ID: 1162651094

View in Genome Browser
Species Human (GRCh38)
Location 19:12089642-12089664
Sequence CTTTGGAAGGCCAAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274879
Summary {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162651094_1162651103 13 Left 1162651094 19:12089642-12089664 CCATCCACCTTGGCCTTCCAAAG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
Right 1162651103 19:12089678-12089700 GGTGTGAGCCACGCCCGGCTTGG No data
1162651094_1162651100 -8 Left 1162651094 19:12089642-12089664 CCATCCACCTTGGCCTTCCAAAG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
Right 1162651100 19:12089657-12089679 TTCCAAAGTGCTGGGATTACAGG 0: 9594
1: 299194
2: 262940
3: 149017
4: 131705
1162651094_1162651102 8 Left 1162651094 19:12089642-12089664 CCATCCACCTTGGCCTTCCAAAG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
Right 1162651102 19:12089673-12089695 TTACAGGTGTGAGCCACGCCCGG No data
1162651094_1162651106 26 Left 1162651094 19:12089642-12089664 CCATCCACCTTGGCCTTCCAAAG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
Right 1162651106 19:12089691-12089713 CCCGGCTTGGTTTCATTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162651094 Original CRISPR CTTTGGAAGGCCAAGGTGGA TGG (reversed) Intergenic
Too many off-targets to display for this crispr