ID: 1162633387

View in Genome Browser
Species Human (GRCh38)
Location 19:11946219-11946241
Sequence GTAAATGAGCTGCCAAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 3, 1: 4, 2: 32, 3: 48, 4: 188}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162633378_1162633387 28 Left 1162633378 19:11946168-11946190 CCATTTTGTTTCTTCTTTAACTG 0: 1
1: 2
2: 11
3: 147
4: 1386
Right 1162633387 19:11946219-11946241 GTAAATGAGCTGCCAAGGGAGGG 0: 3
1: 4
2: 32
3: 48
4: 188
1162633383_1162633387 -10 Left 1162633383 19:11946206-11946228 CCAGTCTTAGATCGTAAATGAGC 0: 1
1: 0
2: 1
3: 2
4: 61
Right 1162633387 19:11946219-11946241 GTAAATGAGCTGCCAAGGGAGGG 0: 3
1: 4
2: 32
3: 48
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162633387 Original CRISPR GTAAATGAGCTGCCAAGGGA GGG Intronic
900162537 1:1231255-1231277 GGAACTGAGCTGCTAGGGGATGG - Intronic
900362718 1:2297716-2297738 GGAAATGTGCGGCCAAGGGCCGG - Intronic
901542559 1:9929127-9929149 GTAAATGTTCTGCCAACGAATGG + Exonic
901830300 1:11888013-11888035 GTCATGGAGCTGCCAAGCGATGG + Intergenic
901918526 1:12519240-12519262 GCAAGTGAGCCCCCAAGGGAGGG + Intergenic
905234391 1:36535940-36535962 GTAAATGATGTGCCTAGGGCAGG + Intergenic
906134239 1:43484593-43484615 GTAGATTAGTTGCCCAGGGATGG - Intergenic
910005084 1:82386674-82386696 ATAAATGAGCTGACAAGGCAGGG - Intergenic
910239114 1:85067328-85067350 GTAAATGAGCTGTTCAGGTAAGG + Intronic
910872884 1:91851152-91851174 GTTTAAGAGCTGGCAAGGGAGGG + Intronic
911973834 1:104466939-104466961 GCAAGCGAGCTGCCAAGGGAGGG + Intergenic
912515229 1:110212626-110212648 GTAAATGAGGTGGCACGGCATGG - Intronic
912770862 1:112463290-112463312 ATATATGAGCTGTCCAGGGAAGG - Intronic
914348963 1:146823217-146823239 GTAAGAGAGCTCCAAAGGGAGGG + Intergenic
915653224 1:157334935-157334957 CTCAATCAACTGCCAAGGGATGG - Intergenic
921837066 1:219789187-219789209 GTAAATAAGCAGCCCAGAGAGGG + Intronic
922325509 1:224524681-224524703 GAAAATGAGAAGCCAAGGGGTGG + Intronic
923066131 1:230518981-230519003 GTAAAGAAGCTGCCAAGGCCGGG + Intergenic
923978210 1:239288894-239288916 GTAAGTAAGATGCCAAGGAAGGG - Intergenic
924089884 1:240491366-240491388 GTGAATGAGCTGCCATTGGTGGG - Exonic
1062957888 10:1552215-1552237 GTCCATGAGCTGCAAAGGAAAGG - Intronic
1063991247 10:11566102-11566124 GAAAATGAGCTGGGAAGGGCAGG + Intronic
1064394994 10:14974547-14974569 GTAAACCAGCTGTCGAGGGAGGG + Intronic
1064396042 10:14982676-14982698 GTAGACGAGCTGCCAAGGGAGGG + Intronic
1064397742 10:14994863-14994885 CTAAACGAGCTGCCGAGGGAGGG + Intergenic
1066389920 10:34970326-34970348 ATAAAAGAGCTGCTAAGGGAGGG - Intergenic
1068579672 10:58724942-58724964 GACACTGGGCTGCCAAGGGAGGG - Intronic
1068779054 10:60899897-60899919 GAAAATGAGGTGGCTAGGGAGGG + Intronic
1068881073 10:62049301-62049323 GTAATGGAGCTGCCGGGGGAGGG + Intronic
1071360615 10:84842762-84842784 AGAAATGAGTTGCCAAGGGTTGG - Intergenic
1072740215 10:97904680-97904702 GCAAATGAGCACCCATGGGAAGG - Exonic
1073663940 10:105509035-105509057 GTTAATGAGATTCCCAGGGAGGG + Intergenic
1077142294 11:1029952-1029974 GTCTAGGAGCTGCCGAGGGAAGG - Intronic
1077509193 11:2946989-2947011 GTAAAGGAGCTGTGCAGGGACGG + Intronic
1077589495 11:3480599-3480621 TTAAACGAGCTGCCAAGGGAGGG + Intergenic
1077855037 11:6115855-6115877 ATGAGTGAGCTCCCAAGGGAAGG + Intergenic
1078474585 11:11620390-11620412 GTCAATGAGCTGTCATGGGAGGG - Intronic
1079118144 11:17653708-17653730 GTAACTGATCTGCAAAGGAATGG - Intergenic
1079604152 11:22343893-22343915 GTTAATGAGCTGCGTAGGGGCGG + Intronic
1080335836 11:31195159-31195181 CTACAAGAGCTCCCAAGGGAGGG + Intronic
1080420018 11:32101346-32101368 GGAAAAGAGCTGCCATGAGAAGG - Intronic
1081163950 11:39785908-39785930 GTCTATGGGCTGCCAAGGGCAGG + Intergenic
1083523292 11:63336587-63336609 GTGAAAGAGCTGCCATGGGATGG - Intronic
1083819581 11:65160610-65160632 GTAAATGAGCCGCCTGGGAAGGG - Intergenic
1084245216 11:67852373-67852395 TTAAACGAGCTGCCAAGGGAGGG + Intergenic
1084261622 11:67982528-67982550 GTAAACGAGCTGCCAAGGGAGGG + Intergenic
1084807009 11:71586022-71586044 ATAAACAAGCTGCCGAGGGAGGG - Intronic
1084811021 11:71611585-71611607 GTAAACAAGCTGCCGAGGGAGGG - Intergenic
1084827472 11:71742205-71742227 TTAAACGAGCTGCCAAGGGAGGG - Intergenic
1084870197 11:72093501-72093523 GTAAATGAGGAGCCAAGGACAGG + Exonic
1085486850 11:76871728-76871750 GAAAACGAGCTGGAAAGGGAAGG + Intronic
1085789597 11:79485692-79485714 CTAAATGATCAGCCAGGGGAGGG + Intergenic
1087984759 11:104664051-104664073 GTAAATGAGCTACTCAGTGAAGG + Intergenic
1088652887 11:111974063-111974085 TGAAATGAGCTGCCAAGGCAAGG - Exonic
1091448802 12:560106-560128 AGAAATGTGCTGCCAAGAGAAGG + Intronic
1092107602 12:5933463-5933485 ATAAATGAGGTGCCAGGAGAAGG + Intronic
1092415785 12:8289505-8289527 TTAAACGAACTGCCAAGGGAGGG + Intergenic
1092432909 12:8423090-8423112 ATAAACGAGCTGCCGAGGGAGGG + Intergenic
1092435504 12:8443719-8443741 TTAAACGAGCTGCCGAGGGAGGG + Intergenic
1092965183 12:13634536-13634558 GTAGTTGAGCTGTCAGGGGAGGG + Intronic
1093966113 12:25328003-25328025 GTTAATGAACTGCCATGAGAGGG + Intergenic
1097755124 12:63399887-63399909 TTAAATAAGCTGCCACGGAAAGG + Intergenic
1098651472 12:72976066-72976088 GTTAATGAGCTGGCCAGGCACGG + Intergenic
1098721635 12:73907038-73907060 GTAAATGAGCAGACAAGACAGGG - Intergenic
1098985989 12:77012897-77012919 CAAAATGAGCTGCCATGGTAGGG + Intergenic
1100473427 12:94914232-94914254 GTAGATGGGCTGGCCAGGGAAGG - Intronic
1102325588 12:111980389-111980411 ATCAATGAGTTGCCAAGGAAAGG + Intronic
1102737187 12:115172756-115172778 GTGAAAGACCTGCCAAGAGAGGG - Intergenic
1103256550 12:119546472-119546494 TTAAATGAAATGCCAAGGCAGGG - Intergenic
1103409503 12:120700796-120700818 GTAGATCAGCTGCCTAGCGAGGG + Exonic
1104481311 12:129110645-129110667 GCAGAGGAGCTGCCAGGGGAAGG + Intronic
1105448930 13:20481442-20481464 GGAAATTAGCTGCAAAGGGAAGG + Intronic
1107490994 13:40879786-40879808 ATAAATGAGCCACCAGGGGAGGG + Intergenic
1107544675 13:41424618-41424640 GTAAACGAGCTGCCGAGGGAGGG + Intergenic
1109420492 13:62105621-62105643 GTCAATGAGCAGCCATGGGTGGG - Intergenic
1109997516 13:70148197-70148219 GGAAAAGACCTGCAAAGGGAAGG + Intergenic
1110437839 13:75495191-75495213 GTAAAGGGGTTGCCCAGGGATGG + Intergenic
1112377528 13:98857287-98857309 GCAAATGAGCTGCCATGGACTGG + Intronic
1112900599 13:104352655-104352677 TGGAATGAGCTGCCATGGGATGG - Intergenic
1114308065 14:21441590-21441612 GAAAATGAGCTGCCTAGAGCTGG + Intronic
1115701822 14:35961022-35961044 GTAAATGTACAGCCAAGGGCAGG + Intergenic
1115738579 14:36362544-36362566 GTAAAAGAACAGCCGAGGGAAGG + Intergenic
1117038280 14:51748589-51748611 GTCAATGAGCTGCCGGGGGAGGG - Intergenic
1119954188 14:78777670-78777692 GTAAAACAGCAGCCAGGGGAAGG - Intronic
1121861748 14:97325052-97325074 GTAAAAGTGGTGCCAAGGGAAGG + Intergenic
1122142165 14:99668872-99668894 GTCAATGAGCTGCACACGGAAGG - Intronic
1122192042 14:100053073-100053095 TTAAATGAGCTCCTAAGGGTAGG - Intronic
1123075110 14:105664205-105664227 GAAAATCAGCCGCCAAGGTAGGG - Intergenic
1126347332 15:47709792-47709814 GTAAATGTGCAGCCTAGAGAAGG - Intronic
1126854059 15:52820569-52820591 GTAAATGTGATTACAAGGGAAGG - Intergenic
1127775288 15:62259880-62259902 GAAGCTGGGCTGCCAAGGGATGG + Intergenic
1128522401 15:68384515-68384537 GAAAATGAGCTGCAGAGGGCTGG - Intronic
1129408646 15:75336646-75336668 GGACTTGAGCTGCCAAGGGAAGG + Intronic
1132492799 16:242906-242928 GTAAAAGACCTGACACGGGATGG - Intronic
1133870654 16:9682558-9682580 CTAAATGAGTTGCAAATGGAGGG - Intergenic
1136672793 16:31873442-31873464 GTAAGAGAGGTGCTAAGGGACGG + Intergenic
1136687689 16:32004668-32004690 GTAAATGAGGGGCCAGTGGATGG + Intergenic
1138372726 16:56540129-56540151 ATTAATCAGCTGACAAGGGAGGG + Intergenic
1138709366 16:58952178-58952200 GTGAATGAGGTGCCGATGGAGGG + Intergenic
1138933283 16:61688226-61688248 GTAAATTAGCTGCTCAGGCAGGG - Intronic
1139985070 16:70892338-70892360 GTAAGAGAGCTCCAAAGGGAGGG - Intronic
1140754995 16:78059017-78059039 TTAAACGAGCTGCCAAGGGAGGG + Intronic
1141271726 16:82547048-82547070 GTAAGAAAGCTGCCATGGGAGGG + Intergenic
1144020427 17:11236226-11236248 ATAAATGAGCAGCTAAGTGAAGG - Intergenic
1145865345 17:28237707-28237729 TTAAACGAGCTGCCAAGGGAGGG + Intergenic
1146061459 17:29609710-29609732 GTAAATGGGATGCCAAGGAAAGG - Intronic
1146489648 17:33271199-33271221 GTAAAGGAGCAGGCAAAGGAGGG - Intronic
1146493565 17:33300346-33300368 TGAAATGAGGTGCCAAAGGAAGG - Intronic
1147264784 17:39227959-39227981 GCATCTGAGCTGCCCAGGGAGGG - Intergenic
1148785906 17:50146104-50146126 GTACAGGAGATGCCAAGGCAGGG - Intronic
1149306967 17:55357467-55357489 GTATATGAGCAGCCAAGACAGGG + Intergenic
1149445633 17:56711240-56711262 GTGAATGAGCTGCTCAGGAATGG + Intergenic
1150605766 17:66689409-66689431 ACAAATGAGCTCCCAAGGAAAGG - Intronic
1150969002 17:70005273-70005295 GTGAATGAGCTGCCTGGGAAGGG - Intergenic
1154201196 18:12301902-12301924 GGAAAAGAGCTGCTAAGGGTTGG + Intergenic
1160293418 18:77616358-77616380 GGCAATGAGCAGCCAAGGAAGGG + Intergenic
1162312906 19:9917807-9917829 GTAGATGAGGTGGCCAGGGAAGG - Intronic
1162633387 19:11946219-11946241 GTAAATGAGCTGCCAAGGGAGGG + Intronic
1163916531 19:20245232-20245254 CTAAATGAGCCACCAAGGGAGGG - Intergenic
1163966848 19:20754005-20754027 TTAAATGAGCTGCCAAGGGAGGG + Intronic
1164061674 19:21680756-21680778 GTAGATGAGCTGTCAAAGGCTGG - Intergenic
1164463369 19:28466973-28466995 GTTAATGAGCTGGAAAGGAAAGG + Intergenic
925674048 2:6341281-6341303 GAAAATGTGCTGCCATGGCATGG + Intergenic
925917449 2:8616938-8616960 GTACATGAGCTTCCGAGGGACGG + Intergenic
927362615 2:22253693-22253715 GAAAATGAGTTTTCAAGGGAAGG + Intergenic
928927581 2:36595169-36595191 TTAAATGAAGTGCCAAGGGTCGG + Intronic
930682287 2:54269295-54269317 GTAAACAAGATGGCAAGGGATGG + Intronic
930973761 2:57429294-57429316 GTAAATGACCTGACAACTGAAGG - Intergenic
931699532 2:64898513-64898535 TCAAACGGGCTGCCAAGGGAGGG + Intergenic
932189126 2:69724257-69724279 GCAAATGAGGTGCCAGGAGAAGG + Intronic
932349411 2:71020402-71020424 GTAAAGGAGCTGCCGGGGGAGGG - Intergenic
932352998 2:71046891-71046913 ATAAACCAGCTGCCAAGGGAGGG - Intergenic
933935958 2:87204043-87204065 TCAAATGGGCTGCCAAGGGAGGG + Intergenic
934121169 2:88841343-88841365 GTAATTGAGTTGCCCAGGAAAGG - Intergenic
935687965 2:105701270-105701292 CTAAATTTGCTGCCAAGTGATGG - Intergenic
936357189 2:111761786-111761808 TCAAATGGGCTGCCAAGGGAGGG - Intergenic
937638194 2:124180827-124180849 GGAAATGAGCTGGCAGGGGAGGG - Intronic
938635680 2:133223519-133223541 TTAAATGATCTGCCATGGAAAGG - Intronic
939861607 2:147427693-147427715 GTAAATGAGCTGTGAAGGGGAGG - Intergenic
940871695 2:158866187-158866209 GTAAAAGAGCTGCCGAGGGAGGG - Intergenic
940873919 2:158882190-158882212 ATAAATGAGCTGCCAAGGGAGGG - Intergenic
942502993 2:176611738-176611760 GTGAATGAGCAGCCCAGGGCTGG + Intergenic
946603052 2:221372676-221372698 GTAAATGAGTTTTCAGGGGAGGG - Intergenic
947594493 2:231402314-231402336 TTAAACAAGCTGCCAAGGGAGGG - Intergenic
947766321 2:232640167-232640189 GTCAATGACCTGCCAAGACATGG + Intronic
948825497 2:240571793-240571815 GGACAGGAGCGGCCAAGGGAAGG - Intronic
948842155 2:240657118-240657140 GAACATGAGGGGCCAAGGGAGGG + Intergenic
1168961098 20:1870540-1870562 AGATATGAGCTGCCCAGGGAGGG + Intergenic
1172509157 20:35487917-35487939 ATAAATGGGCAGCCAAGTGATGG - Intronic
1175197204 20:57252428-57252450 GTAAGTTACCTGCCAAGAGAGGG + Intronic
1175984790 20:62759250-62759272 GTAATTGAGCTGCCTGGTGAGGG + Intronic
1177372354 21:20220370-20220392 GAAAATGAATTGCCAAGTGAGGG - Intergenic
1179064020 21:38007228-38007250 GTAAATGAGGTGGGCAGGGAAGG + Intronic
1180042991 21:45289677-45289699 GAAAAAGAGCTGGAAAGGGAAGG + Intergenic
1182137557 22:27919719-27919741 GAACCTGAGCTGCCAAGGGCTGG - Intronic
1182680496 22:32075659-32075681 ATAAATGAGTTGCCAAGAGTAGG + Intronic
1184088521 22:42280346-42280368 GTAAATGAGCTGCCTGGGGCTGG - Intronic
1185232492 22:49691217-49691239 CTAAATGAGCTGACATGGGTGGG + Intergenic
949416683 3:3822769-3822791 GGAAATGAGCTGGGAAGAGAAGG + Intronic
949882130 3:8670134-8670156 ATAAACGAGCTGCCAAGGGAGGG - Intronic
949882539 3:8673358-8673380 GTAAACGAGCAGCCGAGGGAGGG - Intronic
953206854 3:40838603-40838625 GTGGATGAGCTGTCAAGGGATGG - Intergenic
953683322 3:45056705-45056727 GCAAATGAGCCGCCAAAGGAAGG - Intergenic
953929549 3:46999134-46999156 GTGAATGGGATGCCAGGGGAGGG - Intronic
957044899 3:75365905-75365927 ATAAACGAGCTGCCGAGGGAGGG + Intergenic
957076693 3:75608101-75608123 ATAAACGAGCTGCCGAGGGAGGG + Intergenic
958270305 3:91491321-91491343 ATTAATGAGTTGCCATGGGAAGG + Intergenic
961271770 3:125694863-125694885 GTAAACGAGCTGCCAAGGGAGGG - Intergenic
961274603 3:125717088-125717110 GTAAACGAGCTGCCGAGGGAGGG - Intergenic
961277525 3:125739720-125739742 ATAAACGAGCTGCCGAGGGAGGG - Intergenic
961554107 3:127685809-127685831 ATGAATGAGTGGCCAAGGGAGGG - Intergenic
961876898 3:130029944-130029966 GTAAACGAGCTGCCGAGGGAGGG + Intergenic
961893330 3:130148118-130148140 TTAAATGAGCTACCAAGGGAGGG + Intergenic
962048727 3:131789995-131790017 CTAAATGATCTGACAAGGGGAGG - Intronic
964626363 3:158763899-158763921 GTCTATGTGCTGCCAAGGGCAGG - Intronic
968989175 4:3897145-3897167 GCAAACGAGCTGCCGAGGGAGGG + Intergenic
969020147 4:4134395-4134417 ATAAACGAGCTGCCGAGGGAGGG + Intergenic
969024847 4:4164789-4164811 TCAAACGAGCTGCCAAGGGAGGG + Intergenic
969025747 4:4170734-4170756 GTAAACGAGCTGCGGAGGGAGGG + Intergenic
969728968 4:8942374-8942396 GTAAACGAGCTGCCGAGGGAGGG - Intergenic
969733710 4:8973017-8973039 GTAAACGAGCTGCCGAGGGAGGG - Intergenic
969793301 4:9507077-9507099 GTAAACGAGCTGCCGAGGAAGGG - Intergenic
969826186 4:9760452-9760474 GTAAACGAGCTGCCGAGGGAGGG - Intergenic
973644646 4:52937784-52937806 GAAAGTGAGCTGGCAAGTGAAGG + Intronic
979267053 4:118716013-118716035 GGAAAAGAGCTGACAAGGGAAGG - Intergenic
981604506 4:146527464-146527486 GTAGACGAGCTGCCAAGGGAGGG - Intergenic
983217436 4:165015343-165015365 GTGAATGAGCTCTCAAGGAATGG + Intergenic
983626830 4:169810089-169810111 GTAAATGAGATGTCAATGAAGGG + Intergenic
984129205 4:175852042-175852064 GAAAATAAGCTCCCAGGGGAGGG + Intronic
984847298 4:184118733-184118755 GCAAATGAGCTGACCTGGGATGG - Intronic
986500831 5:8397771-8397793 GTAAATGAAATGCAAGGGGATGG + Intergenic
988054541 5:26076698-26076720 AAAACTGAGCTGCCAAGTGATGG - Intergenic
993730863 5:91421094-91421116 GTAAACAAAATGCCAAGGGAGGG + Intergenic
997633244 5:135385746-135385768 GGAGATGAGCTGGCCAGGGAAGG - Intronic
998669592 5:144338773-144338795 GAAAATGAGCTGAAAAGGCAAGG + Intronic
1000443827 5:161295915-161295937 ATAAAAGATCTGCCAAGGAAGGG + Intronic
1000991562 5:167916797-167916819 GGAACTGAGCTGCCAAGGCAAGG - Intronic
1002195945 5:177501369-177501391 GGATTTGAGCTGCCAAGGGCTGG + Intergenic
1004415620 6:15421671-15421693 TTAACTCAGCTGCCAAGTGAGGG - Intronic
1005653025 6:27902415-27902437 TTGAGTGAGCTGGCAAGGGAAGG + Intergenic
1006621017 6:35364072-35364094 GTAGATTAGCAGCCAAGGGATGG - Intronic
1007130133 6:39464617-39464639 GGAGATGAGCTGCCAGGCGATGG - Intronic
1008984844 6:57530034-57530056 ATTAATGAGTTGCCATGGGAAGG - Intronic
1009172891 6:60422978-60423000 ATTAATGAGTTGCCATGGGAAGG - Intergenic
1011488240 6:87865574-87865596 GTAAATAAGATGTCAAGGGCTGG - Intergenic
1011564850 6:88663738-88663760 GCAAGCAAGCTGCCAAGGGAGGG - Intronic
1011571191 6:88737579-88737601 GTAAATGAGGTCACAAGGGTGGG + Intronic
1012777107 6:103511157-103511179 GTAAATAAGATAACAAGGGATGG + Intergenic
1013136872 6:107290748-107290770 GTAAATGGCTTGCCCAGGGAAGG - Intronic
1015371225 6:132455882-132455904 GAAAAAGATTTGCCAAGGGATGG + Exonic
1016764480 6:147776735-147776757 TTAAATGCGGTGACAAGGGATGG + Intergenic
1017246075 6:152226731-152226753 GTAAAAGAGCTGGTGAGGGATGG + Intronic
1017967558 6:159279837-159279859 CCAAATGAGCCGCCTAGGGAAGG - Intergenic
1018988683 6:168657133-168657155 CTAAATGTGCTGCCAAGGTCTGG + Intronic
1020307560 7:6846430-6846452 GTAAAAGAGCTGCCGAGGGAGGG + Intergenic
1020312018 7:6875249-6875271 GCAAACGAGCTGCCGAGGGAGGG + Intergenic
1020323557 7:6957615-6957637 TTAAACGAGCTGCCAAGGGAGGG + Intergenic
1020564876 7:9782474-9782496 GTAGATGAGCTGCCGAGGAGAGG - Intergenic
1022505923 7:30908595-30908617 GTAAGTGACTTGCCAAGGAAAGG - Intergenic
1023081164 7:36527830-36527852 GAAGATGAGCTGCCCAGGCACGG + Intronic
1029078677 7:97955369-97955391 GTAAACGGGTTGCCGAGGGAGGG + Intergenic
1031606066 7:123769523-123769545 GTGTATGAGCTGCCAAGAAAGGG + Intergenic
1033051341 7:138007127-138007149 GAAAATGAGCTGGAAAGAGACGG + Intronic
1034471260 7:151255550-151255572 GAAGAGGAGCTGCCAAGGAATGG - Intronic
1036239339 8:7069117-7069139 GTAAATGAGCTGCCAAGGGAGGG - Intergenic
1036262546 8:7252008-7252030 GTAAACGAGCTGCCGAGGAAGGG + Intergenic
1036304041 8:7587550-7587572 GTAAACGAGCTGCCGAGGAAGGG - Intergenic
1036314585 8:7710547-7710569 GTAAACGAGCTGCCGAGGAAGGG + Intergenic
1036354896 8:8035542-8035564 GTAAACGAGCTGCCGAGGAAGGG - Intergenic
1036372506 8:8173368-8173390 TTAAACGAGCTGCCAAGGGAGGG - Intergenic
1036493717 8:9250783-9250805 GTAAATGAGCTGCCAAGGGAGGG - Intergenic
1036817117 8:11910497-11910519 TTAAACGAGCTGCCAAGGGAGGG + Intergenic
1036817455 8:11912808-11912830 ATAAACGAGCTGCCAAGGGAGGG + Intergenic
1036820419 8:11935388-11935410 TTAAACGAGCTGCCAAGGGAGGG + Intergenic
1036833845 8:12042003-12042025 GTAAACGAGCTGCCGAGGGAGGG + Intergenic
1036855690 8:12288568-12288590 GTAAACGAGCTGCCGAGGGAGGG + Intergenic
1036878397 8:12492273-12492295 TTAAACGAGCTGCCAAGGGAGGG + Intergenic
1036904014 8:12692411-12692433 ATAAACGAGCTGCCGAGGGAGGG + Intergenic
1036906483 8:12712081-12712103 GTAAAGGAGCTGCCAGGGGAGGG + Intergenic
1036932873 8:12973287-12973309 GTGCATGTGCTGGCAAGGGAAGG - Intronic
1038179674 8:25214663-25214685 ATAAAAGAGGTGCCAGGGGATGG - Intronic
1038798618 8:30730172-30730194 TTAAACGAGCTGCCAAGGGAGGG - Intergenic
1038861484 8:31393314-31393336 GTAAATGAGCTGGGCAAGGAAGG + Intergenic
1039277875 8:35953072-35953094 TCAAATGGGCTGCCAAGGGAGGG - Intergenic
1043519187 8:81026037-81026059 GTAAGTGACTTGCCAAGGAAGGG - Intronic
1043741084 8:83812118-83812140 GGAAAAGAGCTGGAAAGGGAAGG + Intergenic
1044115493 8:88328617-88328639 GTAAAGCAGCTGGCAAGGGCGGG + Intergenic
1046379503 8:113434007-113434029 GGAAATGAAATGCCAAGGAAAGG + Intronic
1049383204 8:142327726-142327748 ATGAAAGAGCTGCCAAGCGAGGG + Intronic
1052766532 9:32646997-32647019 CTAAGTGTGCTGCCAAGAGAAGG + Intergenic
1055624268 9:78158164-78158186 AAAAATGTGCTGCCAAGAGAAGG - Intergenic
1056260990 9:84848171-84848193 GTAAATGAGTTCACAAGGGTAGG - Intronic
1056300252 9:85232861-85232883 GGAAATGAGATGCCGGGGGAGGG + Intergenic
1056760178 9:89408930-89408952 AGCAATGAGCTGCCATGGGATGG + Intronic
1056865323 9:90223645-90223667 GTAAACGAGCTGCCGAGGGAGGG - Intergenic
1056917687 9:90759242-90759264 GTAAACGAGCTGCCGAGGGAGGG + Intergenic
1056972288 9:91216286-91216308 GTAACTCAGCTCCCAAGTGAGGG - Intronic
1057580038 9:96279588-96279610 GAAAATGACCTGGAAAGGGAAGG + Intronic
1058613348 9:106799160-106799182 GAAACTGAGGTGCCAATGGAAGG - Intergenic
1058699299 9:107587657-107587679 GAAAATGAGCTGCGTAAGGAAGG - Intergenic
1059531366 9:115038553-115038575 GTAACTGAGCCAGCAAGGGAGGG - Intronic
1062224672 9:135443007-135443029 TTAAACGAGCTGCCAAGGGAGGG + Intergenic
1185582217 X:1218385-1218407 GTAAGTGAGATGCCAAGGCTGGG - Intergenic
1192561994 X:72133210-72133232 AGAAATGAGCTGCCTTGGGAGGG + Intergenic
1194400044 X:93431270-93431292 TTAAACCAGCTGCCAAGGGAGGG - Intergenic
1194717276 X:97301743-97301765 GTAAATCAGCTGTCAATGCATGG - Intronic
1196122656 X:112067279-112067301 GTAAGAGAGGTGACAAGGGAAGG - Intronic
1196275087 X:113757255-113757277 GTACTTCAGCTGCCAAGGAAGGG - Intergenic
1197288332 X:124623697-124623719 GTAAATCAGCTGCCAAAGTTGGG + Intronic
1197720809 X:129743385-129743407 GAAAAAGCCCTGCCAAGGGAAGG + Intronic
1198339998 X:135704438-135704460 GTAAAAGAGCATCCAGGGGAAGG + Intergenic
1198787154 X:140301255-140301277 GAAAAAGAACTGCCAAGAGATGG - Intergenic
1200911727 Y:8537141-8537163 ATAAATGAGCTGCCAAGGGTGGG - Intergenic
1200925155 Y:8647681-8647703 GTAAATGAGCTGCCAAAGGCGGG - Intergenic
1200947868 Y:8864343-8864365 TTAAACGAGCTGCCAATGTAGGG - Intergenic