ID: 1162648294

View in Genome Browser
Species Human (GRCh38)
Location 19:12065805-12065827
Sequence CTGTATTTTCAGTAAAGACG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355092
Summary {0: 2, 1: 186, 2: 7524, 3: 119375, 4: 228005}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162648286_1162648294 23 Left 1162648286 19:12065759-12065781 CCCTAGTAGCTGGGGTTACAGGC 0: 53
1: 5334
2: 124138
3: 260146
4: 230826
Right 1162648294 19:12065805-12065827 CTGTATTTTCAGTAAAGACGGGG 0: 2
1: 186
2: 7524
3: 119375
4: 228005
1162648287_1162648294 22 Left 1162648287 19:12065760-12065782 CCTAGTAGCTGGGGTTACAGGCA 0: 782
1: 54523
2: 104031
3: 156804
4: 231605
Right 1162648294 19:12065805-12065827 CTGTATTTTCAGTAAAGACGGGG 0: 2
1: 186
2: 7524
3: 119375
4: 228005
1162648288_1162648294 -3 Left 1162648288 19:12065785-12065807 CCACCACGCCCTGCTGATTTCTG 0: 1
1: 44
2: 1910
3: 34439
4: 145639
Right 1162648294 19:12065805-12065827 CTGTATTTTCAGTAAAGACGGGG 0: 2
1: 186
2: 7524
3: 119375
4: 228005
1162648289_1162648294 -6 Left 1162648289 19:12065788-12065810 CCACGCCCTGCTGATTTCTGTAT 0: 1
1: 42
2: 1849
3: 32426
4: 106611
Right 1162648294 19:12065805-12065827 CTGTATTTTCAGTAAAGACGGGG 0: 2
1: 186
2: 7524
3: 119375
4: 228005

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162648294 Original CRISPR CTGTATTTTCAGTAAAGACG GGG Intronic
Too many off-targets to display for this crispr