ID: 1162633388

View in Genome Browser
Species Human (GRCh38)
Location 19:11946220-11946242
Sequence TAAATGAGCTGCCAAGGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 5, 1: 18, 2: 35, 3: 33, 4: 255}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162633378_1162633388 29 Left 1162633378 19:11946168-11946190 CCATTTTGTTTCTTCTTTAACTG 0: 1
1: 2
2: 11
3: 147
4: 1386
Right 1162633388 19:11946220-11946242 TAAATGAGCTGCCAAGGGAGGGG 0: 5
1: 18
2: 35
3: 33
4: 255
1162633383_1162633388 -9 Left 1162633383 19:11946206-11946228 CCAGTCTTAGATCGTAAATGAGC 0: 1
1: 0
2: 1
3: 2
4: 61
Right 1162633388 19:11946220-11946242 TAAATGAGCTGCCAAGGGAGGGG 0: 5
1: 18
2: 35
3: 33
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162633388 Original CRISPR TAAATGAGCTGCCAAGGGAG GGG Intronic
901457523 1:9371727-9371749 TAAATGAGCTGCCCAGGGCCAGG + Intergenic
901918527 1:12519241-12519263 CAAGTGAGCCCCCAAGGGAGGGG + Intergenic
902701081 1:18172642-18172664 TAAATGAGGTCCTAAGGGTGGGG - Intronic
902973850 1:20074685-20074707 TGAATGAGCTGTCTTGGGAGTGG - Intronic
902986141 1:20155421-20155443 CAAACAGGCTGCCAAGGGAGGGG - Intergenic
904760562 1:32801132-32801154 TAAAAGAGCTTCCCAGGAAGCGG + Intronic
905512535 1:38533500-38533522 TGCATGAGATGCCAGGGGAGAGG - Intergenic
908217844 1:61973218-61973240 TCATTGAGCTGACAAGAGAGTGG + Intronic
908700636 1:66896608-66896630 TAAATGGGTTATCAAGGGAGTGG + Intronic
911973835 1:104466940-104466962 CAAGCGAGCTGCCAAGGGAGGGG + Intergenic
912626022 1:111204776-111204798 TAAAGCAGTTGCAAAGGGAGAGG - Intronic
912962456 1:114208245-114208267 CAACTGCGCTGACAAGGGAGAGG - Intergenic
913049954 1:115108868-115108890 TAAAACAGCTTCCAAGGGGGAGG - Intergenic
914348964 1:146823218-146823240 TAAGAGAGCTCCAAAGGGAGGGG + Intergenic
916557203 1:165903509-165903531 TAAATGACCTGCCTAAGGACTGG - Intronic
917288331 1:173444778-173444800 TAAATGAACTGGGAAGGAAGAGG + Intergenic
917879091 1:179315835-179315857 TAATTCAGCTACCATGGGAGAGG - Intronic
918246682 1:182666751-182666773 AAAAGGAGCTGCCAAGAGACAGG + Intronic
923103179 1:230833707-230833729 TTAATGAGTTACCATGGGAGTGG + Intergenic
1063788226 10:9409223-9409245 TAAATGAGGTCACAAGGGTGGGG + Intergenic
1064110205 10:12532076-12532098 TCAATAACCTGCCCAGGGAGAGG - Intronic
1064394995 10:14974548-14974570 TAAACCAGCTGTCGAGGGAGGGG + Intronic
1064396043 10:14982677-14982699 TAGACGAGCTGCCAAGGGAGGGG + Intronic
1064397743 10:14994864-14994886 TAAACGAGCTGCCGAGGGAGGGG + Intergenic
1066389919 10:34970325-34970347 TAAAAGAGCTGCTAAGGGAGGGG - Intergenic
1066446854 10:35491595-35491617 AAAATTAGGTGACAAGGGAGAGG - Intronic
1068857570 10:61812941-61812963 TAAAGGAGTTGCAAACGGAGTGG + Intergenic
1068881074 10:62049302-62049324 TAATGGAGCTGCCGGGGGAGGGG + Intronic
1070005717 10:72422134-72422156 TAAATGAGGTCACAAGGGTGGGG + Intronic
1070339564 10:75484645-75484667 TAAATGAGGTCACAAGGGTGGGG + Intronic
1070446840 10:76513535-76513557 TAAAACAACTGCCATGGGAGAGG - Intronic
1071331794 10:84568026-84568048 TTAATGAGATTCCTAGGGAGAGG - Intergenic
1073148665 10:101297049-101297071 TAAAGGAGCAGCCAGGGAAGTGG + Intergenic
1074378284 10:112956980-112957002 CAAGTCAGCTGCCAAAGGAGTGG - Intronic
1076381190 10:130025451-130025473 TAAATGAGGTCCTAAGGGTGGGG + Intergenic
1077021184 11:417779-417801 TCCATGGGCTTCCAAGGGAGGGG - Intergenic
1077550665 11:3198721-3198743 TAAATGAGCTGCCTTGTGTGTGG - Intergenic
1077589496 11:3480600-3480622 TAAACGAGCTGCCAAGGGAGGGG + Intergenic
1077634358 11:3831962-3831984 TAAATCAGCTCTCAAAGGAGAGG + Intronic
1078658325 11:13263223-13263245 TTAATGAGCTGGCAGGAGAGTGG - Intergenic
1079478014 11:20851540-20851562 AAAGTGAGCTGAGAAGGGAGAGG - Intronic
1081577421 11:44327857-44327879 TCAATGAGATTCCAAGGGTGAGG - Intergenic
1083277171 11:61603460-61603482 TCAATGAGAGGGCAAGGGAGAGG - Intergenic
1083819580 11:65160609-65160631 TAAATGAGCCGCCTGGGAAGGGG - Intergenic
1083953627 11:65970779-65970801 TTCATGAGCTGCTGAGGGAGGGG + Intronic
1084245217 11:67852374-67852396 TAAACGAGCTGCCAAGGGAGGGG + Intergenic
1084261623 11:67982529-67982551 TAAACGAGCTGCCAAGGGAGGGG + Intergenic
1084580674 11:70021085-70021107 TCACTCAGCTGCCAAGGGGGAGG + Intergenic
1084807008 11:71586021-71586043 TAAACAAGCTGCCGAGGGAGGGG - Intronic
1084811020 11:71611584-71611606 TAAACAAGCTGCCGAGGGAGGGG - Intergenic
1084827471 11:71742204-71742226 TAAACGAGCTGCCAAGGGAGGGG - Intergenic
1085326397 11:75609992-75610014 TTGATGAGTTGCCATGGGAGTGG + Intronic
1085508457 11:77073357-77073379 TAAGCAAGCGGCCAAGGGAGAGG - Intronic
1085789598 11:79485693-79485715 TAAATGATCAGCCAGGGGAGGGG + Intergenic
1086094631 11:83037987-83038009 GAAATAAGCTGCCTTGGGAGTGG + Intronic
1087840371 11:102914579-102914601 TCAGGGAGCTGCCAAGGGATTGG + Intergenic
1087907927 11:103721015-103721037 TAAATGATCTTCCAAGCAAGAGG - Intergenic
1090662790 11:128893679-128893701 TAAAGGAGGAGCCAAGGGTGAGG + Intronic
1091448803 12:560107-560129 GAAATGTGCTGCCAAGAGAAGGG + Intronic
1091593000 12:1856478-1856500 TCAATGAGCTGCCCAGCCAGTGG + Intronic
1092415786 12:8289506-8289528 TAAACGAACTGCCAAGGGAGGGG + Intergenic
1092432910 12:8423091-8423113 TAAACGAGCTGCCGAGGGAGGGG + Intergenic
1092435505 12:8443720-8443742 TAAACGAGCTGCCGAGGGAGGGG + Intergenic
1092997000 12:13959924-13959946 AAAATGAGCATTCAAGGGAGTGG + Intronic
1094807530 12:34107428-34107450 GAACTGCGATGCCAAGGGAGAGG + Intergenic
1095459439 12:42426890-42426912 TAGATGAGCTGGGAAGGAAGTGG + Intronic
1098985990 12:77012898-77012920 AAAATGAGCTGCCATGGTAGGGG + Intergenic
1099221091 12:79915349-79915371 GCAATGACCTGCCAAGGGAATGG - Intronic
1100870245 12:98903320-98903342 TAAAAGAGCTGGCCATGGAGTGG + Intronic
1101724407 12:107377160-107377182 GACATGGGCTGCCTAGGGAGAGG - Intronic
1102619909 12:114186165-114186187 TAAAAAAGCTGCCTAGGGCGAGG - Intergenic
1105662006 13:22506667-22506689 TTAAAGAGCTGTCAAGGAAGTGG + Intergenic
1105693865 13:22869510-22869532 TCAATTAGCTGCAAAGGGAGTGG - Intergenic
1107490995 13:40879787-40879809 TAAATGAGCCACCAGGGGAGGGG + Intergenic
1107544676 13:41424619-41424641 TAAACGAGCTGCCGAGGGAGGGG + Intergenic
1108526490 13:51289989-51290011 TAAATGAGGTGCCCAGGAAATGG + Intergenic
1110509135 13:76328414-76328436 TAAATGAGCTGACAAGCATGGGG - Intergenic
1112370411 13:98788432-98788454 TCACAGAGATGCCAAGGGAGGGG - Intergenic
1112900598 13:104352654-104352676 GGAATGAGCTGCCATGGGATGGG - Intergenic
1114292481 14:21299973-21299995 TAAATGAGTTCACAAGGGTGGGG - Intronic
1114571288 14:23670823-23670845 TAAATGATCTGCAAGAGGAGTGG + Intergenic
1117038279 14:51748588-51748610 TCAATGAGCTGCCGGGGGAGGGG - Intergenic
1117956824 14:61129607-61129629 TGAAAGACCTGCCAAGGGAGAGG + Intergenic
1118721692 14:68599078-68599100 TAAAGCAGCGGCAAAGGGAGCGG - Intronic
1122192041 14:100053072-100053094 TAAATGAGCTCCTAAGGGTAGGG - Intronic
1122827912 14:104380328-104380350 TAAATGAAGTCCCAAGGGTGGGG - Intergenic
1125498258 15:40218392-40218414 GAAATAAGCTGCCATGGTAGAGG + Intronic
1125542089 15:40475498-40475520 AAAAGAAGCTGCCAAGGAAGTGG + Intergenic
1128479929 15:68028309-68028331 TAAAGGAGCAGCCAGGGGAAAGG + Intergenic
1128931440 15:71708193-71708215 TCAATGACCTGCCAAGGCTGGGG + Intronic
1129268509 15:74407577-74407599 TAAATGAGCTGGCAGGGATGAGG - Intergenic
1129405215 15:75312473-75312495 TAAATGAGGTCCTAAGGGTGGGG + Intergenic
1129408647 15:75336647-75336669 GACTTGAGCTGCCAAGGGAAGGG + Intronic
1129461869 15:75703765-75703787 TACAAGCGCAGCCAAGGGAGGGG - Intronic
1129478883 15:75807404-75807426 TAAATGAGGTCCTAAGGGTGGGG + Intergenic
1129480424 15:75820896-75820918 TAAATGAACTAACAAGGGTGAGG - Intergenic
1129722985 15:77888080-77888102 TACAAGCGCAGCCAAGGGAGGGG + Intergenic
1129873631 15:78957810-78957832 TAAATGAGCTGCTACAGGTGAGG - Intergenic
1130510209 15:84582970-84582992 TAAATGAGGTCCTAAGGGTGGGG - Intergenic
1130924403 15:88374490-88374512 TGAATCAGATGCCCAGGGAGTGG - Intergenic
1131167831 15:90155353-90155375 TGAATGAACTGCAAAGGTAGAGG - Intergenic
1131907793 15:97163220-97163242 TAATTCAGCTGTCAAGGAAGAGG - Intergenic
1132089293 15:98934909-98934931 TGAAGGAGTTGCCAAGGGTGTGG + Exonic
1134212477 16:12289315-12289337 TAACTGAGAGGCCAAGGGAGAGG - Intronic
1135223939 16:20639246-20639268 TCACTGAGCTGCCAGGTGAGTGG - Intronic
1135633491 16:24054700-24054722 TAAATGAGCTGTCAACGGCTTGG - Intronic
1136126905 16:28190181-28190203 TCAATCAGCTACCAATGGAGAGG + Intronic
1139985069 16:70892337-70892359 TAAGAGAGCTCCAAAGGGAGGGG - Intronic
1140754996 16:78059018-78059040 TAAACGAGCTGCCAAGGGAGGGG + Intronic
1140815985 16:78621402-78621424 TAAATCAGTTACCAGGGGAGAGG - Intronic
1144020426 17:11236225-11236247 TAAATGAGCAGCTAAGTGAAGGG - Intergenic
1144515254 17:15913031-15913053 TAAATGAGGTGTCAGGTGAGAGG + Intergenic
1145092331 17:19996229-19996251 TTAATGAGTTGTCATGGGAGTGG - Intergenic
1145865346 17:28237708-28237730 TAAACGAGCTGCCAAGGGAGGGG + Intergenic
1148195148 17:45707866-45707888 GAAATGAGTTGGCCAGGGAGAGG - Intergenic
1148785905 17:50146103-50146125 TACAGGAGATGCCAAGGCAGGGG - Intronic
1151143608 17:72018429-72018451 TAAAAATGCTGCCAGGGGAGGGG + Intergenic
1151161726 17:72171584-72171606 TATATGAGATCTCAAGGGAGGGG - Intergenic
1151480570 17:74368202-74368224 TCAAGGAGCTGCCATGGGTGAGG - Intronic
1153420911 18:4903941-4903963 TTTATGAGCTTCAAAGGGAGTGG - Intergenic
1153608875 18:6861642-6861664 TGATTGAGTTGCCAAAGGAGAGG + Intronic
1155143485 18:23064333-23064355 TAAATAAGATGCCAAGTTAGGGG + Intergenic
1158210227 18:55040707-55040729 TTGATGAGCTTCCTAGGGAGGGG - Intergenic
1161227146 19:3151944-3151966 TCAAGGAGCTGCCAAGCTAGGGG + Intronic
1162184603 19:8895085-8895107 TAAATGAATTGCCTAAGGAGAGG + Intronic
1162381007 19:10331975-10331997 TAAATGAGCTGGCTTGGAAGAGG - Intronic
1162633388 19:11946220-11946242 TAAATGAGCTGCCAAGGGAGGGG + Intronic
1162895767 19:13764075-13764097 TAAATGATCTTCCAAGGTTGAGG - Intergenic
1163916530 19:20245231-20245253 TAAATGAGCCACCAAGGGAGGGG - Intergenic
1163966849 19:20754006-20754028 TAAATGAGCTGCCAAGGGAGGGG + Intronic
1166611449 19:44202573-44202595 TAAAAGGGTTGCCAAGGGAGTGG + Intergenic
926139575 2:10360160-10360182 TCCAGGAGCTGGCAAGGGAGGGG + Intronic
928241374 2:29589837-29589859 AGAATCAGCTGCCAAGGGAGTGG + Intronic
928366874 2:30709604-30709626 TAAAGGAGCTGCCAGGCAAGAGG - Intergenic
928927582 2:36595170-36595192 TAAATGAAGTGCCAAGGGTCGGG + Intronic
929126246 2:38524789-38524811 GAAATGAGCTCCCTGGGGAGGGG + Intergenic
929396778 2:41532714-41532736 TAAATGAGGTAACAAGGGTGGGG - Intergenic
930633844 2:53783752-53783774 TAAATGAGCAGGCAAGGTAAAGG + Intronic
930749956 2:54925102-54925124 TAAATGAGTTTATAAGGGAGGGG + Intronic
931217190 2:60257093-60257115 TAGGCAAGCTGCCAAGGGAGAGG + Intergenic
931699533 2:64898514-64898536 CAAACGGGCTGCCAAGGGAGGGG + Intergenic
932349410 2:71020401-71020423 TAAAGGAGCTGCCGGGGGAGGGG - Intergenic
932352997 2:71046890-71046912 TAAACCAGCTGCCAAGGGAGGGG - Intergenic
933935959 2:87204044-87204066 CAAATGGGCTGCCAAGGGAGGGG + Intergenic
935115138 2:100128827-100128849 TAAGTGTGCTGGGAAGGGAGAGG + Intronic
936357188 2:111761785-111761807 CAAATGGGCTGCCAAGGGAGGGG - Intergenic
937214514 2:120303102-120303124 TAAGCCAGCTGCCAAGGCAGGGG - Intergenic
938825650 2:135003004-135003026 TACATGAGGTGTCAAGGGTGGGG + Intronic
939339106 2:140870093-140870115 TTATTGAGATTCCAAGGGAGGGG - Intronic
939830746 2:147067754-147067776 TAACTGAGCTGCAAAGGTGGTGG + Intergenic
940039314 2:149343468-149343490 TCAATGACTTGCCAAAGGAGTGG - Intronic
940595870 2:155792103-155792125 TAATTTAACTGCCAGGGGAGAGG - Intergenic
940774167 2:157869267-157869289 AAAATAATCTGGCAAGGGAGAGG + Intronic
940871694 2:158866186-158866208 TAAAAGAGCTGCCGAGGGAGGGG - Intergenic
940873918 2:158882189-158882211 TAAATGAGCTGCCAAGGGAGGGG - Intergenic
942556004 2:177172709-177172731 TAAAGGAGCTGGGAAGGGTGGGG + Intergenic
942831911 2:180246809-180246831 CAAATGAGCAGCCAAGGATGGGG - Intergenic
943467708 2:188249505-188249527 TGAAAGAGCTGGCTAGGGAGTGG + Intergenic
946085694 2:217169012-217169034 TAAATGAGGTGGAAAGGGAGAGG - Intergenic
947594492 2:231402313-231402335 TAAACAAGCTGCCAAGGGAGGGG - Intergenic
947654390 2:231813783-231813805 TAAATGAGGTCCTAAGGGTGGGG - Intergenic
1168842892 20:921110-921132 GCAAGGAGTTGCCAAGGGAGGGG - Intergenic
1168961099 20:1870541-1870563 GATATGAGCTGCCCAGGGAGGGG + Intergenic
1169213724 20:3781949-3781971 TAAATGACCTGCCAAGGTACTGG - Intergenic
1171094989 20:22324190-22324212 TAAATGGGATGCCAAGATAGAGG - Intergenic
1174214218 20:48903845-48903867 TAAATCGCCTGCCATGGGAGCGG + Intergenic
1175197205 20:57252429-57252451 TAAGTTACCTGCCAAGAGAGGGG + Intronic
1175279631 20:57794438-57794460 TGGATCAGGTGCCAAGGGAGAGG + Intergenic
1175788960 20:61729862-61729884 TAAATGAGACGGCAAGAGAGAGG + Intronic
1176045411 20:63090153-63090175 TCAGTGAGCTGCCAAGGTGGCGG + Intergenic
1177372353 21:20220369-20220391 AAAATGAATTGCCAAGTGAGGGG - Intergenic
1177605652 21:23374872-23374894 TAAATGAGGTCCTAAGGGTGAGG - Intergenic
1178517584 21:33261903-33261925 TAAAGAAGCAGCCAAAGGAGAGG + Intronic
1179117774 21:38509772-38509794 TAAATGAGAAGCAGAGGGAGAGG + Intronic
1181534203 22:23533334-23533356 TAAATGAGAAGAGAAGGGAGGGG + Intergenic
1182375417 22:29843719-29843741 TAAATGATCTACCATGGAAGTGG - Intergenic
1182534624 22:30991552-30991574 TAAATGAGGTCACAAGGGTGAGG - Intergenic
1182678926 22:32063122-32063144 TAAATGAGCTCATAAGGGTGGGG - Intronic
1183287031 22:36973277-36973299 TTCAAGAGCTCCCAAGGGAGGGG + Intergenic
1185232493 22:49691218-49691240 TAAATGAGCTGACATGGGTGGGG + Intergenic
949432365 3:3991566-3991588 TAAATGAGCTTAGAAGGGTGGGG - Intronic
949882129 3:8670133-8670155 TAAACGAGCTGCCAAGGGAGGGG - Intronic
949882538 3:8673357-8673379 TAAACGAGCAGCCGAGGGAGGGG - Intronic
949997550 3:9630401-9630423 TAAATGGGCTGTCTAGGCAGCGG - Intergenic
951679850 3:25283343-25283365 AAAATGACCTGCCATGGAAGAGG - Intronic
952225488 3:31371388-31371410 TGAATGGGCTGTCATGGGAGTGG - Intergenic
953039648 3:39244188-39244210 TAACAGAGCTGACAAGGTAGGGG - Intergenic
953929548 3:46999133-46999155 TGAATGGGATGCCAGGGGAGGGG - Intronic
954469653 3:50681777-50681799 TGAATGAGTTCCGAAGGGAGAGG - Intronic
957021999 3:75137776-75137798 CAAACGGGCTGCCAAGGGCGAGG - Intergenic
957044900 3:75365906-75365928 TAAACGAGCTGCCGAGGGAGGGG + Intergenic
957076694 3:75608102-75608124 TAAACGAGCTGCCGAGGGAGGGG + Intergenic
959646785 3:108712463-108712485 TAAATGAGGTTCTAAGCGAGTGG + Intergenic
960535673 3:118812279-118812301 TAAAGTAGCCGTCAAGGGAGTGG + Intergenic
961271769 3:125694862-125694884 TAAACGAGCTGCCAAGGGAGGGG - Intergenic
961274602 3:125717087-125717109 TAAACGAGCTGCCGAGGGAGGGG - Intergenic
961277524 3:125739719-125739741 TAAACGAGCTGCCGAGGGAGGGG - Intergenic
961313584 3:126019230-126019252 TTAATGAGTTACCATGGGAGTGG - Intronic
961341617 3:126226587-126226609 TAATTGTGTTGCTAAGGGAGAGG + Intergenic
961876899 3:130029945-130029967 TAAACGAGCTGCCGAGGGAGGGG + Intergenic
961893331 3:130148119-130148141 TAAATGAGCTACCAAGGGAGGGG + Intergenic
962240413 3:133746880-133746902 TAGATGTCCTGCCAAGGAAGCGG + Intronic
962390489 3:134967476-134967498 TTAATGAGTTATCAAGGGAGTGG + Intronic
962930947 3:140035414-140035436 AAAATGGGCTGCAAAGGGACAGG - Intronic
963496645 3:146071943-146071965 GTAATGAGCTGATAAGGGAGAGG - Intronic
964172078 3:153782828-153782850 GAAAGGGTCTGCCAAGGGAGAGG + Intergenic
965890130 3:173502769-173502791 TAAAAGTACTGCCAGGGGAGGGG - Intronic
966050075 3:175605168-175605190 CAAATGAGCTGCAAAGGGTCTGG - Intronic
966068023 3:175840071-175840093 TAAATGAGGTGCCACAGGATAGG - Intergenic
966340810 3:178923617-178923639 AAAAGGAGCTCCCAGGGGAGGGG + Intergenic
968989176 4:3897146-3897168 CAAACGAGCTGCCGAGGGAGGGG + Intergenic
969020148 4:4134396-4134418 TAAACGAGCTGCCGAGGGAGGGG + Intergenic
969024848 4:4164790-4164812 CAAACGAGCTGCCAAGGGAGGGG + Intergenic
969547944 4:7844227-7844249 TAAATGAGGTCCTAAGGGTGGGG + Intronic
969728967 4:8942373-8942395 TAAACGAGCTGCCGAGGGAGGGG - Intergenic
969733709 4:8973016-8973038 TAAACGAGCTGCCGAGGGAGGGG - Intergenic
969793300 4:9507076-9507098 TAAACGAGCTGCCGAGGAAGGGG - Intergenic
969826185 4:9760451-9760473 TAAACGAGCTGCCGAGGGAGGGG - Intergenic
969852054 4:9965304-9965326 GAAATGAGCTTCAAAGGGAAAGG - Intronic
971623424 4:28886809-28886831 TAAATCAGCTGTCTAGGCAGTGG - Intergenic
972688934 4:41377844-41377866 TTAATGGGTTACCAAGGGAGTGG - Intronic
973028229 4:45301683-45301705 TAAATTATTTGCCAAGGCAGAGG - Intergenic
978042318 4:104083532-104083554 TAAATTAGCTGGCATGGTAGTGG - Intergenic
978968177 4:114768512-114768534 TAAATGAGGTCATAAGGGAGGGG + Intergenic
980207268 4:129736058-129736080 TATATGAACTGCCCATGGAGAGG - Intergenic
981604505 4:146527463-146527485 TAGACGAGCTGCCAAGGGAGGGG - Intergenic
982373087 4:154656060-154656082 TAAATGAGCTGCCATTGGTAAGG + Intronic
983626831 4:169810090-169810112 TAAATGAGATGTCAATGAAGGGG + Intergenic
985155786 4:186986207-186986229 TACCCGAGCTGCCAAGGCAGGGG - Intergenic
986569194 5:9147858-9147880 TAAATTAGCAGATAAGGGAGAGG + Intronic
986855922 5:11868698-11868720 TTAATGAGTTACCATGGGAGTGG + Intronic
986997318 5:13621925-13621947 TTAATGAGATTCCTAGGGAGGGG - Intergenic
989204594 5:38798131-38798153 TAAATGATCTGGAAAGGGGGAGG - Intergenic
989311098 5:40018771-40018793 TAAATGAGGTGATAAGGGTGGGG + Intergenic
992283572 5:75208538-75208560 TTAATGAGATTCCTAGGGAGGGG - Intronic
993828199 5:92720028-92720050 TATATGAGATCCCAAGGAAGGGG - Intergenic
995912622 5:117205524-117205546 TAACTGAGCTGACCAGGGAGAGG + Intergenic
998081685 5:139280585-139280607 TTAATGTGCTCCAAAGGGAGAGG + Intronic
998207254 5:140166755-140166777 TAAATGATCTTCCAAGCAAGAGG + Intergenic
999191875 5:149754316-149754338 AAACGGAGCTGCCAGGGGAGGGG - Intronic
999585410 5:153084240-153084262 GAAATGTGCTGCCATGGAAGGGG - Intergenic
1000053446 5:157581747-157581769 TAAATGAGGTCACGAGGGAGGGG - Intergenic
1000568815 5:162884284-162884306 TAAGTGAGCTGGGAAGGCAGAGG + Intergenic
1000777098 5:165433272-165433294 TAAATTATATGTCAAGGGAGAGG - Intergenic
1000991561 5:167916796-167916818 GAACTGAGCTGCCAAGGCAAGGG - Intronic
1001186635 5:169580262-169580284 TAAATGAGGTCACAAGGGTGAGG - Intergenic
1001242259 5:170079752-170079774 TAACTGCCCTGGCAAGGGAGGGG + Intronic
1002043748 5:176531014-176531036 TGGATAAGCTGCCAAGAGAGGGG + Exonic
1002545385 5:179939753-179939775 CAAAGGAGTCGCCAAGGGAGGGG - Intronic
1005972471 6:30772144-30772166 TAAATGAGGTCCTAAGGGTGAGG - Intergenic
1008625439 6:53311054-53311076 TAAATGAGCTGACAGGTGACTGG + Intronic
1009404412 6:63293969-63293991 TAAATGAGGGGCAATGGGAGTGG + Intronic
1011564849 6:88663737-88663759 CAAGCAAGCTGCCAAGGGAGGGG - Intronic
1011571192 6:88737580-88737602 TAAATGAGGTCACAAGGGTGGGG + Intronic
1011705070 6:89992942-89992964 TAAATGAGGTCACAAGGGTGGGG + Intronic
1011828287 6:91336828-91336850 TAAATGAGGTCCTAAGGGTGAGG - Intergenic
1013541976 6:111119719-111119741 TAAATGAGGTCACAAGGGTGGGG + Intronic
1014268655 6:119311690-119311712 CAAAGGAACTCCCAAGGGAGAGG + Intronic
1018178666 6:161201167-161201189 AAAATGAGCTGGCAGGGGAGTGG + Intronic
1020307561 7:6846431-6846453 TAAAAGAGCTGCCGAGGGAGGGG + Intergenic
1020312019 7:6875250-6875272 CAAACGAGCTGCCGAGGGAGGGG + Intergenic
1020323558 7:6957616-6957638 TAAACGAGCTGCCAAGGGAGGGG + Intergenic
1023286819 7:38629846-38629868 TAATTCAGCTGCGGAGGGAGAGG + Intronic
1024214404 7:47235102-47235124 TAAATGAGGTCCTAAGGGTGGGG - Intergenic
1024609577 7:51053049-51053071 TATATGTGCTGGGAAGGGAGAGG - Intronic
1025823402 7:64992202-64992224 TAAATTACTGGCCAAGGGAGGGG + Exonic
1026130022 7:67612457-67612479 GAAATGAGCTGCCAAGAGTTAGG + Intergenic
1026179919 7:68029959-68029981 TAAATGAGGTCTCAAGGGTGTGG - Intergenic
1026286296 7:68966128-68966150 TGAAAGAGATGCCAAGGGTGAGG - Intergenic
1028172225 7:87612096-87612118 TCAATGAGTTGCAAAGTGAGTGG + Intronic
1029078678 7:97955370-97955392 TAAACGGGTTGCCGAGGGAGGGG + Intergenic
1029114784 7:98231504-98231526 GAAATGAAGTACCAAGGGAGGGG - Intronic
1031269592 7:119630828-119630850 TGACTGAGCTGGAAAGGGAGGGG + Intergenic
1031606067 7:123769524-123769546 TGTATGAGCTGCCAAGAAAGGGG + Intergenic
1032582676 7:133117757-133117779 GCCATGAGCTGCCAAGTGAGAGG + Intergenic
1035123200 7:156586522-156586544 TATATAAGCTGCAAAGGGAGAGG + Intergenic
1035840825 8:2810485-2810507 TAAAACAGCAGCCAAGGAAGTGG + Intergenic
1036239338 8:7069116-7069138 TAAATGAGCTGCCAAGGGAGGGG - Intergenic
1036262547 8:7252009-7252031 TAAACGAGCTGCCGAGGAAGGGG + Intergenic
1036282582 8:7414525-7414547 TAGTGGATCTGCCAAGGGAGGGG - Intergenic
1036304040 8:7587549-7587571 TAAACGAGCTGCCGAGGAAGGGG - Intergenic
1036314586 8:7710548-7710570 TAAACGAGCTGCCGAGGAAGGGG + Intergenic
1036338890 8:7897024-7897046 TAGTGGATCTGCCAAGGGAGGGG + Intergenic
1036354895 8:8035541-8035563 TAAACGAGCTGCCGAGGAAGGGG - Intergenic
1036372505 8:8173367-8173389 TAAACGAGCTGCCAAGGGAGGGG - Intergenic
1036493716 8:9250782-9250804 TAAATGAGCTGCCAAGGGAGGGG - Intergenic
1036533140 8:9616107-9616129 TAAACGGGGTGGCAAGGGAGAGG - Intronic
1036609937 8:10341013-10341035 TAATTTAGATGCCAAGTGAGAGG + Intronic
1036817118 8:11910498-11910520 TAAACGAGCTGCCAAGGGAGGGG + Intergenic
1036817456 8:11912809-11912831 TAAACGAGCTGCCAAGGGAGGGG + Intergenic
1036820420 8:11935389-11935411 TAAACGAGCTGCCAAGGGAGGGG + Intergenic
1036833846 8:12042004-12042026 TAAACGAGCTGCCGAGGGAGGGG + Intergenic
1036855691 8:12288569-12288591 TAAACGAGCTGCCGAGGGAGGGG + Intergenic
1036878398 8:12492274-12492296 TAAACGAGCTGCCAAGGGAGGGG + Intergenic
1036904015 8:12692412-12692434 TAAACGAGCTGCCGAGGGAGGGG + Intergenic
1036906484 8:12712082-12712104 TAAAGGAGCTGCCAGGGGAGGGG + Intergenic
1037184165 8:16041335-16041357 TTAATCAGCTGCCCAGGAAGGGG + Intergenic
1037846362 8:22286281-22286303 TAAATGAGTGGCCAAGTCAGTGG - Intronic
1038798617 8:30730171-30730193 TAAACGAGCTGCCAAGGGAGGGG - Intergenic
1039277874 8:35953071-35953093 CAAATGGGCTGCCAAGGGAGGGG - Intergenic
1039478904 8:37857334-37857356 TAAGTGAGCAGACAGGGGAGTGG + Intergenic
1039519650 8:38159330-38159352 TAAAGGGGCAGTCAAGGGAGGGG + Intergenic
1041553339 8:59124659-59124681 TAAATGTATTGCCAAAGGAGAGG + Intergenic
1042439991 8:68814368-68814390 TAAAGGTGCTGGCAAGGGAGTGG - Intronic
1043531668 8:81157976-81157998 TGAATGAGCTCCCCAGGGAGTGG - Intergenic
1043536513 8:81210709-81210731 TGGATGAGCTGCCAAGACAGAGG + Intergenic
1046060587 8:109134674-109134696 CAAATGAACAGCCAAGGAAGAGG + Intergenic
1047195102 8:122713897-122713919 CAAGTTAGCTGCCGAGGGAGAGG - Intergenic
1048354937 8:133645748-133645770 CAAGTGAGCTGACAAGTGAGGGG + Intergenic
1050257538 9:3810802-3810824 TAACTGAGATGCTAAGGTAGTGG - Intergenic
1050298531 9:4232269-4232291 TATTTGAGATGCCAAGGCAGGGG + Intronic
1050778157 9:9294520-9294542 TAAATGAGTTCCTAAGGGTGGGG + Intronic
1051364569 9:16312300-16312322 GAAGTGTGGTGCCAAGGGAGGGG + Intergenic
1053019727 9:34686547-34686569 TGAGGGAGCTCCCAAGGGAGAGG - Intergenic
1053728186 9:41025627-41025649 TTAATGAGTTACCATGGGAGTGG + Intergenic
1054700323 9:68406459-68406481 TTAATGAGTTACCATGGGAGTGG - Intronic
1055307852 9:74949605-74949627 TAAATGAAGTCCCAAGGGTGAGG + Intronic
1055661518 9:78508395-78508417 TAAATGAGGTCACAAGGGTGGGG + Intergenic
1055702449 9:78960394-78960416 TAAATGAGGTCACAAGGGTGAGG + Intergenic
1056300253 9:85232862-85232884 GAAATGAGATGCCGGGGGAGGGG + Intergenic
1056760179 9:89408931-89408953 GCAATGAGCTGCCATGGGATGGG + Intronic
1056865322 9:90223644-90223666 TAAACGAGCTGCCGAGGGAGGGG - Intergenic
1056917688 9:90759243-90759265 TAAACGAGCTGCCGAGGGAGGGG + Intergenic
1060823068 9:126672551-126672573 TAAATTGGCTGCGAAGGGACAGG + Intronic
1061219744 9:129243253-129243275 AAAATGCGCTGCCCAAGGAGTGG - Intergenic
1061246283 9:129402627-129402649 TAAATGAGAAGAGAAGGGAGGGG - Intergenic
1061718536 9:132537100-132537122 TAGCTGAGGAGCCAAGGGAGGGG + Intronic
1062224673 9:135443008-135443030 TAAACGAGCTGCCAAGGGAGGGG + Intergenic
1186116671 X:6311184-6311206 TAAGGGAGCTTGCAAGGGAGTGG - Intergenic
1186248534 X:7640761-7640783 TTCATGAGATTCCAAGGGAGGGG + Intergenic
1186295400 X:8143170-8143192 TAAATGAGCAGACAATGGATAGG + Intergenic
1187477468 X:19624981-19625003 TAAATGTGGTTCCAAGGGTGAGG - Intronic
1188564165 X:31506497-31506519 TAAATGATCTAGCAAGGGCGGGG - Intronic
1190139886 X:47833518-47833540 TTAATGAGTTACCATGGGAGTGG + Intergenic
1193743887 X:85251705-85251727 TAAATGAGCTACCACGTGATAGG + Intronic
1194400043 X:93431269-93431291 TAAACCAGCTGCCAAGGGAGGGG - Intergenic
1195731278 X:107970312-107970334 GAAATGAGCAGGCAAGTGAGTGG - Intergenic
1196275086 X:113757254-113757276 TACTTCAGCTGCCAAGGAAGGGG - Intergenic
1198151853 X:133918944-133918966 AAAATGAGCTGCCACTGCAGTGG - Intronic
1198551289 X:137748099-137748121 TAAATAAGATGCTAGGGGAGGGG + Intergenic
1200125017 X:153809262-153809284 TAAAAGAGGTGCCAAGAAAGTGG + Intronic
1200911726 Y:8537140-8537162 TAAATGAGCTGCCAAGGGTGGGG - Intergenic
1200925154 Y:8647680-8647702 TAAATGAGCTGCCAAAGGCGGGG - Intergenic
1200947867 Y:8864342-8864364 TAAACGAGCTGCCAATGTAGGGG - Intergenic
1200984027 Y:9287516-9287538 TCAGTGAACTGCCAAGGGTGGGG + Intergenic
1202152574 Y:21856679-21856701 TAAGTGAGCTGCCAAGGGTGCGG + Intergenic