ID: 1162650831 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:12087743-12087765 |
| Sequence | TGCTCATGGGTGACTCCTAT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1162650826_1162650831 | -2 | Left | 1162650826 | 19:12087722-12087744 | CCCAACAAATTATGCCACATTTG | No data | ||
| Right | 1162650831 | 19:12087743-12087765 | TGCTCATGGGTGACTCCTATTGG | No data | ||||
| 1162650824_1162650831 | 0 | Left | 1162650824 | 19:12087720-12087742 | CCCCCAACAAATTATGCCACATT | No data | ||
| Right | 1162650831 | 19:12087743-12087765 | TGCTCATGGGTGACTCCTATTGG | No data | ||||
| 1162650825_1162650831 | -1 | Left | 1162650825 | 19:12087721-12087743 | CCCCAACAAATTATGCCACATTT | No data | ||
| Right | 1162650831 | 19:12087743-12087765 | TGCTCATGGGTGACTCCTATTGG | No data | ||||
| 1162650827_1162650831 | -3 | Left | 1162650827 | 19:12087723-12087745 | CCAACAAATTATGCCACATTTGC | No data | ||
| Right | 1162650831 | 19:12087743-12087765 | TGCTCATGGGTGACTCCTATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1162650831 | Original CRISPR | TGCTCATGGGTGACTCCTAT TGG | Intergenic | ||
| No off target data available for this crispr | |||||