ID: 1162633383

View in Genome Browser
Species Human (GRCh38)
Location 19:11946206-11946228
Sequence GCTCATTTACGATCTAAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 61}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162633383_1162633388 -9 Left 1162633383 19:11946206-11946228 CCAGTCTTAGATCGTAAATGAGC 0: 1
1: 0
2: 1
3: 2
4: 61
Right 1162633388 19:11946220-11946242 TAAATGAGCTGCCAAGGGAGGGG 0: 5
1: 18
2: 35
3: 33
4: 255
1162633383_1162633392 30 Left 1162633383 19:11946206-11946228 CCAGTCTTAGATCGTAAATGAGC 0: 1
1: 0
2: 1
3: 2
4: 61
Right 1162633392 19:11946259-11946281 ACATTCTCTCTTGTCTGTTCTGG 0: 1
1: 1
2: 1
3: 26
4: 226
1162633383_1162633387 -10 Left 1162633383 19:11946206-11946228 CCAGTCTTAGATCGTAAATGAGC 0: 1
1: 0
2: 1
3: 2
4: 61
Right 1162633387 19:11946219-11946241 GTAAATGAGCTGCCAAGGGAGGG 0: 3
1: 4
2: 32
3: 48
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162633383 Original CRISPR GCTCATTTACGATCTAAGAC TGG (reversed) Intronic
904809496 1:33154157-33154179 GCTCATTTAAGATCTAAAGATGG + Intronic
909464946 1:75963110-75963132 TCTCATTTTCTATCTAACACAGG + Intergenic
910821939 1:91360199-91360221 GCCCATTTACAATTTAAGATTGG - Intronic
911198700 1:95021963-95021985 GCTCATTTTGGATCTGAGGCTGG - Intronic
912570320 1:110616512-110616534 GCTTATTTATGATCTAACTCTGG - Intronic
914931277 1:151935898-151935920 GCTCATTTAATATCTAGTACTGG - Intergenic
922148178 1:222970027-222970049 TCTCATTTACTATCTCAGAAAGG - Intronic
1074282097 10:112062363-112062385 GCTCCTTTTCTATTTAAGACAGG + Intergenic
1074835198 10:117285096-117285118 GCTAATTTACGGTTTAAAACTGG + Exonic
1084261617 11:67982515-67982537 GCTCGTTTACGACCCAAAACGGG - Intergenic
1086105179 11:83139697-83139719 GCTCTTTCAAGATCTAAGAATGG - Intergenic
1090525166 11:127526424-127526446 AATCATTTAGGATCTAATACAGG + Intergenic
1091784879 12:3237312-3237334 GATGACTTACGATCAAAGACAGG + Intronic
1091913664 12:4251874-4251896 ACTCATTAGAGATCTAAGACAGG + Intergenic
1107490988 13:40879773-40879795 GCTCATTTATGGCCTAAGACTGG - Intergenic
1107544670 13:41424605-41424627 GCTCGTTTACGACCCAAAACGGG - Intergenic
1115530292 14:34320864-34320886 GCTCATTTAAGAGCCCAGACTGG + Intronic
1117038287 14:51748602-51748624 GCTCATTGACGACCCAAAACGGG + Intergenic
1139619589 16:68126912-68126934 GCTCATTTAAAATTTAATACAGG + Intronic
1152458497 17:80429484-80429506 GCTCATTTTCCCTCTAAGCCAGG + Intronic
1162633383 19:11946206-11946228 GCTCATTTACGATCTAAGACTGG - Intronic
1163471728 19:17501087-17501109 GCTCATTGAAGCCCTAAGACAGG - Intronic
1163916536 19:20245245-20245267 GCTCATTTAGGACCTAAGACTGG + Intergenic
1163943664 19:20516989-20517011 GCTCACTTACGGCCCAAGACTGG - Intergenic
1163966844 19:20753992-20754014 GCTCATTTAAGACCCAAAACAGG - Intronic
925928820 2:8691049-8691071 GCTGATTCCCGATCTAGGACAGG + Intergenic
931371866 2:61670573-61670595 GCACATTTAGTATCTAAGAATGG + Intergenic
939698631 2:145360651-145360673 GCTCATTTAAGTTCCCAGACTGG + Intergenic
940871700 2:158866200-158866222 GCTCTTTTACGACCCAAAACGGG + Intergenic
1170478928 20:16745721-16745743 GCTCCTTTAGGATCTAAGCATGG - Intergenic
1171407409 20:24920851-24920873 GCTCATTTAAGACCCAAAACTGG + Intergenic
1177355232 21:19998613-19998635 GCCCACTTATGACCTAAGACTGG - Intergenic
949882544 3:8673371-8673393 GCTCGTTTACGATGCAAAACGGG + Intronic
951988397 3:28647331-28647353 TCTCAGTCACTATCTAAGACTGG + Intergenic
961271775 3:125694876-125694898 GCTCGTTTACGACCCAAAACGGG + Intergenic
961274608 3:125717101-125717123 GCTCGTTTACGACCCAAAACGGG + Intergenic
961876893 3:130029931-130029953 GCTCGTTTACGACCCAAAACGGG - Intergenic
961893325 3:130148105-130148127 GCTCATTTAAGACCCAAAACGGG - Intergenic
969025741 4:4170721-4170743 GCTCGTTTACGACCCAAAACGGG - Intergenic
969728973 4:8942387-8942409 GCTCGTTTACGACCCAAAACGGG + Intergenic
969733715 4:8973030-8973052 GCTCGTTTACGACCCAAAACGGG + Intergenic
969785147 4:9451921-9451943 GCTCGTTTACGACCCAAAACGGG + Intergenic
969793305 4:9507090-9507112 GCTCGTTTACGACCCAAAACGGG + Intergenic
969826191 4:9760465-9760487 GCTCGTTTACGACCCAAAACGGG + Intergenic
977156802 4:93584056-93584078 TTTCATTTGTGATCTAAGACCGG - Intronic
997536614 5:134627496-134627518 GCTCATTTACTTTTTAAAACCGG + Intronic
1010923710 6:81717306-81717328 TCTCACTTGCAATCTAAGACAGG + Intronic
1017516540 6:155161181-155161203 GCTCATTCCCGATCTGAGCCGGG + Intronic
1020307555 7:6846417-6846439 GCTCTTTTACGACCCAAAACGGG - Intergenic
1024533043 7:50409114-50409136 GCTCATATAGGCTCTGAGACTGG - Intergenic
1027126420 7:75559726-75559748 GCTCACTTTCTATCTCAGACAGG + Exonic
1036239343 8:7069130-7069152 GCTCATTTACAACCCAAAACCGG + Intergenic
1036262542 8:7251995-7252017 GCTCGTTTACGACCCAAAACGGG - Intergenic
1036304045 8:7587563-7587585 GCTCGTTTACGACCCAAAACGGG + Intergenic
1036314581 8:7710534-7710556 GCTCGTTTACGACCCAAAACGGG - Intergenic
1036354900 8:8035555-8035577 GCTCGTTTACGACCCAAAACGGG + Intergenic
1041493785 8:58463991-58464013 GCTGATTTCAGATTTAAGACAGG + Intergenic
1056865328 9:90223658-90223680 GCTCGTTTACGACCCAAAACGGG + Intergenic
1056917682 9:90759229-90759251 GCTCGTTTACGACCCAAAACGGG - Intergenic
1185909487 X:3968987-3969009 GCTCACTTACGGCCCAAGACTGG + Intergenic
1186058462 X:5677208-5677230 GCTCATTTTCAATCTTGGACTGG - Intergenic
1194095490 X:89633644-89633666 GCATATTTATGAGCTAAGACTGG - Intergenic
1197922809 X:131613276-131613298 TCTCTTTTATGATCTAGGACAGG - Intergenic
1200448123 Y:3289823-3289845 GCATATTTATGAGCTAAGACTGG - Intergenic
1200925158 Y:8647694-8647716 GCTCATTTACAACATAAGACTGG + Intergenic