ID: 1162650826

View in Genome Browser
Species Human (GRCh38)
Location 19:12087722-12087744
Sequence CAAATGTGGCATAATTTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162650826_1162650831 -2 Left 1162650826 19:12087722-12087744 CCCAACAAATTATGCCACATTTG No data
Right 1162650831 19:12087743-12087765 TGCTCATGGGTGACTCCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162650826 Original CRISPR CAAATGTGGCATAATTTGTT GGG (reversed) Intergenic