ID: 1162662391

View in Genome Browser
Species Human (GRCh38)
Location 19:12180813-12180835
Sequence TGTGATGCTGACTTTGGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 277}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162662391 Original CRISPR TGTGATGCTGACTTTGGACA TGG Intronic
900123785 1:1060552-1060574 CGTGCTGCTGACTTTGCAAACGG + Intergenic
901758345 1:11455020-11455042 GGTGTTGCTGGCTTTGAACATGG - Intergenic
902135272 1:14299835-14299857 TGTTCTGCTGACTTTGGGCTTGG - Intergenic
902408172 1:16197748-16197770 AGTGCTGCTGATTTTGGACTCGG + Intergenic
902725303 1:18331768-18331790 AGAGATGCTGACTGTGGAGATGG + Intronic
903090793 1:20914405-20914427 TGTGTTGCTGGCTTTGAAGATGG + Intronic
904532941 1:31181329-31181351 TGTCCTGCTGTTTTTGGACAGGG + Exonic
904953729 1:34265720-34265742 TTTGCTTCTGGCTTTGGACAGGG + Intergenic
905998446 1:42402465-42402487 GCTGTTGCTGGCTTTGGACATGG + Intronic
906886428 1:49653305-49653327 TGAGATGCTGACCTTGGATGTGG - Intronic
907619559 1:55962629-55962651 TGTGCTGCTCACTTTGAAGATGG - Intergenic
908888144 1:68813686-68813708 TATGCTGCTGACTTTGAAGAAGG + Intergenic
909098178 1:71315932-71315954 TGTCATGCTCACTTTGCTCAGGG + Intergenic
909134764 1:71784058-71784080 GGGGATGCTGATATTGGACAAGG + Intronic
911766187 1:101677923-101677945 TGTGTTGCTGAATTGTGACATGG + Intergenic
912931581 1:113968529-113968551 GCTGATGCTGATCTTGGACAGGG - Exonic
913333076 1:117683377-117683399 TGAGATGCAGAGTTTGGAGAAGG + Intergenic
917030016 1:170679989-170680011 TCTGATGCTGATTTTTGAAAAGG + Intronic
919501694 1:198345399-198345421 GGGGATGTTGACTTTGGTCATGG - Intergenic
919662481 1:200260808-200260830 TGTCTTGTTGACTTTGGACTTGG - Intergenic
920525774 1:206664806-206664828 AGTGATGCTGGCTTCTGACAGGG - Intronic
920613686 1:207468216-207468238 CGAGATGCTGACTTAGGATATGG - Intronic
923773899 1:236961286-236961308 TGTGCTGCTGGCTGTGGAGATGG - Intergenic
924499291 1:244622050-244622072 TGTCATTCAGACTTTGGACTTGG - Intronic
924624268 1:245686723-245686745 TGTGATGCTGACCTCGGAGACGG - Exonic
924920093 1:248619839-248619861 TGTGACTCTGACTTCTGACATGG + Intergenic
1062808853 10:447169-447191 TGTGATCCTGAGTATCGACAGGG - Intronic
1062808882 10:447319-447341 TGTGATCCTGAATATCGACAGGG - Intronic
1062808892 10:447369-447391 TGTGATCCTGAGTATCGACAGGG - Intronic
1062808938 10:447617-447639 TGTGATCCTGAGTATAGACAGGG - Intronic
1062808992 10:447917-447939 TGTGATCCTGAGTATAGACAGGG - Intronic
1062809056 10:448267-448289 TGTGATCCTGAGTATAGACAGGG - Intronic
1062809131 10:448668-448690 TGTGATCCTGAATATCGACAGGG - Intronic
1062809149 10:448768-448790 TGTGATCCTGAGTATCGACAGGG - Intronic
1062809214 10:449168-449190 TGTGATCCTGAGTATTGACAGGG - Intronic
1063925613 10:10974077-10974099 AGTTAGGGTGACTTTGGACATGG + Intergenic
1064090338 10:12377985-12378007 TGAGATTCTGATTTTGCACATGG + Intronic
1065005390 10:21375111-21375133 TGTTCTGATGACTTTGGAGAAGG + Intergenic
1066479851 10:35785394-35785416 TGAGATGCTGTTTTTGGAGAAGG - Intergenic
1068526978 10:58141787-58141809 AGTGATGCTGACGATGGAGAAGG + Intergenic
1069086571 10:64146836-64146858 TGTGCTACTGACTTTGCAGATGG + Intergenic
1069656934 10:70096866-70096888 TGTAATGCTGACTTTTCCCAGGG - Intronic
1070890497 10:79939377-79939399 TCTTATGCTGACTTTGTTCAGGG - Intronic
1071054805 10:81497114-81497136 TGGGGCGCTGACTATGGACATGG - Intergenic
1071668022 10:87579100-87579122 GCAGATTCTGACTTTGGACAAGG - Intergenic
1073548978 10:104379856-104379878 TGTTATGCTAATTTTGCACAAGG - Intronic
1074716961 10:116228645-116228667 TGTGTTGCTGACTTTGAAGATGG + Intronic
1077482431 11:2822094-2822116 TGTGCTGCTGGCTTTGAAGACGG + Intronic
1077915606 11:6609749-6609771 TGTGAAGTTTGCTTTGGACATGG + Exonic
1077957829 11:7039943-7039965 CCTGATTCTGACTTTGGCCAGGG - Intronic
1078861389 11:15250241-15250263 ACTGTTGTTGACTTTGGACAGGG + Intergenic
1082374296 11:51845316-51845338 TGTGATGATTTCTTTGGAAACGG + Intergenic
1082518806 11:53936285-53936307 TGTGAAGATTTCTTTGGACACGG + Intergenic
1082821645 11:57547998-57548020 TGTGTTGCTCACTTTGGCCTTGG + Intronic
1083040167 11:59678366-59678388 TATGCTGCTGACTTTGAAAATGG - Intergenic
1083151949 11:60797532-60797554 TGTGATGCTGGCTTTGAAGGTGG - Intronic
1083842439 11:65312271-65312293 TGTGTTGCTGCCTTTGAAGATGG - Intergenic
1083933540 11:65858727-65858749 TGTTTTACTGACGTTGGACATGG - Intronic
1084427292 11:69091859-69091881 TTTGTTGCTGACTTTGAAGATGG - Intergenic
1084563488 11:69917006-69917028 AGTGCTGCTGACTTTGAAGATGG - Intergenic
1088084748 11:105963818-105963840 TGTGAAACTGTCTTTGGATATGG + Intronic
1093204376 12:16229618-16229640 TGTGTTGCTTACTTTGAACCTGG - Intronic
1094202229 12:27805957-27805979 TGTTATGCTTACTGTGGTCAGGG + Intergenic
1094735115 12:33225257-33225279 TGTGATGCTTATGATGGACAAGG + Intergenic
1097068879 12:56340257-56340279 TGTGATGCTGACCTATGATAAGG + Exonic
1097522078 12:60681831-60681853 TGTGAAGCAGACTTTGGAACTGG - Intergenic
1097910834 12:64967587-64967609 TGTGAGGCTGAATTTGGAGGTGG + Intergenic
1098165901 12:67697268-67697290 TGTGAGGGAGACTCTGGACATGG + Intergenic
1098741289 12:74176810-74176832 TGTGAGGCTGTATTTGGAGATGG + Intergenic
1099030475 12:77520152-77520174 TATGATGCTGGCTTTGAAGATGG - Intergenic
1099411245 12:82330671-82330693 TGTGATTTTGACTTAGGAAAAGG - Intronic
1102576721 12:113860387-113860409 TGCCATGCTGGCTTTGAACAGGG + Intronic
1102789935 12:115636385-115636407 TGTGTGTATGACTTTGGACAGGG - Intergenic
1104160048 12:126169418-126169440 CATGATGCTGACATGGGACACGG + Intergenic
1105624675 13:22101377-22101399 TATGTTGCTGACTCTGGAGATGG + Intergenic
1106934228 13:34700631-34700653 TGTGATTTTGGCTTTTGACAGGG + Intergenic
1107677295 13:42810682-42810704 TTGGATGCTGACTATGGATAAGG + Intergenic
1108433597 13:50379619-50379641 TGTGAAGCTGACTTTTCAGAGGG + Intronic
1110084896 13:71365410-71365432 TGTGAAAGTGGCTTTGGACATGG - Intergenic
1110432717 13:75443749-75443771 TGTGATTCTGAGTAGGGACAGGG - Intronic
1110600606 13:77368225-77368247 AGTGATGCTGGCTTTGTAGAAGG - Intergenic
1111478986 13:88796471-88796493 CATTATGCTGACTTTGGCCAAGG - Intergenic
1111551335 13:89817458-89817480 TGTGGAGGTGACTTTGGAAATGG + Intergenic
1111904128 13:94235900-94235922 TGTAATGGAGACATTGGACAAGG - Intronic
1114494899 14:23125945-23125967 TGTCATGCTGTCTTGGGGCAGGG - Exonic
1117050226 14:51852982-51853004 TGTGATAGTGATTTTGGAAAAGG - Intronic
1117794159 14:59374664-59374686 TGTGATGCTGAGCAAGGACACGG + Intergenic
1117835273 14:59798537-59798559 TATGATGCTGGCTTTGAAGATGG - Intronic
1118229735 14:63936842-63936864 GGTGATGGTGACTTGGGCCAGGG + Intronic
1119419314 14:74497909-74497931 TGTGCAGCTGGCTTTGGGCAGGG + Intergenic
1121198406 14:92096238-92096260 TGTGCTGTTAACTTTGGAAATGG - Intronic
1121970270 14:98349472-98349494 TGTGAAGATGTATTTGGACATGG + Intergenic
1123795488 15:23766363-23766385 TGTGAAGGTGACTTTGGAACTGG + Intergenic
1123928853 15:25147382-25147404 TGTGATGATGCCTTTAGGCAAGG + Intergenic
1124086328 15:26553745-26553767 TGTGCTCCTGACTAAGGACAGGG - Intronic
1126290627 15:47072933-47072955 TGTGATGCAGGCTTTGAAAATGG - Intergenic
1126450071 15:48797626-48797648 TGTGATGATGACTTTGGTGAGGG - Intronic
1128081521 15:64860000-64860022 TGCGATGCAGTCTGTGGACATGG + Intronic
1128332196 15:66763211-66763233 TGGCATGCTGACCTTGGGCAGGG - Intronic
1128414178 15:67428914-67428936 TGTGCTGCTGGCCTTGAACAAGG + Intronic
1132518962 16:378711-378733 GGCTATGATGACTTTGGACACGG + Intronic
1134847883 16:17456180-17456202 TGTGAAACTGACTGTGGACGTGG - Intronic
1134872776 16:17666831-17666853 TGTGTTGCTGGCTTTGAAGATGG - Intergenic
1135353103 16:21746573-21746595 TCTGCTGCTGATTTTGGAGATGG + Intronic
1135451590 16:22562696-22562718 TCTGCTGCTGATTTTGGAGATGG + Intergenic
1135597011 16:23752613-23752635 TGGGATGCTGATCTTGGAAAGGG - Intergenic
1138498224 16:57421795-57421817 TGCCATGCTGGCTTTGGAGAAGG - Intergenic
1140868211 16:79082734-79082756 TGTGATGCAAACTTTTGAGAAGG + Intronic
1141282617 16:82642742-82642764 TGTGGTGCTGATTTTGAACCAGG + Intronic
1142157775 16:88540422-88540444 TCTGATGCTGTCCTTGGGCAGGG + Intergenic
1142501104 17:333758-333780 TGTGAACCTGACTATGGAAAAGG - Exonic
1142907677 17:3056254-3056276 TGTGGTGCTGACTTTGGGGCGGG + Intergenic
1142926888 17:3248005-3248027 TGTGGTGCTGACTTTGGGGCGGG - Intergenic
1145843383 17:28015693-28015715 TATGGTGCTGATTTTTGACAAGG - Intergenic
1146015731 17:29232026-29232048 TGTGCTGCTGGCTTTGGAGGTGG + Intergenic
1148162854 17:45461455-45461477 TGTGATACTGACTTAGGCAATGG - Intronic
1150050252 17:61955071-61955093 TATGTTGCTGACTTTGAAGATGG - Intronic
1150394084 17:64808107-64808129 TGTGATACTGACTTAGGCAATGG - Intergenic
1152853911 17:82652937-82652959 AGTGATGCTGATTTTGGACTTGG + Intergenic
1153339229 18:3957218-3957240 TTTGCTGCTGAGTTTGGAGATGG + Intronic
1153673209 18:7432323-7432345 TGTGAGGCTGACTTTGCAGAAGG - Intergenic
1155220237 18:23678511-23678533 TGTCATCGTGACTTTGCACACGG - Intergenic
1155753058 18:29453493-29453515 TGTGATGTTTCCTTTGGGCAAGG - Intergenic
1156057852 18:33032323-33032345 TCTAATGCTGACTTTGAAAAAGG - Intronic
1159816101 18:73075358-73075380 TGTTGTGCTGACTTTGAAAATGG - Intergenic
1160396036 18:78572829-78572851 AGTGCTGCTGACTTTGGAGGTGG + Intergenic
1161909111 19:7179391-7179413 TCTGATGCTAACTTTGGAGGAGG + Intronic
1162662391 19:12180813-12180835 TGTGATGCTGACTTTGGACATGG + Intronic
1166060411 19:40322092-40322114 GATGATGCTGACTTTAGACAAGG + Exonic
1166257591 19:41617672-41617694 TGTGCTGCTGGCTTTGAAGATGG + Intronic
1167156690 19:47743141-47743163 AGTGAGGCTGGCTTGGGACAGGG + Intergenic
926443745 2:12919152-12919174 TGTCAGGCTGACTTAGGAGAAGG - Intergenic
929311309 2:40429206-40429228 TTTGCTGCTGACTTAGGACTTGG + Exonic
930034916 2:47079354-47079376 TGTGATGCTGACATTGCCGAAGG + Intronic
930419563 2:51134225-51134247 TGTGGAGGTGACTTTGGACCTGG + Intergenic
932720732 2:74137610-74137632 TTGTTTGCTGACTTTGGACAAGG - Intronic
932750835 2:74370735-74370757 TGAGATGGCCACTTTGGACAAGG - Exonic
934032858 2:88064170-88064192 TGTGTTGCTGACTTTAAAGATGG - Intergenic
935400727 2:102657443-102657465 AGTGATACTGACTTGGGAGATGG + Intronic
936631318 2:114206168-114206190 AGTGTTTCTGACTTAGGACATGG + Intergenic
937141308 2:119603922-119603944 TTAGAAACTGACTTTGGACATGG - Intronic
937670477 2:124532742-124532764 TGTGATCCTGATTTTGCAAAAGG - Intronic
938017352 2:127878172-127878194 TGAGATGTTGACTTTGGGCTTGG - Intronic
938556121 2:132425771-132425793 TCTGTTGCTGGCTTTGGAGATGG + Intronic
939297599 2:140289953-140289975 TCTGATCCTGCCTTTGGAGAGGG + Intronic
940813513 2:158273035-158273057 TGAGATGATGACTTTGGAAGAGG + Intronic
943090660 2:183370731-183370753 TGTGATGATGTGTTTGGAGATGG - Intergenic
944977738 2:205076362-205076384 TGTGATGCTAAATGTGGAAAGGG - Intronic
946507960 2:220321715-220321737 TGAGGTGCTGACTGAGGACAAGG + Intergenic
946883184 2:224196368-224196390 TTTGATGTTGACTTGGGAGAAGG + Intergenic
947315076 2:228848649-228848671 TGCCATGTTGACTTTGGACTTGG + Intergenic
947523313 2:230864620-230864642 GGGGATGCTGGCCTTGGACAGGG + Intronic
947690096 2:232127465-232127487 TGTGATGCAGGCATTGGAGATGG - Intronic
948171105 2:235903948-235903970 TGTGGGGCTGCCTTTGGAGAAGG - Intronic
948538609 2:238668209-238668231 TGTGGTGCTGTCTGTGGACCAGG + Intergenic
948701090 2:239760814-239760836 GCTGATGCTGACTGTGGGCAGGG + Intergenic
1168737849 20:158932-158954 AGTGTTGCTGGCTTTGGACGAGG - Exonic
1170909426 20:20549934-20549956 AGTAATGTTCACTTTGGACAGGG - Intronic
1170911841 20:20579723-20579745 TCTGAAACTGACTTTGGACATGG + Intronic
1171068898 20:22046819-22046841 TGTGCTGGTGACCTAGGACAGGG + Intergenic
1172845112 20:37925555-37925577 GGTGCTGCTGACTGTGAACAGGG + Intronic
1175643857 20:60654506-60654528 TGAGATACTGACTCTGGCCAGGG + Intergenic
1176171898 20:63699887-63699909 TGTGATGCAGCCTCGGGACAGGG - Exonic
1176172899 20:63704177-63704199 TGTGGTGCTGGCTCTGCACAAGG + Intronic
1176950040 21:15033563-15033585 TGTAATGGTGACTTTCAACATGG + Intronic
1177082555 21:16658672-16658694 TTTGATGCTTTCTTTGGAAATGG + Intergenic
1179794353 21:43774184-43774206 TCTGATCCTGACTTTGGACAAGG - Exonic
1182535082 22:30995019-30995041 GGTGATGCTGCCTTTTCACATGG + Intergenic
1183633691 22:39048195-39048217 TGTGATGCAGAGGCTGGACAGGG + Intronic
1184420368 22:44378628-44378650 GGTGATGCTGACTGTTGACTGGG - Intergenic
1185052581 22:48561615-48561637 TGTGATGATGACGGTGGCCACGG + Intronic
1185109796 22:48894551-48894573 TGTGCTGCTGATTTCAGACAGGG - Intergenic
949509931 3:4758866-4758888 TGTGATGCTGACATGGCAGATGG - Intronic
951427963 3:22570951-22570973 TGTGATGCATACTTTGGATTTGG + Intergenic
952084699 3:29804014-29804036 TGTGATGCTGGATTTGGATTAGG - Intronic
952580429 3:34826273-34826295 TGTGATGCTGAAGTTGAACATGG + Intergenic
953202460 3:40789702-40789724 TATGCTGCTGACTTTGAAGAAGG + Intergenic
954132766 3:48568731-48568753 TGTGATGCTGGCTCTGGACCTGG + Intronic
954703123 3:52462575-52462597 TGTGTTGCTGACATTGGATAGGG + Intronic
956640002 3:71406483-71406505 AATGTTGCTGACTTTGGAAATGG - Intronic
957632287 3:82732719-82732741 TGTGTTCTTGACTTTGGGCAAGG - Intergenic
960571837 3:119192080-119192102 TGGCATGCTGACTATGGTCATGG - Intronic
961658257 3:128454939-128454961 TGTGCTGCTGGCTTTGAAGATGG + Intergenic
963833947 3:150037435-150037457 TTTGATGCTGACTTCGGATGGGG - Intronic
963893866 3:150664716-150664738 TGTGGTGCTTACTTTGGGGAAGG + Intronic
966103334 3:176303506-176303528 ATTGAGGCTGACTTTGGGCATGG - Intergenic
966171137 3:177082055-177082077 TTGTATGCTGACTTTGGAGATGG - Intronic
968045130 3:195619705-195619727 TGTGGTGCCGGCTGTGGACAGGG - Intergenic
968060985 3:195726042-195726064 TGTGGTGCCGGCTGTGGACAGGG - Exonic
968480995 4:832966-832988 TTTGGTGCTGACTGTGGACGTGG + Intergenic
968541831 4:1171934-1171956 GGTGATGCTGTATTTGGCCAGGG + Exonic
969135113 4:5023082-5023104 TGTGCTGCTGGCTTTGAAGATGG + Intergenic
969268909 4:6085581-6085603 TGTGATTCTGGCCTTGGAGAAGG - Exonic
970143021 4:13003226-13003248 TATGCTGCTAACTTTGGAGATGG - Intergenic
970932960 4:21534863-21534885 TGTGAAGCTGACTGTGATCAGGG - Intronic
971646106 4:29205797-29205819 TCAGATGCTGACTTTGGAGAAGG - Intergenic
971839393 4:31814440-31814462 GATGATGCTGCCTTTGGCCAGGG - Intergenic
972791432 4:42374964-42374986 TGTGATGCTGGCTTTGAAGATGG - Intergenic
973198001 4:47467495-47467517 AATGATGCTGTTTTTGGACAGGG + Intergenic
974809221 4:66923794-66923816 GGTGACACTGACTTTAGACAGGG - Intergenic
975135371 4:70869269-70869291 GGTGGTGGTGAGTTTGGACATGG - Intergenic
975282895 4:72583236-72583258 TGTCACACTGGCTTTGGACAGGG + Intergenic
975335056 4:73166538-73166560 TGTGATGTTGAGATTGAACAAGG - Intronic
975886641 4:78974265-78974287 AGTGATGCTGTCTTTGTATACGG + Intergenic
978223573 4:106306522-106306544 TCTGAAGCTGACTTGGGACCTGG + Intronic
980214902 4:129839507-129839529 TCTGTTGTTGACTTTGGATATGG + Intergenic
980562198 4:134491999-134492021 TTTTATGCTGATTTTGGATATGG - Intergenic
980671243 4:136009357-136009379 TGTGAGGCTGCAGTTGGACAAGG - Intergenic
981321422 4:143396166-143396188 AGTGACCCTGACTCTGGACAAGG + Intronic
981814375 4:148813377-148813399 TGAGATGATGATTTTGTACAGGG - Intergenic
982545309 4:156725328-156725350 TGTGAGGCTGCGGTTGGACAAGG - Intergenic
984078799 4:175216362-175216384 TGTGACGCTGGCTGTGGACCTGG - Intergenic
985187811 4:187336497-187336519 TGTGATTGTGACAATGGACAAGG - Intergenic
985801850 5:2009643-2009665 TGTGATTCTGACTGTAGTCATGG + Intergenic
986350070 5:6868978-6869000 TGTGATGCTGAGCCTGGACCTGG - Intergenic
986973341 5:13363845-13363867 TGTTTTCCTGCCTTTGGACATGG - Intergenic
988341185 5:29973892-29973914 GGTGATGCTGACCTTGTAGAAGG + Intergenic
989406941 5:41071887-41071909 AGTGATGCTGACTTGGGAAGCGG - Intergenic
989887130 5:46903815-46903837 TGTGAGGCTTAATTTGGAAACGG + Intergenic
990898930 5:60729242-60729264 TGGGATGCTGAAGTTGGGCAGGG + Intergenic
992771363 5:80051171-80051193 AGTGATGCTGCCTCTGGAGAAGG + Intronic
993779457 5:92047989-92048011 GGTGATGCTGACTTTGTAAAAGG + Intergenic
996144231 5:119953820-119953842 TGTGGTGTGCACTTTGGACAAGG + Intergenic
997161653 5:131615365-131615387 TGTAATGCTGAGCTTGGAAAAGG + Intronic
998521579 5:142805839-142805861 TCTGTTGCTGATTTTGGACCAGG + Intronic
998633252 5:143924817-143924839 AGAGATGCTGACTCTGGAGAGGG - Intergenic
998690901 5:144586305-144586327 TCTGCTGCTGCCGTTGGACAGGG - Intergenic
1001233908 5:170013521-170013543 TGTGTTGCTGGCTTTGAAGATGG + Intronic
1005316717 6:24609791-24609813 TATGAGCCTGACTTTTGACAAGG + Intronic
1007530887 6:42541180-42541202 TGGGCTTCTGTCTTTGGACATGG - Intergenic
1010210049 6:73355361-73355383 GGTGATGCTAACTTGGGTCAAGG - Intergenic
1011779907 6:90776410-90776432 TGTAATGGTGACTATGGAAAAGG - Intergenic
1011940419 6:92835878-92835900 ATTGATGCTGACTATTGACAGGG + Intergenic
1012346717 6:98196412-98196434 TGAGAATCTGACTTTGGACTTGG - Intergenic
1016298376 6:142601004-142601026 GGTGATTCTGAGTTTGGCCATGG + Intergenic
1017036168 6:150269312-150269334 TGTGAGGATGATTTTGGACAAGG + Intergenic
1017724289 6:157266101-157266123 TGTGATTTTGATTTGGGACAGGG + Intergenic
1019505560 7:1388798-1388820 TGTGAGGCTGACTTAGGGAAGGG + Intergenic
1022673485 7:32477365-32477387 TGAGATGCTGACTGTGGAGCTGG + Intergenic
1023105946 7:36763451-36763473 TGTGAAGCTGGCTTTGAAGAAGG - Intergenic
1028048782 7:86157667-86157689 TGTGGGGCTGACTTGGGAGATGG - Intergenic
1029712342 7:102306725-102306747 TGGGATGCTGACCTTGGGCCTGG - Exonic
1030285739 7:107825044-107825066 TACGTTGCTGACTTTGAACATGG + Intergenic
1031156881 7:118120656-118120678 TTTGTGTCTGACTTTGGACAGGG - Intergenic
1031632495 7:124061648-124061670 AGGGTTGCTGACTTTGGAGATGG - Intergenic
1034751737 7:153575349-153575371 TGTGAAGGTGACTTTGGAACTGG + Intergenic
1037148019 8:15597136-15597158 CATGATTCTGACCTTGGACAAGG - Intronic
1038134220 8:24768342-24768364 GGTGATGCTGACTCAGGACTTGG + Intergenic
1038608723 8:29038716-29038738 TGTGATGATGGCTGTGGAGAAGG - Intronic
1041100959 8:54396207-54396229 CGTGGTGCTGACCTTGGAAAAGG + Intergenic
1041568978 8:59314328-59314350 TGTGGTGTTGACTTAGGGCAAGG - Intergenic
1042162337 8:65909650-65909672 TTTGATGCTAACTTTAGATAAGG - Intergenic
1044600829 8:94002956-94002978 TGTAATGCTAACTGTTGACAAGG - Intergenic
1045945646 8:107792667-107792689 GGTGATGCTGACCTTGCAGAAGG - Intergenic
1049239819 8:141531644-141531666 AGTGATGCTGATTTTCGACTGGG + Intergenic
1050008219 9:1157380-1157402 TGTGGGGCTGAATTTGGCCATGG + Intergenic
1050962253 9:11749566-11749588 TGTGCTGCCGACTTTGAAGATGG - Intergenic
1051142379 9:13991671-13991693 GGTGGAGCTGACTTTGGACATGG - Intergenic
1053182132 9:35981758-35981780 TGGGATCCTGAATTTGGAAATGG - Intergenic
1055058967 9:72049260-72049282 TATGCTGCTGACTTTGAAGAGGG - Intergenic
1056795589 9:89656614-89656636 CGTGATGATCACTGTGGACATGG - Intergenic
1056860696 9:90178297-90178319 TGTGTTGGTAAATTTGGACAGGG - Intergenic
1057958289 9:99430093-99430115 GGCAATGTTGACTTTGGACAAGG + Intergenic
1059152612 9:111963146-111963168 TATGCTGCTGACTTTGAAGATGG + Intergenic
1059720742 9:116958069-116958091 TGTGATGTTAACTTTGGTTAAGG + Intronic
1059962473 9:119578787-119578809 TGAGGTCCTGACTTAGGACAGGG - Intergenic
1062094561 9:134696080-134696102 GGTGTGGCTAACTTTGGACAGGG - Intronic
1202799759 9_KI270719v1_random:164556-164578 TGTGAAGCTGAGTCTGGAGATGG + Intergenic
1185448822 X:272296-272318 TGTGATGTGGACTGTGGTCACGG - Intergenic
1185448835 X:272345-272367 TGTGATGTGGACTGTGGTCACGG - Intergenic
1185449029 X:273176-273198 TGTGATGTGGACTGTGGTCATGG - Intergenic
1185449042 X:273225-273247 TGTGATGTGGACTGTGGTCACGG - Intergenic
1185449055 X:273274-273296 TGTGATGTGGACTGTGGTCACGG - Intergenic
1185449104 X:273470-273492 TGTGATGTGGACTGTGGTCACGG - Intergenic
1185449117 X:273519-273541 TGTGATGTGGACTGTGGTCACGG - Intergenic
1185449130 X:273568-273590 TGTGATGTGGACTGTGGTCACGG - Intergenic
1185449266 X:274112-274134 TGTGATGTGGACTGTGGTCACGG - Intergenic
1185449279 X:274161-274183 TGTGATGTGGACTGTGGTCACGG - Intergenic
1185449292 X:274210-274232 TGTGATGTGGACTGTGGTCACGG - Intergenic
1185449305 X:274259-274281 TGTGATGTGGACTGTGGTCACGG - Intergenic
1185449399 X:274651-274673 TGTGATGTGGACTGTGGTCACGG - Intergenic
1185787455 X:2902817-2902839 TGTGCTGCTGGCTTTGAAGATGG + Intergenic
1186880153 X:13857015-13857037 TATGTTGCTGACTTTGAAGATGG - Intronic
1189947553 X:46194655-46194677 TGTGTTGCTTACTTTGAATATGG + Intergenic
1190779942 X:53584294-53584316 TGTGATGCTGACTCTCCTCAGGG - Exonic
1193865738 X:86727944-86727966 TGTGAAGCTGACTTTAGAACTGG + Intronic
1195199013 X:102529230-102529252 TGTGATCCTGAATTTAGCCATGG - Intergenic
1195494194 X:105510714-105510736 ACTGATGCTGACTTTGAAGATGG + Intronic
1197776030 X:130119296-130119318 TGTGATGCTGAGTTAGAACTTGG + Intergenic
1198308158 X:135402935-135402957 TGTGATGTTTATCTTGGACAGGG - Intergenic
1199260693 X:145770825-145770847 TATGATGCTGACTTAGACCAGGG - Intergenic
1199263253 X:145800449-145800471 TATGATGCTTACTATGTACAAGG - Intergenic
1199734782 X:150675632-150675654 TCTGCTGCTGGCTTTGGAGATGG - Intergenic
1201360827 Y:13146839-13146861 TCTTCTGCTAACTTTGGACATGG - Intergenic