ID: 1162621620

View in Genome Browser
Species Human (GRCh38)
Location 19:11848627-11848649
Sequence GCCCTGGGTATCAGGCCCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162621620_1162621631 7 Left 1162621620 19:11848627-11848649 CCGCAGGGCCTGATACCCAGGGC No data
Right 1162621631 19:11848657-11848679 GTCACTTAGACGTGGGGGGCGGG No data
1162621620_1162621628 2 Left 1162621620 19:11848627-11848649 CCGCAGGGCCTGATACCCAGGGC No data
Right 1162621628 19:11848652-11848674 CCGCTGTCACTTAGACGTGGGGG No data
1162621620_1162621624 -1 Left 1162621620 19:11848627-11848649 CCGCAGGGCCTGATACCCAGGGC No data
Right 1162621624 19:11848649-11848671 CTTCCGCTGTCACTTAGACGTGG No data
1162621620_1162621625 0 Left 1162621620 19:11848627-11848649 CCGCAGGGCCTGATACCCAGGGC No data
Right 1162621625 19:11848650-11848672 TTCCGCTGTCACTTAGACGTGGG No data
1162621620_1162621626 1 Left 1162621620 19:11848627-11848649 CCGCAGGGCCTGATACCCAGGGC No data
Right 1162621626 19:11848651-11848673 TCCGCTGTCACTTAGACGTGGGG No data
1162621620_1162621629 3 Left 1162621620 19:11848627-11848649 CCGCAGGGCCTGATACCCAGGGC No data
Right 1162621629 19:11848653-11848675 CGCTGTCACTTAGACGTGGGGGG No data
1162621620_1162621632 8 Left 1162621620 19:11848627-11848649 CCGCAGGGCCTGATACCCAGGGC No data
Right 1162621632 19:11848658-11848680 TCACTTAGACGTGGGGGGCGGGG No data
1162621620_1162621630 6 Left 1162621620 19:11848627-11848649 CCGCAGGGCCTGATACCCAGGGC No data
Right 1162621630 19:11848656-11848678 TGTCACTTAGACGTGGGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162621620 Original CRISPR GCCCTGGGTATCAGGCCCTG CGG (reversed) Intergenic
No off target data available for this crispr