ID: 1162652013

View in Genome Browser
Species Human (GRCh38)
Location 19:12095912-12095934
Sequence TACTTTGGTGGTGGCTTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 231}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162652013 Original CRISPR TACTTTGGTGGTGGCTTCTG TGG Intronic
901881136 1:12194424-12194446 GAGTTGGGTGGGGGCTTCTGTGG + Intronic
902404938 1:16177444-16177466 CCCCTTGGTGGTGGCATCTGGGG - Intergenic
902525125 1:17052356-17052378 TTCTTTTGAGGTGGCTTTTGTGG + Intronic
903657743 1:24959404-24959426 CCCTTTGATGGCGGCTTCTGAGG - Intronic
904801305 1:33094660-33094682 GACCTTGGTGGTGGCTTCCCTGG + Exonic
906065045 1:42974806-42974828 TACTTTAGAGGAGGCTGCTGGGG + Intergenic
906451477 1:45952353-45952375 TACGTTGGTGGTTGGTTGTGGGG + Intronic
906551284 1:46668295-46668317 TGCTGTGGTGGTGGCGGCTGCGG - Exonic
910708042 1:90150552-90150574 TTCTTTGGTGGTGATTTCTGAGG + Intergenic
911904336 1:103547986-103548008 AGCTTGGGTGGTGGCTTCAGAGG - Intronic
912252158 1:108022240-108022262 GATGTTGGGGGTGGCTTCTGAGG + Intergenic
913096660 1:115523924-115523946 GACTTTGGTGGTGTCTTCTGTGG - Intergenic
913390173 1:118301958-118301980 TGGTATGGTGGTGGTTTCTGAGG - Intergenic
916707128 1:167362684-167362706 TACTTTTGTTGGGGTTTCTGTGG + Intronic
919727268 1:200892308-200892330 TACTTTGCTGGGGGCTGTTGGGG + Intronic
920975428 1:210781286-210781308 TACTCTGTTGGCGGCTTCTCTGG + Intronic
921001491 1:211048771-211048793 TTCTTTAGTGGTGATTTCTGAGG - Intronic
922615373 1:226958181-226958203 TACTATGGCGATGGCTACTGAGG - Intronic
924862112 1:247936015-247936037 TGCTTGGGTTGTGGCTTGTGTGG + Intergenic
924920433 1:248623383-248623405 GGCTTTGGTGGTGGCTTCTCTGG - Intergenic
1063095450 10:2904750-2904772 CACTTTGGTGTTGGCTGCTTGGG - Intergenic
1065149577 10:22808902-22808924 TTCTTTAGTGGTGATTTCTGAGG + Intergenic
1065783554 10:29192655-29192677 TACTTTGGTCATTTCTTCTGAGG - Intergenic
1068519482 10:58062926-58062948 AACTTGGGTTGTGGCTTCAGGGG - Intergenic
1074480884 10:113819512-113819534 TTCTTAAGTGGTTGCTTCTGGGG - Intergenic
1075445916 10:122512761-122512783 TTCTTTGGTGGTGATTTGTGAGG + Intronic
1075986789 10:126794761-126794783 TTCTTTAGTGGTGATTTCTGAGG - Intergenic
1076488735 10:130841490-130841512 TTCTTTAGTGGTGATTTCTGAGG - Intergenic
1079154708 11:17935008-17935030 TTCCTTTGTGGTGGCTCCTGAGG - Intronic
1080022628 11:27579031-27579053 TACTTAGGTGGTGGGTTCACAGG + Intergenic
1080884552 11:36354437-36354459 TAATTTGTTGGTTGCATCTGCGG + Intronic
1083016258 11:59457386-59457408 GGCCTTGGTGGTGGCTTCTTGGG + Exonic
1085599905 11:77846144-77846166 TTCTTTGTTTGTGGCTTCTGAGG + Intronic
1085711645 11:78834527-78834549 GACTCTGGTAGTGCCTTCTGTGG - Intronic
1087690099 11:101311023-101311045 TTCTTTAGTGGTGATTTCTGAGG + Intergenic
1088430299 11:109751495-109751517 TGCTTTGGTGGGCTCTTCTGGGG - Intergenic
1089615037 11:119690536-119690558 CCCTTTGGTGGGGGCTCCTGAGG - Intronic
1090313187 11:125761260-125761282 TTCTTTAGTGGTGATTTCTGAGG - Intergenic
1090374209 11:126277522-126277544 TACTTTGCTACTGGCTTCAGTGG + Exonic
1091223640 11:133945369-133945391 ATCTTTGCTGGTGGCTTCTGAGG - Intronic
1091308590 11:134557040-134557062 TACTTCTGAGGTTGCTTCTGAGG + Intergenic
1091361598 11:134982405-134982427 TATTTTATTGATGGCTTCTGGGG - Intergenic
1093353103 12:18128143-18128165 AACTTGGGTTGTGGCTTCAGAGG + Intronic
1093479721 12:19592064-19592086 TTCTTTGGTGGCAGCCTCTGAGG - Intronic
1095725723 12:45450187-45450209 TTCTTTAGTGGTGATTTCTGAGG - Intergenic
1096529070 12:52232172-52232194 TTGTTTGGTGGTGGCTTCACGGG + Intergenic
1096570396 12:52519911-52519933 GGCTTTGGAGGTGGCTTCGGTGG - Exonic
1096610153 12:52795711-52795733 GGCTTTGGTGGTGGCTTTGGTGG - Exonic
1097512820 12:60565134-60565156 TACATTGGTGGTGGCTTCTCTGG + Intergenic
1099365611 12:81763009-81763031 GGCGTTGGGGGTGGCTTCTGAGG - Intergenic
1102150635 12:110687469-110687491 TACTTAGGAGGTGGCGGCTGGGG + Intronic
1106362097 13:29040029-29040051 TTCTTTAGTGGTGATTTCTGAGG + Intronic
1106391769 13:29340709-29340731 TTCTTTAGTGGTGATTTCTGAGG + Intronic
1107222142 13:37995585-37995607 TAATTTGGTAGTGGCTGATGAGG - Intergenic
1109582735 13:64363693-64363715 GACGTTGGGGGTGGCTCCTGAGG - Intergenic
1110172585 13:72519932-72519954 AACTTTGGTGGTGGCAACTATGG + Intergenic
1111990758 13:95114498-95114520 TGTTTTAGTGATGGCTTCTGAGG + Intronic
1112642516 13:101291987-101292009 TACCTGGGTGGTGGCTGTTGAGG + Exonic
1115491703 14:33964512-33964534 TGCTTTGGTGCTAGCTGCTGGGG + Intronic
1115669744 14:35597245-35597267 TACATTGTTGGTGGCATCTGTGG - Intronic
1116034363 14:39610546-39610568 TACTTTGGTCTTGTTTTCTGGGG + Intergenic
1117150438 14:52881992-52882014 TACTTAGGTTGTAGCTTCTAAGG - Intronic
1121015989 14:90549400-90549422 GACTGTGGTGGCAGCTTCTGGGG + Intronic
1125325352 15:38530904-38530926 TACTCTGGTGCTGCCTTTTGTGG - Intronic
1126915738 15:53464363-53464385 TATTTTGGTGGAGACTTCTTTGG - Intergenic
1127652149 15:61019843-61019865 TACTTTGGAGGTGAATTCTGGGG - Intronic
1128796869 15:70472607-70472629 AACTTTTGTGGTGGTTTCTATGG - Intergenic
1131826237 15:96324153-96324175 CACTTTGGAGGGGGCATCTGTGG - Intergenic
1132946069 16:2532073-2532095 TACTGTGGGAGGGGCTTCTGGGG + Intergenic
1133466534 16:6032509-6032531 TAATTTGGTGGAGCCTACTGGGG + Intronic
1134766007 16:16758600-16758622 TAAGTTCTTGGTGGCTTCTGAGG + Intergenic
1134980040 16:18600614-18600636 TAAGTTCTTGGTGGCTTCTGAGG - Intergenic
1139360378 16:66395279-66395301 TAATTTTGTGGGGGCATCTGAGG + Intronic
1139561270 16:67743908-67743930 GACTTTGGTGCTGGTTGCTGTGG - Intronic
1141100475 16:81194038-81194060 TACTTTGGTCATGGTATCTGAGG + Intergenic
1142627985 17:1204083-1204105 AGCCCTGGTGGTGGCTTCTGCGG - Intronic
1143503700 17:7352662-7352684 TACTTTGGTGGTGGATGGGGAGG - Exonic
1144585278 17:16483762-16483784 TGTACTGGTGGTGGCTTCTGGGG + Intronic
1145721404 17:27076260-27076282 AACTGTGCTGGTGGCTGCTGGGG - Intergenic
1147119625 17:38328296-38328318 CACTCTGGGGTTGGCTTCTGTGG + Exonic
1147577747 17:41612438-41612460 AGCTTTGGTAGTGGCTTCGGGGG - Exonic
1148355633 17:46973911-46973933 AGCTTTGGGGGTGGCTTCAGAGG - Intronic
1148584847 17:48770053-48770075 GAGTTGGGTGGTGGATTCTGGGG + Exonic
1149311577 17:55399363-55399385 TACTGTGTTAGTGGCTTTTGAGG + Intronic
1151740942 17:75981569-75981591 TGCTTTGTGGGTTGCTTCTGAGG - Intronic
1156991603 18:43415232-43415254 TTCTTAGATGCTGGCTTCTGAGG + Intergenic
1157209456 18:45729148-45729170 TTCTTTGGTAGTGTCTTATGTGG + Intronic
1158165484 18:54534982-54535004 TGTTTTGGTTGTAGCTTCTGTGG - Intergenic
1161040416 19:2108173-2108195 TTCTTTTCTGGTGGCTTCTTTGG - Intronic
1162652013 19:12095912-12095934 TACTTTGGTGGTGGCTTCTGTGG + Intronic
1163229272 19:15989113-15989135 TTCTTTAGTGGTGATTTCTGAGG + Intergenic
1166055262 19:40284749-40284771 TACAGGGGTGGGGGCTTCTGGGG - Intronic
1166394205 19:42426860-42426882 TGCTGTGGTGCGGGCTTCTGTGG + Exonic
1167060685 19:47143862-47143884 TCCCTTGGTGGTTGCTTGTGAGG + Intronic
925346796 2:3177298-3177320 GCCTTTGCTGGTGGGTTCTGAGG + Intergenic
926117662 2:10223609-10223631 CTCTGTGGTGGGGGCTTCTGGGG + Intergenic
926256982 2:11212718-11212740 TACTCTGTTGGTGGATTATGTGG - Intronic
926346045 2:11946578-11946600 TCCTTTGGTCGTGGCTTGTTCGG + Intergenic
928210618 2:29320834-29320856 AACTTTGAAGATGGCTTCTGTGG - Exonic
928408349 2:31032515-31032537 TACTTTACTGGTGTTTTCTGAGG + Intronic
930658098 2:54026987-54027009 TTCTTTAGTGGTGATTTCTGAGG - Intronic
932560418 2:72862843-72862865 TGCTTTCTTGGCGGCTTCTGGGG + Intergenic
933003555 2:76958868-76958890 TACTTGGGTGGTGGTGTTTGAGG - Intronic
934571386 2:95375132-95375154 TGCATAGGTGGTGGCATCTGGGG - Exonic
937293701 2:120797419-120797441 TCCTTTGGTGGTGGCTGCAGCGG + Exonic
937432467 2:121850823-121850845 GATTGTGGTGGTGGTTTCTGGGG + Intergenic
937591707 2:123621138-123621160 TTCTTTGGTGGTGATTTGTGAGG - Intergenic
937622561 2:124005661-124005683 AACTTTGGTGTTGCCTACTGTGG - Intergenic
937725918 2:125166456-125166478 TAATTTGGTGGGGGTTTCTCAGG + Intergenic
938037218 2:128045231-128045253 TTCTTTGGTGGTGATTTGTGAGG + Intergenic
938142184 2:128803820-128803842 TAATTTGGTGGTGCATTCTAAGG - Intergenic
938686819 2:133746251-133746273 TTCTTTGATGATGGCTTCGGAGG - Intergenic
941677933 2:168363984-168364006 GACTTTGGTGGAGGAGTCTGAGG - Intergenic
942618520 2:177821413-177821435 GGGTTTGGAGGTGGCTTCTGGGG - Intronic
942809440 2:179980226-179980248 GAATTTGGAGATGGCTTCTGTGG - Intronic
944192277 2:197015829-197015851 AACTTTGGTGGTGGTACCTGTGG + Intronic
944857486 2:203782232-203782254 TGCTTTGGTGTTGGGTGCTGAGG + Intergenic
945932640 2:215870975-215870997 TACTTTGATGCTGGCCTTTGGGG + Intergenic
947597079 2:231419654-231419676 TACTTCGGTGGAGGATCCTGGGG - Intergenic
947744969 2:232502847-232502869 TACTTCGGTGGTATTTTCTGTGG - Intergenic
1169087686 20:2837643-2837665 GCCTTTGGTGGAGGCTTCTGAGG - Intronic
1169346091 20:4829013-4829035 TACTCTGGTGGTGGCAAGTGAGG - Intergenic
1169349747 20:4858664-4858686 TGCCTTGGCGGTGGCTGCTGTGG - Intronic
1172508995 20:35486557-35486579 TGCTTTGCTTTTGGCTTCTGTGG + Intronic
1173911837 20:46676353-46676375 TGATTTGGAGGGGGCTTCTGGGG - Intronic
1173911992 20:46677358-46677380 TGATTTGGAGGGGGCTTCTGGGG - Intronic
1174067749 20:47878032-47878054 TCTATTGGTGGGGGCTTCTGGGG + Intergenic
1176076184 20:63249255-63249277 TCTCTTGGGGGTGGCTTCTGGGG - Intronic
1178369377 21:32014738-32014760 TTCTTTAGTGGTGATTTCTGAGG - Intronic
1179203167 21:39246084-39246106 TTCTTTGGTGGTGTCTTTTGAGG - Intronic
1180031950 21:45217375-45217397 TAATTTGGTGGTGGTTTTTAGGG + Intronic
1182036461 22:27202568-27202590 TACATTGGTGGTGGCGGCGGTGG - Intergenic
1182326651 22:29518430-29518452 GACTTAGGTGGTGGCATTTGGGG - Intronic
1182856820 22:33524798-33524820 TACTTTGCTTATAGCTTCTGTGG - Intronic
1184143290 22:42592326-42592348 GACTTTGGTGGTGGCTTGCTGGG - Intronic
1185191855 22:49443135-49443157 TACTTTGAAGGAGGCTTCTCGGG - Intronic
950543298 3:13624955-13624977 TCCTGAGTTGGTGGCTTCTGTGG + Intronic
950981135 3:17305483-17305505 TTCTTTGCAGGTGGCATCTGTGG + Intronic
952640593 3:35589880-35589902 TACCTTCGTGGTGGTTTATGTGG - Intergenic
953011292 3:39027746-39027768 TCCTTAGCTGGTGGCTTCTCTGG + Intergenic
953284744 3:41595645-41595667 TTCTTCTGTGTTGGCTTCTGTGG - Intronic
953907555 3:46875923-46875945 TATTTTGGTCCTGGGTTCTGGGG - Intronic
954639633 3:52090343-52090365 AACTTTGCTGTGGGCTTCTGAGG + Intronic
956224716 3:66944402-66944424 TTCTTTGGTGGTGATTTCTGAGG - Intergenic
956636267 3:71368579-71368601 TACTTTGGTTTTAGCTACTGAGG - Intronic
960610428 3:119550358-119550380 AATTTTGGTGATGGCTTCTGAGG + Intronic
962265834 3:133943733-133943755 TCCAGTTGTGGTGGCTTCTGTGG - Intronic
963037249 3:141042006-141042028 TATTTTGGTGGTTGCTTTAGAGG - Intergenic
965180092 3:165390993-165391015 TACTTTGGTTGTGGCTTTCTGGG + Intergenic
966121843 3:176530018-176530040 CACTGTGGTGGTGGCTACAGGGG + Intergenic
967276036 3:187775400-187775422 TACTTTGATTTTGGCTTCTAGGG + Intergenic
967505605 3:190249633-190249655 TATGTTGGGGGTGGCTCCTGAGG + Intergenic
967873206 3:194249297-194249319 TACTTTGCAGGTGTGTTCTGAGG + Intergenic
968392220 4:203118-203140 AACTTGGGTTGTGGCTTCAGAGG + Intergenic
968832482 4:2940224-2940246 GAGTTGGCTGGTGGCTTCTGAGG + Intronic
974209823 4:58757062-58757084 GACTTTGATGGTGGCTTCCTGGG - Intergenic
975899853 4:79139182-79139204 TTCTTTAGTGGTGACTTCTGAGG + Intergenic
979766709 4:124472345-124472367 GATATTGGGGGTGGCTTCTGAGG - Intergenic
982544675 4:156719361-156719383 AACTTTGGTGGAGACTTCTTTGG + Intergenic
982593692 4:157350461-157350483 TTCTTTAGTGGTGATTTCTGAGG + Intronic
982803984 4:159740248-159740270 TTCTTTGGTGGTGATTTCTCAGG + Intergenic
983409575 4:167379882-167379904 TACTTTGGTGGTCTGCTCTGGGG - Intergenic
984118406 4:175711038-175711060 AACTTTATTGTTGGCTTCTGAGG + Intronic
986003053 5:3645020-3645042 TACTTTGTTGGTCTCCTCTGCGG + Intergenic
986439578 5:7768064-7768086 TTCTTTCCTGGAGGCTTCTGAGG + Intronic
987015917 5:13819446-13819468 TACATTGTTGGTGGTTGCTGAGG - Intronic
987143147 5:14965952-14965974 TATCTTGGTGATGGCATCTGTGG + Intergenic
987846182 5:23290347-23290369 TTCTTTAGTGGTGATTTCTGAGG + Intergenic
991186010 5:63808566-63808588 AACTTGGGTGCTGGGTTCTGAGG - Intergenic
992134733 5:73733050-73733072 TTCTTTAGTGGTGATTTCTGAGG + Intronic
993032670 5:82723436-82723458 TAGGTTGGTGGTTGCTACTGTGG - Intergenic
993752575 5:91689493-91689515 TTCTTTAGTGGTGATTTCTGAGG + Intergenic
993948078 5:94138594-94138616 TTCTTTTGTGGTGATTTCTGAGG + Intergenic
994517595 5:100790475-100790497 CACTGAGGTGGTGGCTTCAGTGG + Intergenic
994822655 5:104674077-104674099 CACTTTGGTGGTGGCTTAGGCGG - Intergenic
995619423 5:114007603-114007625 GACTGTGTTGGGGGCTTCTGAGG + Intergenic
996177568 5:120378532-120378554 AACTTAGGTCGTGGCTTCAGAGG + Intergenic
997221438 5:132169446-132169468 TAGTTTGGTGGGAACTTCTGAGG + Intergenic
997288181 5:132699394-132699416 TTCTTTGGTTTTAGCTTCTGTGG - Intronic
1004160796 6:13211179-13211201 TTCTTTAGTGGTGATTTCTGAGG + Intronic
1004631011 6:17421317-17421339 TTCTTTAGTGGTGATTTCTGAGG - Intronic
1005610874 6:27523978-27524000 AACTTTGGTGGTGGCGTTGGAGG + Intergenic
1006286866 6:33103568-33103590 TTCTTTAGTGGTGATTTCTGAGG - Intergenic
1006408579 6:33859007-33859029 CACTTTAGTGGTGCCTTCCGGGG - Intergenic
1006574149 6:35031616-35031638 TACTGAGGTGGTGGCCGCTGAGG - Intronic
1007272516 6:40649292-40649314 TGCTTTGATTGTGGCTACTGTGG + Intergenic
1007578832 6:42943157-42943179 TACTTGGGAGGTGGCTTGAGAGG + Intergenic
1009377561 6:62991013-62991035 AACTCAGGTGGTGGCTTCAGAGG - Intergenic
1009390425 6:63137512-63137534 AACGTTGGGGGTGGCTCCTGGGG + Intergenic
1010146389 6:72674395-72674417 TTCTTTAGTGGTGATTTCTGAGG - Intronic
1010415969 6:75612116-75612138 TGATTTGGTGGTGGCTTGTGTGG + Intronic
1011778386 6:90758793-90758815 TTCTTGGTTGGTGGCTGCTGTGG + Intergenic
1012192204 6:96294046-96294068 TTCTTTAGTGGTGATTTCTGAGG - Intergenic
1013381346 6:109574769-109574791 TTCTTTGGTGGTGATTTCTGAGG + Intronic
1017043230 6:150324493-150324515 TTCTTTAGTGGTGACTTCTGCGG - Intergenic
1017070713 6:150573421-150573443 GTCCTGGGTGGTGGCTTCTGAGG + Intergenic
1019318392 7:402177-402199 CACGTTGGTGGAGGTTTCTGTGG - Intergenic
1020806644 7:12797978-12798000 TACAGTGGTGATGGCTTTTGGGG + Intergenic
1021458968 7:20863978-20864000 TAATTTGTTGATGTCTTCTGTGG - Intergenic
1022094627 7:27130885-27130907 AACTTTGGTGGCGGCGTCTGCGG - Intronic
1023503393 7:40874748-40874770 AAGTGTGGTGGTGGCTTCTCAGG - Intergenic
1024551419 7:50565712-50565734 TACTTTGGGGCTGCCTTCAGGGG - Intergenic
1024863992 7:53881455-53881477 TACTGTGTTGCAGGCTTCTGCGG + Intergenic
1024958582 7:54951537-54951559 TGTATTGGGGGTGGCTTCTGAGG + Intergenic
1025097555 7:56108136-56108158 TTCTTTAGTGGTGATTTCTGAGG - Intergenic
1025226858 7:57173067-57173089 TACTGTGGTGATGGCTATTGAGG - Intergenic
1027732717 7:81896628-81896650 TTCTTTAGTGGTGATTTCTGAGG + Intergenic
1028823149 7:95236070-95236092 TTCTTTAGTGGTGATTTCTGAGG - Intronic
1029968087 7:104761532-104761554 TACTCTGGTGCTGGTTTCAGAGG + Intronic
1030004886 7:105107899-105107921 TTCTTTTGTGGTGGATTCTGGGG - Exonic
1031200892 7:118684026-118684048 TTCCTTGGTGGTGGTTGCTGAGG - Intergenic
1031463630 7:122081781-122081803 TACTTTTTTGGTGGGTTGTGGGG - Intronic
1031796892 7:126186198-126186220 TCCTTTGGTGGGGGTTGCTGTGG + Intergenic
1032298970 7:130668943-130668965 TATTTGGGTGGCGACTTCTGCGG + Exonic
1034301712 7:150021529-150021551 TTCTTTAGTGGTGATTTCTGAGG + Intergenic
1034804334 7:154075738-154075760 TTCTTTAGTGGTGATTTCTGAGG - Intronic
1037829321 8:22178698-22178720 GGCTCTGGTTGTGGCTTCTGGGG - Intronic
1038652994 8:29422461-29422483 TCCTGTTGTGGTGTCTTCTGTGG - Intergenic
1039626897 8:39063292-39063314 TATTTTGGAGGTGGATCCTGAGG + Intronic
1039685068 8:39792680-39792702 TACTTTGGGGATGGTTTCTTGGG - Intronic
1041593519 8:59619719-59619741 TACTTTTGGGGCTGCTTCTGAGG - Intergenic
1041926794 8:63245360-63245382 TTCTTTAGTGGTGATTTCTGAGG + Intergenic
1042603597 8:70524381-70524403 TTCTTTCATGATGGCTTCTGAGG - Intergenic
1043503200 8:80876156-80876178 AAATCTGGTGGTGGCATCTGAGG - Intergenic
1044943816 8:97371106-97371128 TTCTTTAGTGGTGACTCCTGAGG - Intergenic
1045843718 8:106608425-106608447 CATCTTGGTGGTGGTTTCTGTGG + Intronic
1045982942 8:108213261-108213283 TGCTTTGGTGTTTGCTTCCGAGG - Intronic
1045982996 8:108213936-108213958 TGCTTTAGTGTTTGCTTCTGAGG - Intronic
1046571155 8:115967826-115967848 TACTTTGTTAATGCCTTCTGTGG - Intergenic
1049896700 9:116576-116598 GCCTTCGGTTGTGGCTTCTGTGG - Exonic
1050702068 9:8351831-8351853 CACTTGAGTGGTGTCTTCTGAGG + Intronic
1052263293 9:26542438-26542460 TTCTTTGGTGGAGAGTTCTGTGG - Intergenic
1053578876 9:39382272-39382294 TACTTTAGTGCTGGTTTGTGTGG + Intergenic
1053843391 9:42210347-42210369 TACTTTAGTGCTGGTTTGTGTGG + Intergenic
1054100459 9:60941076-60941098 TACTTTAGTGCTGGTTTGTGTGG + Intergenic
1054121856 9:61216701-61216723 TACTTTAGTGCTGGTTTGTGTGG + Intergenic
1054585888 9:66965810-66965832 TACTTTAGTGCTGGTTTGTGTGG - Intergenic
1056501697 9:87215999-87216021 TACTTTGGGGATGGCTACTTTGG - Intergenic
1056572997 9:87832677-87832699 TGTTTGGGTGGTGGCTTCAGGGG - Intergenic
1057380952 9:94567193-94567215 TGTTTGGGTGGTGGCTTCAGGGG - Intronic
1059241279 9:112808066-112808088 TATTTTGGTGGTGCATTCAGAGG + Intronic
1060941738 9:127546448-127546470 AACATTGGTGGTGGGTTCTCAGG - Intronic
1186685142 X:11917798-11917820 TACTTGGGTGATGGGTTCAGTGG + Intergenic
1189170674 X:38906371-38906393 TAGTTTTGTGCTGGCTTTTGAGG + Intergenic
1189376901 X:40473654-40473676 TACCTTTGTTGTGGTTTCTGCGG - Intergenic
1190390589 X:49927459-49927481 TACTTTGCTGGTTACTTCAGAGG - Intronic
1190395947 X:49983721-49983743 AACTTTGGTGGTTGCTGCTGTGG + Intronic
1192118853 X:68435896-68435918 CACTTTGGTGGGGGCTGCAGTGG - Intergenic
1195623229 X:106980170-106980192 AACTTTGTTGATGGCTTTTGGGG - Intronic
1195696712 X:107672958-107672980 GACATTGGTGGTGGGTTTTGAGG + Intergenic
1197581474 X:128288885-128288907 CATATTGGTGGTGGCTACTGGGG + Intergenic
1198177127 X:134167666-134167688 TTCTCTGGTGGTGGCGGCTGGGG - Intergenic
1201674345 Y:16562485-16562507 TACTTTAGTTCTGGCTTTTGGGG - Intergenic