ID: 1162650831 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 19:12087743-12087765 |
Sequence | TGCTCATGGGTGACTCCTAT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1162650827_1162650831 | -3 | Left | 1162650827 | 19:12087723-12087745 | CCAACAAATTATGCCACATTTGC | No data | ||
Right | 1162650831 | 19:12087743-12087765 | TGCTCATGGGTGACTCCTATTGG | No data | ||||
1162650824_1162650831 | 0 | Left | 1162650824 | 19:12087720-12087742 | CCCCCAACAAATTATGCCACATT | No data | ||
Right | 1162650831 | 19:12087743-12087765 | TGCTCATGGGTGACTCCTATTGG | No data | ||||
1162650825_1162650831 | -1 | Left | 1162650825 | 19:12087721-12087743 | CCCCAACAAATTATGCCACATTT | No data | ||
Right | 1162650831 | 19:12087743-12087765 | TGCTCATGGGTGACTCCTATTGG | No data | ||||
1162650826_1162650831 | -2 | Left | 1162650826 | 19:12087722-12087744 | CCCAACAAATTATGCCACATTTG | No data | ||
Right | 1162650831 | 19:12087743-12087765 | TGCTCATGGGTGACTCCTATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1162650831 | Original CRISPR | TGCTCATGGGTGACTCCTAT TGG | Intergenic | ||