ID: 1162625612

View in Genome Browser
Species Human (GRCh38)
Location 19:11882199-11882221
Sequence TTGGAGTTCTTTAGGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162625612_1162625618 -3 Left 1162625612 19:11882199-11882221 CCCTCTCCCCTAAAGAACTCCAA No data
Right 1162625618 19:11882219-11882241 CAAGCTCCTAATTCACCAGATGG 0: 1
1: 0
2: 2
3: 12
4: 100
1162625612_1162625622 23 Left 1162625612 19:11882199-11882221 CCCTCTCCCCTAAAGAACTCCAA No data
Right 1162625622 19:11882245-11882267 TTGCCAGGCTAGCAACATGAAGG 0: 1
1: 0
2: 2
3: 7
4: 111
1162625612_1162625620 8 Left 1162625612 19:11882199-11882221 CCCTCTCCCCTAAAGAACTCCAA No data
Right 1162625620 19:11882230-11882252 TTCACCAGATGGCTTTTGCCAGG 0: 1
1: 0
2: 3
3: 22
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162625612 Original CRISPR TTGGAGTTCTTTAGGGGAGA GGG (reversed) Intronic
No off target data available for this crispr