ID: 1162633392

View in Genome Browser
Species Human (GRCh38)
Location 19:11946259-11946281
Sequence ACATTCTCTCTTGTCTGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 1, 2: 1, 3: 26, 4: 226}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162633389_1162633392 5 Left 1162633389 19:11946231-11946253 CCAAGGGAGGGGTTTCTCCCGCA 0: 1
1: 0
2: 23
3: 47
4: 79
Right 1162633392 19:11946259-11946281 ACATTCTCTCTTGTCTGTTCTGG 0: 1
1: 1
2: 1
3: 26
4: 226
1162633383_1162633392 30 Left 1162633383 19:11946206-11946228 CCAGTCTTAGATCGTAAATGAGC 0: 1
1: 0
2: 1
3: 2
4: 61
Right 1162633392 19:11946259-11946281 ACATTCTCTCTTGTCTGTTCTGG 0: 1
1: 1
2: 1
3: 26
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162633392 Original CRISPR ACATTCTCTCTTGTCTGTTC TGG Intronic
901200794 1:7466239-7466261 ATATTCTTTCTTGACTTTTCTGG - Intronic
901244834 1:7721680-7721702 ACATTTTATTTTGTATGTTCAGG + Intronic
902261210 1:15226253-15226275 TCATTCCCTGTTGTGTGTTCTGG - Intergenic
906769360 1:48471008-48471030 ATACTCCCGCTTGTCTGTTCTGG - Intronic
906935701 1:50212379-50212401 ACATTCCATATTGTCTCTTCTGG - Intergenic
907614618 1:55911638-55911660 ACATTCTCTCTTCCCTGATATGG - Intergenic
908597307 1:65702195-65702217 ACATCCACTCATGTCTGTTATGG - Intergenic
912778952 1:112526158-112526180 ATATACTCTCTTGGCTGTCCTGG - Intronic
913824796 1:123133000-123133022 TCATTCTCTCTTGTTTCTACAGG - Intergenic
914506325 1:148292633-148292655 ACTTACTCTCTTTTCTCTTCTGG + Intergenic
916212752 1:162372101-162372123 ACATGCTCTCTGTTCTTTTCTGG + Intronic
917187950 1:172382782-172382804 ACATTCTCTTTTGTATTATCTGG - Intronic
917343096 1:174000713-174000735 ACATTTTCTCTTCTCTGATGTGG - Intronic
918683226 1:187381959-187381981 CCAGTTTCTCTTGTCTTTTCTGG + Intergenic
918803449 1:189004660-189004682 ACATTCAGTCTTGTCTGAACTGG - Intergenic
920100941 1:203516685-203516707 ATCTTCTCTCTTCTCTCTTCAGG + Intergenic
922382331 1:225043254-225043276 ACCTTGTCTCTTGTCTCTTGGGG + Intronic
923002008 1:230014265-230014287 CCATTCTCTCTATTCTGTACTGG + Intergenic
923311834 1:232742994-232743016 TCATTCTCTCTTGCCTGGCCAGG + Intergenic
923411313 1:233712828-233712850 AAATTCTCTCTTTTCTTATCTGG + Intergenic
1065082258 10:22140212-22140234 ACATTTTCTCTTGTTGGTACTGG - Intergenic
1066290826 10:34013045-34013067 AGGTTCTCTCTTGTCTATCCTGG + Intergenic
1066389916 10:34970286-34970308 ACCTCCTCTCTTGTCTACTCTGG - Intergenic
1069223801 10:65915748-65915770 GGATTCTATCTTGTCTGTTAGGG + Exonic
1070087475 10:73251347-73251369 TCATTCCCTCTAGGCTGTTCAGG - Intronic
1071258064 10:83892050-83892072 ACATTCTCCCTTTTTTCTTCTGG + Intergenic
1071950142 10:90693978-90694000 TCATTCCCTGTTGTGTGTTCTGG + Intergenic
1074207838 10:111299547-111299569 TCATGATCTCTTTTCTGTTCAGG - Intergenic
1074289468 10:112127652-112127674 ATACTCTCTCTTGTCTGATCAGG + Intergenic
1075287351 10:121198520-121198542 ACATTCTGTGTTCTCAGTTCAGG - Intergenic
1076069932 10:127481063-127481085 TCATTATCTCTTAACTGTTCTGG - Intergenic
1077589501 11:3480639-3480661 ACCTCCTCTCTTGTCTACTCTGG + Intergenic
1078141188 11:8694138-8694160 ACATTCTCTCTTGTCCTCTCTGG - Intronic
1079476959 11:20841265-20841287 ACATCCTCTCTTAACTGTTTTGG + Intronic
1079515425 11:21262189-21262211 ACATTAACTCTTTTATGTTCTGG + Intronic
1079939819 11:26665580-26665602 AAATCCACTCTTGTCTCTTCTGG - Intergenic
1079976486 11:27098006-27098028 CCTTTCTCACTTGTTTGTTCAGG + Intronic
1081113432 11:39166237-39166259 GCATTCTATTTTGTTTGTTCTGG - Intergenic
1082728941 11:56771618-56771640 ACATTTTCTTTTCTCTGTTATGG + Intergenic
1084245222 11:67852413-67852435 ACCTCCTCTCTTGTCTACTCTGG + Intergenic
1084827466 11:71742165-71742187 ACCTCCTCTCTTGTCTACTCTGG - Intergenic
1085014572 11:73164853-73164875 CCAGTCTCTCTTCTCTGGTCAGG + Intergenic
1085060905 11:73445977-73445999 TCATTCTCTTTTGTCAGATCTGG - Intronic
1085208653 11:74753323-74753345 TCTTACTCTCTTATCTGTTCTGG - Intronic
1086219005 11:84419025-84419047 ATGTTCTCTCTTATCTGTCCTGG + Intronic
1086334894 11:85790688-85790710 AGATTCTCGCTTGTCTGTTCAGG + Intronic
1088563440 11:111140071-111140093 AAATTCACTCATGTGTGTTCGGG + Intergenic
1088616170 11:111631027-111631049 CCATTGTCTCTTGTCTACTCTGG - Intronic
1089412792 11:118260912-118260934 ACATTCTCTAATGTCCTTTCTGG - Intronic
1092445123 12:8548482-8548504 TTTTTCTCTCTTTTCTGTTCTGG + Intergenic
1092696054 12:11172367-11172389 ACATTCCCACTTGTATTTTCCGG - Intergenic
1092980416 12:13789102-13789124 ACATTCTCTCTTGTTTAATGAGG - Intronic
1095805770 12:46319215-46319237 ACCTTCTCTCTTCTTTATTCAGG + Intergenic
1095821824 12:46486773-46486795 ACAGTCTGACTTGACTGTTCAGG - Intergenic
1097386114 12:58951648-58951670 ACATTCTTGCTTTTCTGTTTTGG - Intergenic
1097457278 12:59815043-59815065 ACATCCTATCTTATCTTTTCAGG - Intergenic
1099569318 12:84295695-84295717 ATATTCTATCTTTTCTGTTGAGG + Intergenic
1099884684 12:88512935-88512957 TCATTCCCTCTTGTCAGTCCAGG - Intronic
1101464856 12:104938059-104938081 ACATTCTTTCATGTGTCTTCCGG - Intronic
1107491000 13:40879826-40879848 ACATCCTCTCTTGTCTACTCTGG + Intergenic
1107908328 13:45082496-45082518 TTATTCTCTGTTCTCTGTTCTGG - Intergenic
1111429318 13:88131460-88131482 GCATTCTCTCTTTTATTTTCTGG - Intergenic
1111487988 13:88928444-88928466 GCCTTGTCTCTTGTCTCTTCTGG - Intergenic
1111728863 13:92047112-92047134 ACCTTTTCTTTTGTCTGTTTAGG + Intronic
1112676865 13:101711726-101711748 ACATTTTCTCATGTGTCTTCAGG - Exonic
1112717475 13:102203263-102203285 AGATTCTCTTTTGTCTTTTGAGG - Intronic
1113198773 13:107840656-107840678 ACATTCTCTCTTCACTGTCGAGG - Intronic
1116170875 14:41400881-41400903 ACATTCTGTCTTGGCTTCTCAGG - Intergenic
1116354258 14:43907670-43907692 ACATTTTCTTCTCTCTGTTCTGG + Intergenic
1116612064 14:47088293-47088315 ACATTCTCTCTGGTGTTTTGGGG + Intronic
1119989437 14:79179254-79179276 AAATTCTCCCTGGTCTTTTCTGG + Intronic
1120792776 14:88600283-88600305 AGATTCTCTGCTGTCTGTCCTGG - Intronic
1124375033 15:29124340-29124362 ACATTCTGGGTCGTCTGTTCTGG + Intronic
1124458849 15:29870429-29870451 ACATTCATTATTGTCTGCTCCGG - Intronic
1125192922 15:37014471-37014493 ATGTTCTCTCTTGTCTCTTTAGG - Intronic
1125989321 15:44090464-44090486 ACTTTCACTCTTGTCTGGGCTGG + Intronic
1126081870 15:44971412-44971434 CGATTCTCTCTTGGCTCTTCAGG + Intronic
1126409251 15:48355168-48355190 ACATTGTCTCATGTGTGTTTGGG + Intergenic
1126585046 15:50276839-50276861 ACATTCTCTATTGACTTTTCAGG + Intronic
1127477720 15:59350470-59350492 ACATTCTCCTGTGTCTTTTCTGG - Intronic
1130128862 15:81118747-81118769 ACATTCTCTCTTGGGTGGTTTGG - Intronic
1134191895 16:12128048-12128070 AGCTTCTCTCTTGTCCTTTCTGG + Intronic
1134320823 16:13161101-13161123 AAATTCTCACTTTTCTGTCCTGG + Intronic
1136606021 16:31334304-31334326 ACACTCCCTCATGCCTGTTCTGG - Intergenic
1136652544 16:31685233-31685255 CCCTTCTCCTTTGTCTGTTCTGG + Intergenic
1140697888 16:77552990-77553012 AGAATCTCTCTTCTTTGTTCAGG - Intergenic
1140755000 16:78059057-78059079 ACCTCCTCTCTTGTCTACTCTGG + Intronic
1140842083 16:78849170-78849192 ACATTGACTCTTGTATGTTTGGG - Intronic
1142631655 17:1229669-1229691 ACTTTCCCTCTGGTCTCTTCGGG - Intergenic
1146265690 17:31451110-31451132 GCATTCTCTCTTGTTTTTTGTGG + Intronic
1149446372 17:56716493-56716515 ACATTATGTCTTGTGTGTTTGGG + Intergenic
1149734595 17:58980693-58980715 AGCTTGTCTCCTGTCTGTTCAGG + Exonic
1152173202 17:78767996-78768018 ACATTTCATTTTGTCTGTTCTGG - Intronic
1154299196 18:13178281-13178303 AGATTATCTGTTGTCTGTCCCGG + Intergenic
1158269021 18:55692760-55692782 ACCATCACTTTTGTCTGTTCCGG + Intergenic
1159114947 18:64103625-64103647 ACTTTCTCTCTTCTCAGCTCAGG + Intergenic
1160436015 18:78853464-78853486 ACATCCTCTCTTTTCACTTCAGG + Intergenic
1161192160 19:2963867-2963889 TCATTCTTCCTTGTCTGTCCTGG - Intergenic
1162633392 19:11946259-11946281 ACATTCTCTCTTGTCTGTTCTGG + Intronic
1162863525 19:13526217-13526239 ACATTCTCTGTTGTCTTCCCCGG - Intronic
1163577468 19:18119037-18119059 ACATTCTCTCTGTTGTGTCCTGG + Intronic
1163916524 19:20245192-20245214 ACATCCTCTCTTGTTTACTCTGG - Intergenic
1165582229 19:36876740-36876762 ACATTCACTTTTTTGTGTTCTGG - Intronic
1165713771 19:38030735-38030757 ACATTCTCTCTTGTTTCTGTGGG + Intronic
1165825843 19:38705326-38705348 ACTCTCTCACTAGTCTGTTCTGG - Intronic
924982153 2:233944-233966 TCATTATTTCTTGTGTGTTCTGG + Intronic
926772073 2:16387227-16387249 AGCTTGACTCTTGTCTGTTCTGG - Intergenic
930020078 2:46996416-46996438 ACATTCACTTCTGGCTGTTCAGG - Intronic
931634025 2:64326117-64326139 ACATTCTCACTTCTCAGTTGTGG - Intergenic
932352991 2:71046851-71046873 ACCTCCTCTCTTATCTGCTCTGG - Intergenic
932697614 2:73969918-73969940 ACATTCTCTCTTGCCTAATTTGG + Intergenic
933492287 2:83001333-83001355 TCATTCCCTCTTGGCTGTTCAGG + Intergenic
934591286 2:95551938-95551960 ACCTCCTCTCTTGTCTGCTCTGG - Intergenic
936667166 2:114610003-114610025 ACATTGCCTTTTCTCTGTTCTGG - Intronic
937320838 2:120959772-120959794 ACATTCTCTGCTGTGTGGTCTGG - Intronic
938617194 2:133011958-133011980 CCATTCTCTCTTTTCTCTTCTGG + Intronic
939116382 2:138066172-138066194 CCATTCCCTCTTGTCTGCTCTGG + Intergenic
939364395 2:141213554-141213576 ACATTCTCTCATGTCTGTGTGGG - Intronic
940780091 2:157924231-157924253 ACATTCCCACTGGTCTGTTTTGG - Intronic
940873915 2:158882150-158882172 ACCTCCTCTCTTGTCTACTCTGG - Intergenic
941301044 2:163801731-163801753 ATATTCTCTCTTCTGTGTTGTGG - Intergenic
941308048 2:163894835-163894857 ACATTCTCTCTTGTCTGTACAGG + Intergenic
941842824 2:170106202-170106224 GCATCCTCCCTTCTCTGTTCTGG - Intergenic
943015287 2:182502785-182502807 ACATGCTCTCCTCTCAGTTCAGG - Intronic
943701108 2:190989048-190989070 GGATTCACTCTTGTCTCTTCTGG - Intronic
944480792 2:200155226-200155248 ACATTCTTGCTTGTCTGTTTAGG + Intergenic
945205860 2:207331441-207331463 ACATTCTTTTTTTTCTGTTGAGG - Intergenic
945660330 2:212677868-212677890 TCTTTCTCTCTTTTCTGTTCTGG - Intergenic
945732815 2:213561822-213561844 ACATTATGTCTTGAATGTTCCGG + Intronic
946167492 2:217873888-217873910 ACATTCTTTCTTGCCTGGTGGGG - Intronic
947594488 2:231402274-231402296 ACCTCCTCTCTTGTCTACTCTGG - Intergenic
947608063 2:231502784-231502806 ACATTCTGTCTTCTCTCTCCAGG - Intergenic
947645757 2:231738442-231738464 ACCTTCTCTCTACTCTGTTCTGG + Intronic
1169070434 20:2725151-2725173 GCTTTCTCTCTTTTCTCTTCTGG + Intronic
1171169066 20:22999418-22999440 TCAGTCTCTCTTGACTGTTGGGG - Intergenic
1171252335 20:23658106-23658128 ACATTCTCTGATGTGTGATCAGG + Intergenic
1172381696 20:34498863-34498885 AAATTCTCTCTTCTATTTTCTGG + Intronic
1173525903 20:43732337-43732359 ACATTCTCTTTTTTGTTTTCTGG + Intergenic
1173716345 20:45210038-45210060 ACATTTTCTCTTGTCTTTCTGGG - Intergenic
1173757161 20:45526669-45526691 ACATTATGTCTTGTCTATTTGGG + Intergenic
1175107866 20:56627410-56627432 ACAAGCTGTCTTGTCTGTGCTGG - Intergenic
1176368105 21:6045706-6045728 CCCTTCCCTCTTCTCTGTTCAGG + Intergenic
1177516319 21:22156016-22156038 TCATTGTCTTTTGTCTGTTGGGG - Intergenic
1177681255 21:24374578-24374600 ATATTCTTTTTTGTCTATTCTGG + Intergenic
1178542151 21:33461995-33462017 ACATTTTCTCTTGTTTGCTTTGG + Intronic
1179271293 21:39853175-39853197 AGATTCCCTTTTGTCTGTTTTGG + Intergenic
1179755414 21:43492836-43492858 CCCTTCCCTCTTCTCTGTTCAGG - Intergenic
1182367333 22:29788031-29788053 ACATTCTCACTTGTTTCTTAAGG + Intergenic
1183676474 22:39301623-39301645 CCATTCCCTCTTGTCTGTGGTGG - Intergenic
949882126 3:8670094-8670116 ACCTCCTCTCTTGTCTACTCTGG - Intronic
955601078 3:60645560-60645582 ACATCTTCTCTTGTCTCCTCTGG + Intronic
958434949 3:94085026-94085048 ACATTCTCTCTTTTTTTTACAGG + Intronic
958992149 3:100859239-100859261 ACATTCTGTTTTCTCTGTTGGGG - Intronic
959912776 3:111782548-111782570 AAATTCTTTCTTCTCTGTTTTGG + Intronic
960464662 3:117982602-117982624 ACCTTCTCTGGTGTTTGTTCTGG - Intergenic
960573244 3:119205857-119205879 ACACTCTCTCCTGTGTGTTCTGG + Intergenic
961271765 3:125694823-125694845 ACCTCCTCTCTTGTCTACTCTGG - Intergenic
961893336 3:130148158-130148180 ACCTCCTCTCTTGTCTACTCTGG + Intergenic
962678069 3:137770829-137770851 TCTTTCTCTCCTCTCTGTTCCGG - Intergenic
965704752 3:171495073-171495095 ACCTTCACTCTTTTCTCTTCAGG + Intergenic
975736934 4:77389986-77390008 ACAATCTCACTTGTCTCTTGGGG + Intronic
975856837 4:78633501-78633523 AAATTCTTTCATGTATGTTCTGG - Intergenic
976578814 4:86709618-86709640 ACATTCTCTGTTGGTTGTTCAGG - Intronic
978035165 4:103984221-103984243 TCATTCTTTCTTTTGTGTTCCGG - Intergenic
978684672 4:111425646-111425668 TCATTATCATTTGTCTGTTCTGG - Intergenic
978785668 4:112606991-112607013 ACTTTATCTCTGGTCTGTTGGGG - Intronic
980876348 4:138666198-138666220 ACATTCTGTCTTGTAGGTTGAGG + Intergenic
982078696 4:151765248-151765270 AAATTCTCTCTTTTGTGTTTTGG + Intergenic
984149030 4:176102880-176102902 ACATGCTCACTTGTCTGCCCTGG - Intronic
984919791 4:184753247-184753269 ATATTTTTTCTTTTCTGTTCTGG + Intergenic
985210779 4:187591463-187591485 ACAAGCTGTCTTGTCTGTTAAGG + Intergenic
985639993 5:1059112-1059134 ACATCCTCTGTTTTCTGTCCAGG - Intronic
986171205 5:5316216-5316238 ACATACTCTCTTGTAGGTTTGGG + Intronic
987096349 5:14554089-14554111 CCATACTCTCTTGTCTGTTAAGG + Intergenic
988660712 5:33264676-33264698 CAATTCTCTCTTCTCTGTTTAGG - Intergenic
989105408 5:37858546-37858568 ACATTCTTTCTTTTCTGTGATGG - Intergenic
991284612 5:64958038-64958060 AAATTTTATCTTGTCTTTTCAGG - Intronic
991901381 5:71464101-71464123 ACTTACTCTCTTGTCTGGACTGG - Exonic
993606110 5:89992507-89992529 TCATCCTCACTTGTCTGCTCAGG + Intergenic
994426050 5:99588249-99588271 AAATCCTTTCTTGTCTCTTCTGG - Intergenic
994440668 5:99799680-99799702 ACAATCTCTCTTCTCTTGTCTGG - Intergenic
995332570 5:110961554-110961576 ACATCCTCACTTCTCTGTTGAGG + Intergenic
996322172 5:122231013-122231035 GCATTTGCTGTTGTCTGTTCTGG - Intergenic
997937724 5:138129037-138129059 ACATTCTCTGTTGCTTTTTCTGG + Intronic
1001418658 5:171569528-171569550 ACATTCTCTCTTCTCTTTCTGGG + Intergenic
1002325068 5:178399270-178399292 ACTCTCTCTCTTCTCTGTGCTGG - Intronic
1004066253 6:12247430-12247452 CCATTGTCTCTTGTTTGATCTGG - Intergenic
1005717042 6:28559334-28559356 GCATACTGCCTTGTCTGTTCCGG - Intergenic
1007037255 6:38687391-38687413 CCATTCTCTCTAGTCTGCTTTGG + Intronic
1007245843 6:40461854-40461876 AAATTGTCTCTAGTCTATTCAGG - Intronic
1009164079 6:60319617-60319639 CTATTCTCTCTTGTTTGTTGAGG - Intergenic
1009472466 6:64044653-64044675 ACATTCTTTCTGTTCTTTTCAGG + Intronic
1010386952 6:75291182-75291204 ACATTCTTTTTTGGCTGTTCTGG - Intergenic
1010676011 6:78744434-78744456 CCAATCTCTCTTGGCTGTTAAGG + Intergenic
1010824653 6:80457486-80457508 ACACTCCCTCCTGTCTGTTTGGG + Intergenic
1013676024 6:112464096-112464118 ACATTCCCTAATGTCTTTTCTGG + Intergenic
1014616111 6:123601653-123601675 ACATTCTCACTTCTTTGTCCAGG + Intronic
1014620263 6:123658975-123658997 ATGTTCTCTTTTGTTTGTTCTGG - Intergenic
1017331911 6:153209095-153209117 ATATTCTCTCATGTCTGCTTTGG + Intergenic
1017544170 6:155433352-155433374 TGATTCTCTCTTGTCTGTCCCGG - Intronic
1017792900 6:157817196-157817218 AATGTCTGTCTTGTCTGTTCAGG - Intronic
1018767029 6:166942401-166942423 ATATTCTCTCCTGTCTGATATGG + Intronic
1020380382 7:7538269-7538291 CCATGCTCTCTTATTTGTTCTGG - Intergenic
1023517940 7:41020867-41020889 ACATTCGCTCTGCTCTGTCCAGG - Intergenic
1024923354 7:54585314-54585336 ACATTCTCTCCTGTATATTGTGG - Intergenic
1026401173 7:70014442-70014464 TCATTCTTTTTTGTCTGTCCTGG + Intronic
1026779043 7:73251623-73251645 AAATTCTCTATTGTCTGTAATGG - Intergenic
1027019903 7:74805027-74805049 AAATTCTCTATTGTCTGTAATGG - Intronic
1027068123 7:75140914-75140936 AAATTCTCTATTGTCTGTAATGG + Intronic
1028012656 7:85667834-85667856 ATAGTCTCTTTTGTCTTTTCTGG - Intergenic
1028902404 7:96116235-96116257 ACATTTGCACTAGTCTGTTCTGG + Intergenic
1029678367 7:102089275-102089297 CCATTATCTCTTGTCATTTCTGG + Intronic
1030604346 7:111623288-111623310 ACATTCTGTCTTGTCTGATAGGG + Intergenic
1030647780 7:112082582-112082604 ACATTCTCTGTAGGCTTTTCCGG - Intronic
1030671884 7:112347064-112347086 ACTTTCTCTCTTTTCTGGGCCGG - Intergenic
1031702078 7:124938773-124938795 ACATACTCTCTTGGTTTTTCTGG - Intergenic
1032880147 7:136080886-136080908 ACATTTTCTAATGTCTGTTTAGG + Intergenic
1036493711 8:9250743-9250765 ACCTCCTCGCTTGTCTGCTCTGG - Intergenic
1036817122 8:11910537-11910559 ACCTCCTCTCTTGTCTACTCTGG + Intergenic
1036817461 8:11912848-11912870 ACCTCCTCTCTTGTCTATTCTGG + Intergenic
1037634272 8:20686901-20686923 ACCATCTCCCTTGTCTCTTCTGG + Intergenic
1038798613 8:30730132-30730154 ACCTCCTCTCTTGTCTACTCTGG - Intergenic
1039540966 8:38369016-38369038 ACATTCTCTTTTGCCTTTTTTGG - Intronic
1040886583 8:52269878-52269900 ACATTCTCTCTTTCAAGTTCAGG + Intronic
1041191037 8:55354436-55354458 ACATTCTCTCTCATCTTTTGCGG - Intronic
1043613995 8:82103154-82103176 TCATTCTGTCTTCTCTGTCCAGG - Intergenic
1044033842 8:87273399-87273421 ACAGTCTCCCTTTTCTGTTCAGG - Intronic
1045859751 8:106802934-106802956 ACTTCCTGTCTTATCTGTTCAGG + Intergenic
1046582423 8:116110098-116110120 TCTTTCTCTTTTGTCTGTTACGG + Intergenic
1047859567 8:128950049-128950071 ACATGCTGTTTTCTCTGTTCTGG + Intergenic
1049423116 8:142525511-142525533 CCATCCTCTCTTCTCTGCTCCGG + Intronic
1050327244 9:4509437-4509459 TCACCCTCTCTTGTCTGTTCAGG - Intronic
1050713501 9:8492979-8493001 ACATTCTATTTTGTCATTTCAGG - Exonic
1050823597 9:9914661-9914683 ACATGCTCTCTTGGCTGGTCTGG - Intronic
1051007396 9:12362984-12363006 ACTTTCTTTTTTGTCTATTCAGG + Intergenic
1052713080 9:32081305-32081327 AAATTCTCACTTGTCTTTTTTGG + Intergenic
1052887017 9:33659333-33659355 ACATTCTCCCATGTATGTTTGGG - Intergenic
1058524810 9:105846270-105846292 AATTTCTTTCTTCTCTGTTCAGG - Intergenic
1058554719 9:106154788-106154810 ACATTCTCTCCTTGGTGTTCTGG + Intergenic
1058953865 9:109927918-109927940 ACATTTTCCTTTGCCTGTTCTGG - Intronic
1059387905 9:113979310-113979332 ACATTCTCTCTTGAGGGTGCAGG - Intronic
1061502522 9:131012221-131012243 GCATTCTCTTTTGCCTGCTCTGG + Intronic
1061766062 9:132882190-132882212 GCATACTCTCTTGTCTTTCCAGG + Intronic
1062224678 9:135443047-135443069 ACCTCCTCTCTTGTCTATTCTGG + Intergenic
1189731489 X:44025573-44025595 ACATGCTCTCATCTCTGATCAGG - Intergenic
1190820627 X:53968393-53968415 TCATTACTTCTTGTCTGTTCAGG - Intronic
1192450140 X:71239609-71239631 AAATTGTCTTTTGTCTTTTCTGG - Exonic
1193193890 X:78606780-78606802 ACATTGTCTCATGCCTTTTCTGG - Intergenic
1194749322 X:97666775-97666797 ACATTCTTTGTTGTCTCTTATGG - Intergenic
1196537006 X:116858155-116858177 ATATTCTCTCTTCTAAGTTCTGG - Intergenic
1200713724 Y:6513583-6513605 ACTTTCTCTCATGTCTGTGCTGG + Intergenic
1200947864 Y:8864303-8864325 ACCTCCTCTCTTGTCTACTCCGG - Intergenic
1200984032 Y:9287555-9287577 ACATCCTCTCTTGTCTACTCTGG + Intergenic
1201020204 Y:9648458-9648480 ACTTTCTCTCATGTCTGTGCTGG - Intergenic
1202152579 Y:21856718-21856740 ACATCCTCTCTTGTCTACTGTGG + Intergenic