ID: 1162650831

View in Genome Browser
Species Human (GRCh38)
Location 19:12087743-12087765
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162650827_1162650831 -3 Left 1162650827 19:12087723-12087745 CCAACAAATTATGCCACATTTGC No data
Right 1162650831 19:12087743-12087765 TGCTCATGGGTGACTCCTATTGG No data
1162650824_1162650831 0 Left 1162650824 19:12087720-12087742 CCCCCAACAAATTATGCCACATT No data
Right 1162650831 19:12087743-12087765 TGCTCATGGGTGACTCCTATTGG No data
1162650825_1162650831 -1 Left 1162650825 19:12087721-12087743 CCCCAACAAATTATGCCACATTT No data
Right 1162650831 19:12087743-12087765 TGCTCATGGGTGACTCCTATTGG No data
1162650826_1162650831 -2 Left 1162650826 19:12087722-12087744 CCCAACAAATTATGCCACATTTG No data
Right 1162650831 19:12087743-12087765 TGCTCATGGGTGACTCCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162650831 Original CRISPR TGCTCATGGGTGACTCCTAT TGG Intergenic