ID: 1162627256

View in Genome Browser
Species Human (GRCh38)
Location 19:11894614-11894636
Sequence CCCTGGGAGGAGTGACTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 2, 2: 2, 3: 38, 4: 272}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162627256_1162627267 1 Left 1162627256 19:11894614-11894636 CCCCTGAGTCACTCCTCCCAGGG 0: 1
1: 2
2: 2
3: 38
4: 272
Right 1162627267 19:11894638-11894660 ACAGACTGAGGTAGGAGAATGGG 0: 2
1: 0
2: 6
3: 247
4: 2248
1162627256_1162627266 0 Left 1162627256 19:11894614-11894636 CCCCTGAGTCACTCCTCCCAGGG 0: 1
1: 2
2: 2
3: 38
4: 272
Right 1162627266 19:11894637-11894659 GACAGACTGAGGTAGGAGAATGG 0: 2
1: 3
2: 115
3: 4433
4: 70216
1162627256_1162627268 2 Left 1162627256 19:11894614-11894636 CCCCTGAGTCACTCCTCCCAGGG 0: 1
1: 2
2: 2
3: 38
4: 272
Right 1162627268 19:11894639-11894661 CAGACTGAGGTAGGAGAATGGGG 0: 2
1: 0
2: 105
3: 1943
4: 1236
1162627256_1162627264 -7 Left 1162627256 19:11894614-11894636 CCCCTGAGTCACTCCTCCCAGGG 0: 1
1: 2
2: 2
3: 38
4: 272
Right 1162627264 19:11894630-11894652 CCCAGGGGACAGACTGAGGTAGG 0: 2
1: 0
2: 4
3: 25
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162627256 Original CRISPR CCCTGGGAGGAGTGACTCAG GGG (reversed) Intronic
900115365 1:1025768-1025790 CCCTGGGTGGGGAGACACAGAGG - Intronic
900351710 1:2238133-2238155 CCCTGGGAGGTCTGTCTGAGAGG + Intronic
901952374 1:12759289-12759311 CCCTGGAAGGACAGACACAGTGG - Exonic
902324751 1:15692514-15692536 GCCTGGGTGGAGTTACTCATGGG - Intronic
902924785 1:19688974-19688996 CCCTGTGAGGAGAGACTGAGGGG + Intronic
903044846 1:20556948-20556970 CATTGGGAGGAGAGACACAGGGG - Intergenic
903904877 1:26677912-26677934 CACTGGGAGGAGTGGGTGAGAGG + Intergenic
904700029 1:32352387-32352409 CCTGGGGAGGAGTGTCTCTGGGG - Intronic
904861910 1:33544649-33544671 GCCTGGGAAGGGTGAGTCAGGGG + Intronic
907220631 1:52904820-52904842 TCCTGGTAGGAGGGACTCAGAGG - Exonic
907522113 1:55030697-55030719 CCCAGAGAGGAGTGGCTTAGTGG - Intergenic
907847178 1:58219490-58219512 CCCTGGGAGAAGGGGCCCAGAGG - Intronic
907968861 1:59361025-59361047 CCCTGGAAGCATTTACTCAGGGG - Intronic
908845799 1:68323151-68323173 CCCTGGGAGGAGGAACTGAGGGG - Intergenic
910040851 1:82850264-82850286 CCCTTGGAGGAGGGATGCAGTGG + Intergenic
912435294 1:109657076-109657098 CCCTGGGATGTGGGACTGAGTGG + Intronic
912439694 1:109688534-109688556 CCCTGGGATGTGGGACTGAGTGG + Intronic
912443006 1:109712983-109713005 CCCTGGGATGTGGGACTGAGTGG + Intronic
915311329 1:155007264-155007286 CCCTGGCAGGGGTGAAACAGAGG + Intronic
915555865 1:156660307-156660329 CCCTGGGGGCTGTGAGTCAGCGG + Intergenic
916893583 1:169137782-169137804 CTCTGGGTGGAAAGACTCAGAGG + Intronic
916961390 1:169893487-169893509 CCCTGCGAGGACCGACTCCGCGG + Intronic
918126426 1:181588125-181588147 CCCTGGGAGTGGTGCCACAGAGG - Intronic
918967381 1:191369232-191369254 CCCATGGAGGAGTGACACAGAGG + Intergenic
919779757 1:201214179-201214201 CCCTGGGAGAAGTGGCCCATGGG - Exonic
920086340 1:203420549-203420571 CTCTTGGAGCAGTGACTTAGAGG - Intergenic
920854721 1:209653140-209653162 AGGTGGGAGGAGTGACTCACAGG - Intergenic
921527028 1:216230030-216230052 CCCTGGGAAGACTGACAAAGGGG + Intronic
924530864 1:244892607-244892629 CCTCGGAAGGAGTGAGTCAGTGG + Intergenic
1066745383 10:38601700-38601722 CCCTGGTAGGCGGGCCTCAGAGG - Intergenic
1067578881 10:47426531-47426553 TCCTGGGAAGAGGGTCTCAGAGG + Intergenic
1068100167 10:52542635-52542657 TCCTGCGAGGACTTACTCAGGGG - Intergenic
1068490121 10:57712703-57712725 CCCTGGGAGAAGTAATACAGTGG + Intergenic
1069627406 10:69876824-69876846 CCCTGGGAGCAGGGACTTTGGGG - Intronic
1069729872 10:70603572-70603594 CCATGGGTGGAGTGACTCACAGG + Intergenic
1070712647 10:78693916-78693938 CCCTGGGATGGGGGAGTCAGGGG + Intergenic
1071487208 10:86110291-86110313 ACCTGGGATGGGTGACCCAGGGG - Intronic
1072660337 10:97360016-97360038 CCCTGGGAGGAAGGAAGCAGAGG + Intronic
1074039232 10:109771715-109771737 CCCTTGTAGGAATGCCTCAGTGG - Intergenic
1074500311 10:114017743-114017765 GCCTGGGAGGGGTCACCCAGTGG + Intergenic
1075125301 10:119694560-119694582 CCATGGGGAGAGTAACTCAGTGG - Intergenic
1075345576 10:121679668-121679690 CTCTGGGAGGAGTGACTGTGTGG + Intergenic
1076422406 10:130340675-130340697 CCCTGGGAGGATGGAGGCAGAGG - Intergenic
1076629053 10:131841822-131841844 CCCTGGGAGGACAGACTCTGGGG + Intergenic
1077385561 11:2268031-2268053 CTCTGGGAGGAGTTAGTGAGAGG - Intergenic
1077985822 11:7350012-7350034 CCCTGGCATGAGTGACTCACAGG - Intronic
1082786086 11:57317689-57317711 CCATGGGGAGAGTGACTCACTGG - Intronic
1084685788 11:70694435-70694457 CCATGGGAAGTGAGACTCAGTGG - Intronic
1084944186 11:72630093-72630115 CCCTGTGAGGGGTGCCTCATAGG - Intronic
1085540860 11:77268570-77268592 TGCTGGGAGGAGAGACTCTGAGG - Intronic
1087151255 11:94861721-94861743 ACCTTGGAGGAATGACACAGGGG + Intronic
1087267602 11:96077696-96077718 ACCTGGGAGGCAGGACTCAGTGG - Intronic
1090697863 11:129266893-129266915 CCTTAGGAGAACTGACTCAGGGG - Intronic
1091278395 11:134367962-134367984 CCCTGGGATGAGCGGCACAGGGG + Intronic
1091406705 12:213824-213846 CCCTGGGAAGCGAGACTCTGTGG - Intronic
1093090118 12:14911351-14911373 CCCTGGGTGGAGTGGCTGGGTGG - Intergenic
1097334812 12:58370261-58370283 CCCTGGGAGGAGTGAGTAAGGGG + Intergenic
1100156420 12:91804961-91804983 CCTGGGGTGGAGTGCCTCAGGGG + Intergenic
1100338975 12:93660029-93660051 CCCTGGGAGGACTGAGAGAGAGG - Intergenic
1101528690 12:105555310-105555332 CCCTGGGGGGAGTAAGTCAGGGG + Intergenic
1101579740 12:106032045-106032067 CCCTGGGGGCAGTGAGGCAGAGG - Intergenic
1103533735 12:121620475-121620497 ATCTGGGAGTGGTGACTCAGAGG - Intergenic
1104640623 12:130464741-130464763 CCCTGGACAGAGAGACTCAGAGG - Intronic
1105675264 13:22664525-22664547 CCCAGGCTGGAGTGACCCAGTGG + Intergenic
1106583332 13:31036316-31036338 CCCAAGGAGGAGTGACTGTGTGG - Intergenic
1112261579 13:97882478-97882500 GCCTTAGAGGAGTGGCTCAGGGG - Intergenic
1112381940 13:98899569-98899591 CCCTGGGTGGGGCGACTTAGTGG + Intronic
1118470742 14:66073254-66073276 GCCTGGCAGGAATGGCTCAGTGG - Intergenic
1118770447 14:68939292-68939314 CCCTGGGAGGGGTGAGGCTGTGG - Intronic
1119086104 14:71740381-71740403 GCCTTGGAAGAGTGACCCAGGGG - Exonic
1120492595 14:85195730-85195752 CCATGGGATGAGTGCCCCAGAGG + Intergenic
1121215293 14:92242873-92242895 CCCTTGGAGGAATGAGTAAGGGG - Intergenic
1121765640 14:96483205-96483227 CGCTGGGAGGAGTGGGTGAGTGG + Exonic
1122321536 14:100858706-100858728 CCAGGGGAGGAGAGAATCAGGGG - Intergenic
1122370438 14:101226357-101226379 CCTAGGGAGGAGAGACACAGGGG + Intergenic
1122899769 14:104777627-104777649 CCCTGAGAGGTGTGAGTGAGTGG + Intronic
1125747759 15:42008705-42008727 ACCTGGGAGGAGGGAGGCAGAGG + Intronic
1127261257 15:57328105-57328127 CCCTGGGTGGTGTGTCTCTGAGG - Intergenic
1127788957 15:62381199-62381221 GCTGGGGAGGAGTGCCTCAGCGG + Intergenic
1128325752 15:66722990-66723012 CCCTGAGATCAGTGACCCAGTGG - Intronic
1128452696 15:67815216-67815238 GCCTGGGTGGAGTGACTGCGAGG + Intergenic
1132945003 16:2527752-2527774 CCCTGGGAGGAGGGAGCAAGTGG - Exonic
1133933479 16:10250808-10250830 CCCTGGGAAGAGTAACACACAGG - Intergenic
1134111919 16:11520699-11520721 CCTTGGGAGAAGTGACCAAGAGG + Intronic
1134490759 16:14693938-14693960 CCCTGGGAGGAGTGAGTGGGGGG + Intronic
1134496140 16:14733056-14733078 CCCTGGGAGGAGTGAGTGGGGGG + Intronic
1134797936 16:17058637-17058659 CCCTGATAGGCGTGGCTCAGTGG + Intergenic
1135005611 16:18819364-18819386 CCCTGGGAGGAGGGACGGATGGG - Intronic
1135413040 16:22249501-22249523 GTATGGGAGGAGTGACTGAGAGG - Intronic
1135776036 16:25258029-25258051 CCCGGGGCGGAGGGACACAGAGG + Intergenic
1136154664 16:28374774-28374796 CCCTGGGAGGAGTGAGTGGGGGG - Intergenic
1136208427 16:28740484-28740506 CCCTGGGAGGAGTGAGTTGGGGG + Intergenic
1136264516 16:29107160-29107182 CCCTGGGAGGAGTGAGTGGGGGG + Intergenic
1136737690 16:32477949-32477971 CCCTGGTAGGCGGGCCTCAGAGG + Intergenic
1137460388 16:48655892-48655914 CCCTGGGATGATTAAGTCAGAGG + Intergenic
1137717299 16:50606026-50606048 CCCTGGGCCGTGTGGCTCAGTGG + Intronic
1138410264 16:56833766-56833788 GCCTGGGATGAGAGAGTCAGGGG + Intronic
1139372108 16:66475406-66475428 ACCTGAGAGGAGTGACTGGGTGG - Intronic
1139404318 16:66706271-66706293 TCCAGGGAGGAGTGGTTCAGGGG + Intergenic
1140453948 16:75093779-75093801 CTCTGGCAGGTGTGCCTCAGTGG + Intronic
1140879640 16:79186430-79186452 CCGTGGGAGGACAGACGCAGAGG - Intronic
1141131790 16:81442553-81442575 CACTGGGTGGAGTGGCCCAGTGG - Intergenic
1141572444 16:84942047-84942069 CCTTGGGCTGAGTGACACAGTGG + Intergenic
1142307519 16:89293843-89293865 CCCTAGGAGGCGTGTGTCAGAGG + Intronic
1203015381 16_KI270728v1_random:351628-351650 CCCTGGTAGGCGGGCCTCAGAGG - Intergenic
1203033716 16_KI270728v1_random:624786-624808 CCCTGGTAGGCGGGCCTCAGAGG - Intergenic
1144659415 17:17058492-17058514 CCCGGGGAGGAGAGCCCCAGGGG + Intronic
1144662536 17:17080525-17080547 CCCTGGGAGGCATGACGCTGAGG - Intronic
1144744550 17:17605068-17605090 CCCTGGCGAGAGTGAGTCAGGGG - Intergenic
1146937990 17:36824387-36824409 CCCTGAGAACAGAGACTCAGAGG + Intergenic
1147162749 17:38577601-38577623 CCCTGGGTGAAGGGACTGAGGGG - Intronic
1148084917 17:44988123-44988145 CCCTGGGCGTAGAGACCCAGCGG - Intergenic
1148152360 17:45404358-45404380 TCCTGGGAGGAGGGACTTGGTGG - Intronic
1149209227 17:54285258-54285280 CCCTAAGAGGAGAGAGTCAGTGG - Intergenic
1149577444 17:57724285-57724307 CCCAGCAAGGAGTGACTCATTGG - Intergenic
1149639233 17:58192487-58192509 CCCTGGGAGAAGTGCATCAGTGG + Intergenic
1152732697 17:81980377-81980399 TCCTGGGAGGAGTTTCTTAGGGG + Intronic
1153563273 18:6393840-6393862 CCCTGGCAGGAGTCAGGCAGAGG - Intronic
1154253927 18:12766804-12766826 CCCTGCAAGGAGGGACTCCGAGG + Intergenic
1158517790 18:58145147-58145169 CCCTGGTAGGAGAGCCTCAGGGG - Intronic
1160072397 18:75640233-75640255 CCCTGGGAGAAGAGACTTATAGG - Intergenic
1160243033 18:77136555-77136577 CCCTGGAGGGAGGGGCTCAGAGG + Intergenic
1160708160 19:539478-539500 CCCTGGGTGGCGGGACCCAGCGG - Intronic
1161554539 19:4933151-4933173 CCCTGGGCAGAGGCACTCAGGGG - Intronic
1162087604 19:8257983-8258005 CCATGGGAGGGCTGACTCACTGG - Exonic
1162627256 19:11894614-11894636 CCCTGGGAGGAGTGACTCAGGGG - Intronic
1162639277 19:11995317-11995339 CTCTGGGAGGTATGACTCAGGGG - Intergenic
1162656881 19:12138005-12138027 CTCTGGGAGGACTGACACAGGGG + Intronic
1162660920 19:12168568-12168590 CTCTGGGAGGAGTCACACAAGGG - Intronic
1162675129 19:12293273-12293295 CTCTGGGAAGAGTGACCCAAGGG + Exonic
1162679718 19:12331694-12331716 CTCTGGGAGGAGTGGCCCAGGGG + Intronic
1162687408 19:12399574-12399596 CCCTGGGAGGAGTGACCCAGGGG + Intronic
1162691722 19:12439426-12439448 CCCTGGGAGGAGTGACCCAGGGG + Intronic
1162705112 19:12549777-12549799 CTCTGGGAGGAGTGACCCAGGGG + Intronic
1162746371 19:12801069-12801091 CCTGGGGAGGAGGGACACAGAGG + Exonic
1162786083 19:13035961-13035983 TCCTGGGAGGAGTGACCAACAGG + Intronic
1162998562 19:14351591-14351613 CCCAGGAAGGAGTGGTTCAGGGG - Intergenic
1163852015 19:19669387-19669409 CCCTGGGAGGAGCGAAGCTGGGG - Intronic
1164670738 19:30070671-30070693 CCCTGGGAGCAAAGACCCAGTGG - Intergenic
1164907831 19:31981977-31981999 CCCTGGGAGGAGGGCATCATGGG - Intergenic
1165595646 19:37009647-37009669 CCCAGGGAGGAGGGAGGCAGAGG + Intronic
1167117683 19:47497675-47497697 CGCTGGTAGGAGTGACTGCGGGG - Intronic
1168588782 19:57615645-57615667 CCCATGGGGGAGTGACACAGAGG - Intronic
926929634 2:18023916-18023938 CCATGGCTGGAGTGGCTCAGAGG + Intronic
927893524 2:26767132-26767154 CCCAGGAAGGAGGGACTCTGGGG - Intronic
928419176 2:31124230-31124252 CCCTGGCAGGAGTGCCACTGGGG - Intronic
932296394 2:70626785-70626807 CCCTGGGAGCTGTGACCCAGGGG + Intronic
932702500 2:74001348-74001370 GCCAGGGAGAAGTGACTCACAGG - Intronic
933201144 2:79450348-79450370 GCATGGGAGGGTTGACTCAGTGG - Intronic
933311517 2:80667128-80667150 CTCTGGAAAGAGAGACTCAGTGG + Intergenic
933937252 2:87216885-87216907 CATTGGGAGGTGTGACTCATTGG + Intergenic
934188814 2:89767062-89767084 CCCTGGTAGGCGGGCCTCAGAGG + Intergenic
934560283 2:95309747-95309769 TCTTGGGAGGAGTGAGTCATGGG - Intronic
934725119 2:96611590-96611612 CCCTGGGAGCAGGGACTATGGGG + Intronic
934808785 2:97264585-97264607 CCCTGGGATGAGTTTCCCAGGGG + Intergenic
934828720 2:97492577-97492599 CCCTGGGATGAGTTTCCCAGGGG - Intergenic
934845477 2:97659276-97659298 CCCGGCGAGGAGGGACGCAGAGG + Intronic
935855933 2:107273985-107274007 CTCAGGCAGGAGTGACACAGAGG + Intergenic
936355891 2:111748939-111748961 CATTGGGAGGTGTGACTCATTGG - Intergenic
937111090 2:119367518-119367540 CCCGGGGAGAGGTGACCCAGGGG + Intronic
937487509 2:122330808-122330830 CCCTGGGAGGACTGTCTGAATGG + Intergenic
938584762 2:132679357-132679379 CCCTGGGAGAAGTGAATAAGGGG + Intronic
938754599 2:134368145-134368167 CCCTGGAGGGAGTGAGTCTGTGG + Intronic
941736479 2:168982196-168982218 CCCTGGGAAGACAGAGTCAGAGG + Intronic
942801377 2:179880141-179880163 CCATGCGAGGAGTGAGTGAGAGG - Intergenic
943736044 2:191355755-191355777 CCTGGGGAGGAGTGAGTAAGGGG + Intronic
945616370 2:212073529-212073551 CCCTGCAGGGAGTGAGTCAGAGG + Intronic
947447454 2:230174914-230174936 CCCTGGAAGGTGGGACTGAGAGG + Intronic
947745826 2:232506802-232506824 CCCAGGGAGGGGGGACACAGGGG + Intergenic
948542613 2:238701337-238701359 CCCTGGGAGCAGTTTCTCTGTGG + Intergenic
1169569307 20:6889117-6889139 TCCTGGGAGGAGAGCCTCAACGG - Intergenic
1170338878 20:15301141-15301163 CAGTGGAAGGAGTGACTCAGTGG - Intronic
1170673641 20:18458345-18458367 CACTGGCTGGAGTGACTCATAGG - Intronic
1170894614 20:20402215-20402237 CCATGGGAGGGGGGACTCTGGGG + Intronic
1171463036 20:25309558-25309580 CCCAGGTTGGGGTGACTCAGTGG - Exonic
1171477322 20:25422208-25422230 CACTGGGAGGAGGGACACAAAGG - Intronic
1172097744 20:32468467-32468489 CTCTGCCAAGAGTGACTCAGTGG + Intronic
1172670720 20:36632897-36632919 CCCTGGGAGGACAAACTCATGGG + Intronic
1173240678 20:41294122-41294144 CCCAGGGAGTAGTAGCTCAGGGG + Intronic
1173724430 20:45287339-45287361 ACCTGTGATGAGTGACGCAGTGG + Intergenic
1174194918 20:48766323-48766345 CCCTGGGTGGAGTGACACAAAGG + Intronic
1175297139 20:57916189-57916211 CCCTGGGAGGAGGGACAGTGTGG + Intergenic
1178121359 21:29473485-29473507 TCCTGGGAGCAGTGGCTGAGAGG + Intronic
1178389281 21:32185250-32185272 CCTGGGGAGGAGTGAGTGAGGGG - Intergenic
1178888921 21:36504857-36504879 CTCTGGGAGCAGTGACTCATGGG - Intronic
1179152333 21:38819696-38819718 CCAAGAGAGGAGTGACCCAGTGG + Exonic
1179165190 21:38930047-38930069 CTCAGGGATGAGTAACTCAGAGG + Intergenic
1180110512 21:45645981-45646003 CCCTGGTGGCAGTGACTCAGAGG + Intronic
1180534863 22:16387973-16387995 CCCTGGTAGGCGGGCCTCAGAGG - Intergenic
1180635349 22:17259076-17259098 CCCTGGGAGAAGGCACTCTGAGG - Intergenic
1181278675 22:21703295-21703317 CACGGGGAGGTGTGGCTCAGTGG + Intronic
1181382237 22:22515199-22515221 CCCTGGGGGGAGCGAGTCTGAGG + Exonic
1181597399 22:23925292-23925314 CCCATGGGGGAGTGACACAGAGG + Intergenic
1182464661 22:30506842-30506864 CCCTGGGCAGAGTGACAGAGTGG + Intergenic
1182619326 22:31610169-31610191 GACTGGGAGGAGGGACTGAGGGG + Intronic
1182703495 22:32260056-32260078 CCCTGGGCTGGGGGACTCAGGGG + Intergenic
1183097007 22:35558365-35558387 CCCTGGGCAGAGTGGCTCTGTGG - Intergenic
1183415153 22:37677411-37677433 CGCAGGAAGGAGGGACTCAGGGG - Intronic
1183688233 22:39374256-39374278 CCCTGGGTGGTGTGAGGCAGGGG + Intronic
1184065313 22:42115590-42115612 CCCATGAAGGAGTGACACAGAGG - Intergenic
1184679458 22:46062184-46062206 CCCCGGGAGCAGTGTCTCTGCGG - Intronic
1184744113 22:46446166-46446188 CCCTGGGAGGAGGGAGACAGTGG - Intronic
1184843416 22:47065987-47066009 CACAGGGTGGCGTGACTCAGAGG - Intronic
1185225702 22:49650823-49650845 TCCTGGGAGGAGAGCCTCACAGG + Intronic
949479044 3:4475960-4475982 CCCAGGGATGTGTGACTAAGGGG + Intergenic
950622196 3:14214915-14214937 ACCTGGGAGGTGTGGCTGAGAGG - Intergenic
954279848 3:49569567-49569589 CTCTGGGAGCTCTGACTCAGTGG + Intronic
954580245 3:51699342-51699364 CCCAGGGACAAGTGAGTCAGGGG + Intronic
954691715 3:52399248-52399270 CCCAGGGAGGAGAGGCTCTGAGG + Intronic
955625377 3:60912858-60912880 CCCAGTGATGAGTGACTCAAAGG - Intronic
955819942 3:62886060-62886082 CCCTGGGAACAGAGGCTCAGGGG + Intergenic
956614643 3:71158435-71158457 CCTTAGGATGAGTGCCTCAGAGG - Intronic
958579875 3:96004419-96004441 CCCTGATAGGATTGGCTCAGTGG + Intergenic
959177055 3:102926718-102926740 CCCATGGGGGAGTGACACAGAGG - Intergenic
960046133 3:113200335-113200357 CCCAGGGAGGAGAGAGGCAGGGG - Intergenic
961591076 3:127982406-127982428 CCCTGGGATGACTGAGGCAGAGG - Intronic
961640707 3:128363266-128363288 CCCAGGGAGGTGTGCCACAGAGG + Intronic
963749012 3:149155640-149155662 TCCTGGGGGGAGGGACCCAGAGG + Intronic
964630192 3:158801968-158801990 CGCTGGGAGGACGGACCCAGCGG - Exonic
968655627 4:1777346-1777368 CTGTGGGAGGACAGACTCAGAGG + Intergenic
969540236 4:7784176-7784198 CCCAGGGAGGATTGGCTGAGGGG + Intronic
969586383 4:8096692-8096714 CTCTGGGAGGAACGAGTCAGGGG + Intronic
969640768 4:8397167-8397189 CCTTGGGCAGAGTGGCTCAGAGG + Intronic
969749309 4:9098108-9098130 CCCGTGGAGGATTGACACAGTGG + Intergenic
970456718 4:16230128-16230150 CCCTGGAAAGAGGGTCTCAGAGG + Intergenic
977002217 4:91518781-91518803 CCCTGGGAAGAGTCTCTCAAAGG - Intronic
977819741 4:101458166-101458188 CTCTGGGAGCACTGTCTCAGGGG - Intronic
977840374 4:101695417-101695439 GCCTAGGAGGGGTGAGTCAGTGG + Intronic
980150817 4:129046323-129046345 GCCTGGGGGTAGTGACTTAGGGG - Intronic
981011399 4:139928816-139928838 ACCTGTCAGGAGTGACACAGTGG + Intronic
985191218 4:187375444-187375466 CCCTTGGAGGAATAATTCAGAGG - Intergenic
985639849 5:1058498-1058520 CCCTGGGACGAGTGGCTCCCCGG - Intronic
985647577 5:1092276-1092298 CGCTGGCAGGAGGCACTCAGGGG + Intronic
985881218 5:2640533-2640555 CCCTGGGTGTAGGGACTGAGTGG + Intergenic
986016562 5:3762624-3762646 CCCTGGGAAGAGTCACTGATGGG - Intergenic
986410304 5:7473052-7473074 CCCTGGGATGGGTTTCTCAGTGG + Intronic
996332184 5:122342319-122342341 CCCTGGGAGCAGTGACTCCATGG - Intronic
998476267 5:142424664-142424686 CCCTGGCAGGAGTAACTGAGGGG - Intergenic
999553867 5:152720258-152720280 CCATGGGGGGAGTGACACACAGG + Intergenic
999554480 5:152724835-152724857 CCATGTGGGGAGTGACACAGAGG + Intergenic
999957114 5:156714601-156714623 CCCTAGGAGCAGTGGCTCAAAGG + Intronic
1001408993 5:171496839-171496861 AGCTGGGAAGAGAGACTCAGAGG + Intergenic
1001844069 5:174904905-174904927 TCCTGGGATGAGTGCCTGAGGGG + Intergenic
1002056385 5:176600029-176600051 CACTGGGAGCAGTGAAGCAGGGG - Intronic
1002415545 5:179119149-179119171 CTCTGGGAAGAGAGACTGAGTGG + Intronic
1002821348 6:727719-727741 CCCTGGGAGGAGGGAGCCAAGGG + Intergenic
1003440365 6:6135205-6135227 CCCTTGGAAGAGGGACTCAAGGG - Intergenic
1005808153 6:29494360-29494382 CCCTAGGATGAGGGAGTCAGGGG - Intergenic
1005997200 6:30938677-30938699 CCCTGAGGGGAGAGAATCAGAGG - Intergenic
1006931662 6:37692500-37692522 GCCTGGGAGGAGTGAGACAGAGG - Intronic
1007706023 6:43791959-43791981 CCCAGGGAGCAGTGAGTCAGAGG + Intergenic
1011926889 6:92656403-92656425 TCTTGGGAGAAGTGACTGAGTGG + Intergenic
1018562513 6:165117366-165117388 CCCTGTTGTGAGTGACTCAGTGG + Intergenic
1018765905 6:166932465-166932487 CCCTGAGGGGAGTGGTTCAGTGG - Intronic
1019261495 7:84385-84407 TCCTGTGAGGAGGGACCCAGCGG - Intergenic
1019774911 7:2906607-2906629 CCCTGGGCAGAGAGACTCTGTGG - Exonic
1019891237 7:3948760-3948782 TCTGGGGAGGAGGGACTCAGTGG + Intronic
1023009860 7:35916939-35916961 TCCTGGGAGAAGTGACACTGTGG + Intergenic
1024080974 7:45854669-45854691 TCCTGGGAGAAGTGACACTGTGG - Intergenic
1025123521 7:56327130-56327152 TCCTGGGAGAAGTGACACTGTGG + Intergenic
1025847775 7:65216379-65216401 TCCTGGGAGAAGTGACACTGGGG + Intergenic
1025898026 7:65722248-65722270 TCCTGGGAGAAGTGACACTGGGG + Intergenic
1026872150 7:73859395-73859417 CCTTGGGTGGGGTGACTCTGAGG + Intergenic
1026944660 7:74307863-74307885 CCCTGGGAGTAGTGTTTCTGGGG + Intronic
1027210825 7:76146983-76147005 CCCTGGAAAGAGGGTCTCAGAGG - Intergenic
1029491147 7:100870756-100870778 GGCTGGGAGGAGGGAGTCAGTGG + Intronic
1032831787 7:135634677-135634699 TCCTGGGAGGAGACTCTCAGAGG + Intronic
1034506327 7:151494741-151494763 CCCAGGGAGGAGAGACCCAAGGG - Intronic
1034677741 7:152903532-152903554 CCCTGGGAGAGGCGACACAGAGG - Intergenic
1034969395 7:155409610-155409632 CCTCGGGAGGAGGGACTCTGCGG - Intergenic
1035721610 8:1797205-1797227 CCCTGGCAGGGGTGACTGTGGGG - Intergenic
1036730527 8:11259022-11259044 GGGTAGGAGGAGTGACTCAGAGG - Intergenic
1037519461 8:19665875-19665897 TCCTGGGAGGTGAGACTAAGAGG - Intronic
1037734418 8:21555255-21555277 CCCTGGGAGGATGGTCTCAGAGG - Intergenic
1039552054 8:38450487-38450509 CCCTGGGAGAAGTGAGTCCTGGG - Intronic
1040289386 8:46116586-46116608 CTCTGGCCGAAGTGACTCAGGGG - Intergenic
1041207006 8:55510083-55510105 CCCTGGGAGGGGAGACACAGGGG - Intronic
1044940464 8:97336717-97336739 ACCTTTGAGGAGTGACTCATGGG - Intergenic
1045618925 8:103952047-103952069 CCCAGGGAGGAGGGAATCTGCGG - Intronic
1047060684 8:121221361-121221383 CCCTGGGAGGTGTGACTTTGTGG + Intergenic
1047212833 8:122853779-122853801 CCCTGGGAGGGGTGACAGTGGGG - Intronic
1048841534 8:138570969-138570991 CACTAGTAAGAGTGACTCAGAGG + Intergenic
1051257678 9:15231979-15232001 CCCTGGTGGGGGTGACTCGGGGG - Intronic
1054859447 9:69933773-69933795 CCCATGGGGGAGTGACACAGAGG - Intergenic
1054912525 9:70467138-70467160 TCCTGGGAGGGGTGAGTCAAAGG - Intergenic
1056395907 9:86180865-86180887 CTCTGTGAGGAGTAACTCAAAGG - Intergenic
1056599763 9:88037582-88037604 CCCCTGGGGGAGTGACACAGAGG - Intergenic
1057865245 9:98675092-98675114 ACCTGGGAGCTCTGACTCAGAGG + Intronic
1058958115 9:109968168-109968190 CCCTGGGAGAAGTGCCAGAGAGG - Intronic
1059438485 9:114289976-114289998 CTCTGGAAGGAGGGACTGAGAGG - Intronic
1059932236 9:119272521-119272543 CGCTGGGAAGAATGCCTCAGGGG + Intronic
1060330901 9:122669425-122669447 CCCATGGCGGAGTGACACAGAGG - Intergenic
1060698783 9:125732491-125732513 AACTGGGAGGAGTGAGGCAGAGG - Intergenic
1060967873 9:127721590-127721612 CCCTGGCAGGAGTGACTTCGGGG + Intronic
1060968275 9:127723680-127723702 CCCTGGCAGGAGTGACTCCAGGG + Intronic
1061080256 9:128365499-128365521 CCCTGTGAGGAGTAAATTAGGGG + Intergenic
1061374752 9:130217312-130217334 CCCTGGGAACAGAGACTGAGGGG + Intronic
1061679894 9:132237793-132237815 CCCTGGGAGGTGTGGCCCTGGGG + Intronic
1061887722 9:133601051-133601073 CTCTGGGAGCAGGGCCTCAGAGG + Intergenic
1061994556 9:134177068-134177090 ACATGGGAGGAGAGACACAGGGG - Intergenic
1062208972 9:135353037-135353059 CCCTGGGATGAGTGCCTCAAAGG - Intergenic
1187151451 X:16685364-16685386 CCCTGGTAGGTGTGACCCAGTGG - Intronic
1187191086 X:17035713-17035735 CCCTGGGATGAGTGGCTGTGCGG - Intronic
1188393730 X:29654626-29654648 TCGTGGGAGGAGGGACCCAGTGG - Intronic
1190620296 X:52280834-52280856 CCCATGGGGGAGTGACACAGAGG - Intergenic
1192784782 X:74325235-74325257 GCCTGGGAGGTGAGATTCAGAGG + Intergenic
1192802765 X:74483126-74483148 ACCTCTGAGGAGTGACACAGAGG - Intronic
1192803842 X:74493085-74493107 GCCTGGGAGGTGGGATTCAGAGG - Intronic
1194044429 X:88984246-88984268 CCCATGGGGGAGTGACACAGAGG - Intergenic
1194853343 X:98896918-98896940 CCCTGGGACAAGTCACTCAAAGG + Intergenic
1195428730 X:104763798-104763820 TCATGGGAGGAGGGACCCAGGGG - Intronic
1197262491 X:124333542-124333564 CCCTGGGCCCAGGGACTCAGAGG - Intronic
1199759125 X:150891858-150891880 GCCTGGGAGGACTGGCTCAAGGG - Intronic
1200944053 Y:8814606-8814628 ACCTGGCAGGAGTGACGTAGAGG - Intergenic
1201940370 Y:19452324-19452346 CCCAGGGGGGAGTGACACAGAGG + Intergenic