ATTTTTAAAAAATTCAAACCAGG + Intronic
998815958 5:146014197-146014219 AGGTTTATACAATTCTAACATGG - Intronic
999839572 5:155410929-155410951 ATGTTTAAGCAATTTAAAAATGG + Intergenic
999966635 5:156817433-156817455 ATGTTCAAACAAGGCAAACACGG - Intergenic
1000924968 5:167182726-167182748 ATGTTTTTACATTTCAGACGTGG + Intergenic
1001294615 5:170490147-170490169 GAGTTTAAACAACTCAGTCATGG - Intronic
1002902186 6:1418409-1418431 ATGTTTTAACAATTCCTCCATGG + Intergenic
1003238301 6:4318298-4318320 ATTTGTAACCAAGTCAGACAGGG + Intergenic
1003670713 6:8155448-8155470 ATGTTTAAACAATGCTTACCTGG - Intergenic
1005736647 6:28753901-28753923 ATGGTTAAAGAATTAAAACAAGG + Intergenic
1006140093 6:31923329-31923351 CTGTTTCAACCATGCAGACAAGG + Intronic
1006754351 6:36402235-36402257 AGGTCTAAAGAATACAGACAAGG + Intronic
1007265558 6:40593090-40593112 ATGTTTCAACAATACATAAAGGG - Intergenic
1007422873 6:41730035-41730057 GTGTTTAAACAATTCCTCCAGGG + Intronic
1008385589 6:50886360-50886382 ATGTTTTACCAATTCATACTGGG + Intergenic
1010238280 6:73593074-73593096 TTTTTTAAATAATTGAGACAGGG - Intergenic
1010802333 6:80191075-80191097 ATGGTTAAACAATGCAAACCAGG - Intronic
1011226397 6:85112095-85112117 ATCTATAAATAATTCAGACTTGG - Intergenic
1012033592 6:94103496-94103518 ATGTTTTAAAAATTAATACAAGG - Intergenic
1012801102 6:103829537-103829559 AGCTTTTAACCATTCAGACATGG + Intergenic
1013421990 6:109975618-109975640 CTGATTAAACACTTCACACAAGG + Intergenic
1013811978 6:114055171-114055193 ATGTTTCAAAAACTCAGACCAGG - Intergenic
1015051187 6:128842361-128842383 GTGGTAAAACAATTCACACAAGG + Intergenic
1015513131 6:134059387-134059409 ATTTTTAAAAAATTTAGACAGGG - Intergenic
1015778787 6:136841951-136841973 ATGTTTAAAATATTAGGACATGG - Intronic
1017559585 6:155612977-155612999 ATGTTTAAACAAGTTATGCAAGG - Intergenic
1018051006 6:160007951-160007973 ATCTTTAATCCATTTAGACAGGG + Intronic
1018491779 6:164301422-164301444 ATGTTTAAAGAGGTCAGACATGG - Intergenic
1021080667 7:16360582-16360604 ATGTTCAAATAATTTTGACAAGG + Intronic
1021865592 7:24953604-24953626 GTGATCAAACAGTTCAGACAGGG + Intronic
1022141032 7:27492810-27492832 ATCTTTAAACATATCAGGCATGG + Intergenic
1022641970 7:32195677-32195699 ATTTTTAAAAATTTGAGACAGGG - Intronic
1023248202 7:38229750-38229772 ATGTTAAAACATTTTAGAAAAGG - Intronic
1024003240 7:45205496-45205518 ATGTTTAAAGAATTAAAAGAAGG - Intergenic
1024350991 7:48363867-48363889 ATATTTAAACAATTTAAACAAGG - Intronic
1024489437 7:49961340-49961362 ATGCTAATAAAATTCAGACAAGG + Intronic
1025488155 7:61077576-61077598 ATTTTTAAAAAATTAAGAGAGGG + Intergenic
1025556826 7:62319533-62319555 ATTTTAAAACAATTAAGAGAGGG + Intergenic
1025987280 7:66464621-66464643 ATTTTTAAATAATAGAGACAGGG - Intergenic
1026003550 7:66582187-66582209 ATTTTTAAATAATAGAGACAGGG - Intergenic
1026958933 7:74396387-74396409 ATTTTTAAAAAATAGAGACAGGG - Intronic
1027210556 7:76143487-76143509 ATTTTTAAATAATAGAGACAGGG - Intergenic
1027284205 7:76631765-76631787 ATGTTTACAAAGTTGAGACATGG + Intergenic
1027329278 7:77074554-77074576 TTGTTCAAACACTTAAGACATGG - Intergenic
1027427106 7:78072129-78072151 ATTTAGAAATAATTCAGACAAGG + Intronic
1028100151 7:86809365-86809387 ATGTTTTAAAAATTCACAGAGGG + Intronic
1028611606 7:92718190-92718212 ATGTTTTAACAAAACAGACCTGG + Intronic
1029324527 7:99794661-99794683 AAGTTTAAATAACTCAGACAGGG - Intergenic
1029582455 7:101446316-101446338 ATGTGTACACAATGGAGACATGG - Intronic
1030717962 7:112832947-112832969 ATTTTTTAAAAATTGAGACAAGG + Intronic
1033067342 7:138168701-138168723 ATGTTGCCACAAGTCAGACAGGG - Intergenic
1035816411 8:2545964-2545986 ATGTTGAAATAAGGCAGACAAGG + Intergenic
1037074185 8:14693046-14693068 CTGTTTATACATTTCAGGCACGG + Intronic
1038128505 8:24701724-24701746 ATTTTTCCAAAATTCAGACAAGG - Intergenic
1038153926 8:24969159-24969181 ATGTTTGAAGAATGCAGACTTGG + Intergenic
1038709747 8:29932397-29932419 ATGTTTCAACAACTCAGCCATGG - Intergenic
1039099637 8:33927440-33927462 AAGTTTAAACACATTAGACATGG - Intergenic
1039142906 8:34413335-34413357 ATGTCTACACAATTCATGCATGG + Intergenic
1039456896 8:37713231-37713253 CTTTTTAAAAAATTGAGACAGGG - Intergenic
1041333476 8:56753362-56753384 ATTTTTAAAAAAATCAGAGAAGG - Intergenic
1042685661 8:71437267-71437289 ATTTTTAAAAAATTCATTCATGG + Intronic
1042752670 8:72175236-72175258 AGGTTTACACAATGCATACAAGG + Intergenic
1042983506 8:74556961-74556983 ACTTTTAAACGATTCAGAGATGG - Intergenic
1043254447 8:78116151-78116173 TTCTTTAATCATTTCAGACAAGG - Intergenic
1043812990 8:84765797-84765819 AAGTCTAAATAATTCAGTCATGG - Intronic
1044763059 8:95542744-95542766 TTGTCTAAGCAATGCAGACATGG + Intergenic
1045023901 8:98068027-98068049 TTATTTAAAAAATTGAGACAGGG + Intronic
1045958991 8:107945128-107945150 AGGTTTACAGAATTCACACAGGG - Intronic
1046621000 8:116529609-116529631 ATGTATAAACATTTCATAGATGG + Intergenic
1046856048 8:119032958-119032980 ATTTTAAAATAATTCAGAAACGG + Intronic
1047679028 8:127234923-127234945 ATGTTTAAAGAATTCATAACTGG - Intergenic
1053427477 9:38020143-38020165 ATGTTTTAACATTGCAGAGAAGG - Intronic
1053698468 9:40662034-40662056 ATTTTTAAAAAATTAAGAGAGGG + Intergenic
1053944468 9:43292269-43292291 ATTTTTAAAAAATTAAGAGAGGG + Intergenic
1054309757 9:63461435-63461457 ATTTTTAAAAAATTAAGAGAGGG + Intergenic
1054408546 9:64785585-64785607 ATTTTTAAAAAATTAAGAGAGGG + Intergenic
1054441701 9:65269400-65269422 ATTTTTAAAAAATTAAGAGAGGG + Intergenic
1054488584 9:65752098-65752120 ATTTTTAAAAAATTAAGAGAGGG - Intergenic
1057922452 9:99108412-99108434 ATGTTTAACCAAAACACACATGG - Intronic
1058283504 9:103147567-103147589 ATATTTAAATAATTAATACAAGG - Intergenic
1058712854 9:107696085-107696107 ATGGATAGAAAATTCAGACAAGG - Intergenic
1059681937 9:116594110-116594132 ATCTTTAAACAATTGAGATAGGG + Intronic
1060191068 9:121593089-121593111 TTTTTTAAATAATTGAGACAGGG + Intronic
1061571569 9:131480990-131481012 TTTTTTAAACAATAGAGACAGGG - Intronic
1202780831 9_KI270717v1_random:35239-35261 ATTTTTAAAAAATTAAGAGAGGG + Intergenic
1203587604 Un_KI270747v1:20847-20869 ATTTTTAAAAAATTAAGAGAGGG + Intergenic
1185942407 X:4336364-4336386 ATGTCTCAAGAATTCAAACAAGG - Intergenic
1187085723 X:16041357-16041379 ATGTTTTAATACTTCAGGCATGG - Intergenic
1187669264 X:21652271-21652293 AGGATTCAACAATTAAGACAGGG - Intronic
1187783881 X:22862297-22862319 ATGTGTATACAAATCAGCCAAGG + Intergenic
1187923525 X:24229358-24229380 ATGTTCAAAAAGTTAAGACATGG - Intergenic
1188076828 X:25787412-25787434 ATGTTAAAGCACTTCAGAGATGG + Intergenic
1188700569 X:33256143-33256165 ATAATTAGACAATTCAGAGAAGG - Intronic
1189075168 X:37906693-37906715 ATGTTGAAACAATTCATTGAAGG + Intronic
1191000247 X:55652288-55652310 CTGTTCAAAGAATGCAGACATGG + Intergenic
1191992423 X:67052625-67052647 ATGTGTAAAAACTTCAAACAAGG + Intergenic
1193291849 X:79782730-79782752 ATGTTTAAACATCTCAGTTATGG + Intergenic
1193414634 X:81206925-81206947 ATGTATAAACAATTCTGAACAGG - Intronic
1194942979 X:100034630-100034652 CTGTTTCCACAATTCAGTCATGG + Intergenic
1198224070 X:134629532-134629554 ATGTTTTAAAAATTCACAAATGG - Intronic
1199512387 X:148636979-148637001 ATCTTTAAATATTTCAGAGAAGG + Intronic
1201457049 Y:14179927-14179949 TTGCTTTAACAATTCATACAGGG + Intergenic
1202346913 Y:23940670-23940692 AGGTTTTTACAATTCAGAAATGG - Intergenic
1202523858 Y:25729420-25729442 AGGTTTTTACAATTCAGAAATGG + Intergenic