ID: 1162662608

View in Genome Browser
Species Human (GRCh38)
Location 19:12182065-12182087
Sequence GGAAGGACAAATAGTCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 183}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162662608_1162662613 29 Left 1162662608 19:12182065-12182087 CCCAGCTGACTATTTGTCCTTCC 0: 1
1: 0
2: 0
3: 6
4: 183
Right 1162662613 19:12182117-12182139 AAGTTTATCATTTTTGCAGAAGG 0: 1
1: 0
2: 5
3: 38
4: 475

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162662608 Original CRISPR GGAAGGACAAATAGTCAGCT GGG (reversed) Intronic
906758608 1:48348154-48348176 GAAAGGACAAATAGTAACTTGGG - Intronic
907383568 1:54110857-54110879 TGAAGGACAAGAAGTCACCTCGG - Intronic
910715638 1:90226270-90226292 GGACTGACAAAAAGTTAGCTGGG + Intergenic
912129840 1:106587518-106587540 GGAAGGAGAAATGGCCAGATGGG - Intergenic
914937379 1:151993257-151993279 GGTAGGACGAGTAGGCAGCTGGG - Intronic
919279317 1:195466710-195466732 GGAAGACCAAAGAGTCAGCTTGG - Intergenic
1064245894 10:13667355-13667377 GGAAGGACATCAAGTGAGCTGGG - Intronic
1068142971 10:53029095-53029117 GGAAGAAAATATAGTCAGTTGGG - Intergenic
1069128583 10:64669757-64669779 GGAATGGTAAATACTCAGCTGGG - Intergenic
1073308659 10:102523664-102523686 GGAATGAGAAATTGGCAGCTTGG - Intronic
1074114740 10:110447295-110447317 GAAGGGACACAGAGTCAGCTAGG + Intergenic
1077135396 11:995633-995655 GGCAGGACACATGGTCAGCCGGG - Intronic
1079115658 11:17639143-17639165 GCAAGGATAAATAGGCAGATGGG - Intronic
1082066907 11:47908478-47908500 GAAAGGACAAATATTCTGATAGG + Intergenic
1084411340 11:69007928-69007950 GGCAGGACCGATACTCAGCTGGG - Intronic
1085049974 11:73375423-73375445 GGAAGGTAAATAAGTCAGCTGGG - Intergenic
1086113094 11:83219614-83219636 GGAAGAAAATATAGTCAGTTGGG - Intronic
1086200804 11:84199566-84199588 GGAAGAACAAATAGGAATCTTGG + Intronic
1087618494 11:100516429-100516451 AGAAGGAAAAATACTGAGCTTGG + Intergenic
1087915925 11:103810758-103810780 GGAAGGCCAGAGAGGCAGCTGGG - Intergenic
1087963711 11:104385785-104385807 AGAAGAACAAAGAGTCAGCCGGG - Intergenic
1088304167 11:108390407-108390429 GGAAGAAAAAATAGGCATCTCGG - Intronic
1091109547 11:132953090-132953112 GGAAGGAAAAAGAGTAGGCTAGG - Intronic
1093545220 12:20337587-20337609 GGAAGCGCAAATAGTCATATGGG - Intergenic
1094080238 12:26526752-26526774 GGCAGGGCAGATAGGCAGCTGGG + Intronic
1094395987 12:30006386-30006408 AGAAGGCCAAATAGGGAGCTGGG + Intergenic
1094827825 12:34286439-34286461 GGAAGGAAAAAAAGACAGCGTGG + Intergenic
1095505459 12:42892879-42892901 GGAGAGAGAAATAGTCACCTGGG + Intergenic
1095971979 12:47908337-47908359 GGAAAAACAAACAGTCAGATGGG - Intronic
1097323697 12:58252519-58252541 GGAAGGAAAAATAGGCAGGGAGG - Intergenic
1099929135 12:89053182-89053204 GGAAGAAAAAATAGTCTTCTGGG - Intergenic
1101438291 12:104682923-104682945 AGAAGGACAGAGAGTCAGGTGGG - Intronic
1102031025 12:109740225-109740247 GAAAGGACACATCGACAGCTGGG + Intronic
1102490073 12:113285323-113285345 GGATGGACAGATGGTTAGCTGGG + Intronic
1106240437 13:27908032-27908054 TGAAGGTCAAATAGTGAGTTTGG - Intergenic
1110311539 13:74055857-74055879 GGAAGGACAAACAGCAGGCTTGG + Intronic
1113728320 13:112622367-112622389 GGAAGGACACAGGGACAGCTAGG - Intergenic
1116200920 14:41794216-41794238 GGAAGCAGAAATAGTCAAATGGG - Intronic
1116326253 14:43536111-43536133 GGAAGAAAATATAGTCAGTTGGG + Intergenic
1117719764 14:58618056-58618078 TGAAGGCCAAATAGCCAGCCAGG - Intergenic
1118921698 14:70155214-70155236 GAAATGATAAATATTCAGCTGGG - Intronic
1120629492 14:86872715-86872737 GGAAAGAAAAAAAGTTAGCTGGG + Intergenic
1120727627 14:87962710-87962732 GGAAGTGCATATAGTCAGCAGGG - Intronic
1121512514 14:94522820-94522842 GAAAGCCCAAATAGCCAGCTGGG - Intergenic
1123804107 15:23853869-23853891 GGAAGGGCACATGGTCAGCAGGG + Intergenic
1124563363 15:30794724-30794746 CCAAGGACAAATAGGGAGCTGGG + Intergenic
1125003706 15:34795771-34795793 GGATGGCCAAATAGGGAGCTGGG + Exonic
1128681652 15:69656899-69656921 GGAAGGATGAATAGTCAACAGGG - Intergenic
1129625716 15:77196687-77196709 GGTAGGAAAAATAATCAACTTGG + Intronic
1131073897 15:89482988-89483010 GTATGGAGAAATAGACAGCTGGG - Intronic
1131664999 15:94560723-94560745 GAAATGACAAATAGTCAAGTGGG - Intergenic
1133633393 16:7643323-7643345 GGAAATAAAAATAGTCATCTAGG - Intronic
1134212191 16:12287030-12287052 GGAAGGAGAAAGAGTGAGCCAGG - Intronic
1134682586 16:16136749-16136771 GAAGGGACAAATGGTCATCTGGG - Intronic
1134777923 16:16868981-16869003 GGAAGGGAAAAAAGTCAGCTGGG - Intergenic
1135132342 16:19863368-19863390 GAAAGTACATATAGTCAGCCTGG - Intronic
1136704296 16:32173279-32173301 GGACGGACAGATAGACAGATGGG + Intergenic
1136763614 16:32756127-32756149 GGACGGACAGATAGACAGATGGG - Intergenic
1136804485 16:33114259-33114281 GGACGGACAGATAGACAGATGGG + Intergenic
1137915099 16:52421368-52421390 GGTAGGAAAAATAGGCAGGTGGG + Intergenic
1139287424 16:65827953-65827975 GGAAGGACAAGAAGTCAAATGGG - Intergenic
1140486954 16:75300915-75300937 GGAAGGAAAAAAAGCCAGCCAGG + Intronic
1140492209 16:75347181-75347203 AAAAGTACAAAAAGTCAGCTGGG + Intronic
1203065763 16_KI270728v1_random:1016448-1016470 GGACGGACAGATAGACAGATGGG - Intergenic
1147846549 17:43408064-43408086 GTAAGGAAAAGAAGTCAGCTTGG + Intergenic
1148155369 17:45421842-45421864 TAAAAGACAAAGAGTCAGCTTGG + Intronic
1148388323 17:47252730-47252752 GGAAGGAAAATCAGTCAGATAGG + Intergenic
1150823253 17:68452810-68452832 GAAGGGAAAAATAGGCAGCTTGG + Intronic
1153357949 18:4158763-4158785 TCAAGGTCAAATACTCAGCTGGG + Intronic
1155437881 18:25832152-25832174 GTAAGGAAAAATAGTGGGCTCGG + Intergenic
1157332219 18:46712322-46712344 GGAAGGAGAAGGAGGCAGCTAGG - Intronic
1159162658 18:64663101-64663123 AGAAGGTCAATTAGTCAGCTTGG + Intergenic
1161130202 19:2584139-2584161 AGAAGGACACAGAGCCAGCTTGG + Intronic
1162662608 19:12182065-12182087 GGAAGGACAAATAGTCAGCTGGG - Intronic
1164123411 19:22288137-22288159 TAAAGGACAAATAGTAGGCTGGG - Intronic
1166147283 19:40846300-40846322 TGAAGGACAGATGGTCAGCAAGG - Intronic
1167123050 19:47530483-47530505 GGAAAGTCAAATTGTTAGCTAGG - Intronic
1168547452 19:57265261-57265283 GAAAGGACAAATAATCAAGTTGG - Intergenic
925243855 2:2361437-2361459 GGAAAGACGAAAAGTGAGCTGGG - Intergenic
925264394 2:2555836-2555858 GGAATGACAATTAGAAAGCTAGG - Intergenic
927338923 2:21958131-21958153 GGAAAGAGAAGTAGTCAGATGGG - Intergenic
927354116 2:22153329-22153351 GGCAAGACACATAGACAGCTTGG + Intergenic
928923305 2:36549027-36549049 GGAAGAAAAATTGGTCAGCTTGG + Exonic
932772166 2:74506601-74506623 GGAAGGACAAAAAGTGAGGAAGG - Intronic
933633422 2:84681717-84681739 TGAAAGACAAGTAATCAGCTGGG - Intronic
935589592 2:104834447-104834469 AGGAGGACATATAATCAGCTAGG - Intergenic
935677355 2:105607539-105607561 GAAAGGAGAAAAAGTCAGGTTGG - Intergenic
937384640 2:121417380-121417402 AGAAGGTCAAATAGTGAGCAAGG + Intronic
938947716 2:136228140-136228162 GGATGGACAAATGGACAGATTGG - Intergenic
940076218 2:149744949-149744971 GAAGGGAAAAATAATCAGCTTGG + Intergenic
940169910 2:150817073-150817095 GGAAGGATAACTAATCAGATAGG - Intergenic
941633754 2:167913231-167913253 GGAAGGACTCATGGTCAGTTTGG + Intergenic
941781427 2:169449825-169449847 GAAAATACAAATATTCAGCTGGG + Intergenic
943709534 2:191075549-191075571 GGAATGACAGAAATTCAGCTTGG + Intronic
945048568 2:205802446-205802468 GGCATTAAAAATAGTCAGCTGGG - Intergenic
948165030 2:235854456-235854478 TGAAGGGCAAATAGCCAGCAGGG - Intronic
1169024519 20:2357683-2357705 GGGAAGACAAAAAGACAGCTTGG + Intergenic
1169404534 20:5312401-5312423 GGAAAGACACAAAGTCAGCCCGG - Intronic
1173619979 20:44429498-44429520 GGAAGGACAAACAGACAGACAGG - Intronic
1174241518 20:49139427-49139449 AGAAATACAAATAGTCGGCTGGG + Intronic
1175966125 20:62661039-62661061 GGAAGGGCACAGAGTGAGCTGGG - Intronic
1177499014 21:21926115-21926137 GCAAGAAAATATAGTCAGCTTGG - Intergenic
1177926181 21:27218449-27218471 GGAATGACAAGTAGCCATCTAGG - Intergenic
1180676075 22:17587372-17587394 GGAAGGACACAGAGGCAGATAGG - Intronic
1183422312 22:37719005-37719027 AGAAATACAAAAAGTCAGCTGGG - Intronic
1184880741 22:47302879-47302901 GGAAGGAAAAATAGATAGATGGG - Intergenic
950491079 3:13305454-13305476 GGATGGAGAGATGGTCAGCTAGG + Intergenic
950735646 3:15005832-15005854 GAAAAGACAGATTGTCAGCTGGG - Intronic
952786402 3:37159858-37159880 GGGAGGAAAAAAAGGCAGCTGGG + Intronic
953236026 3:41107988-41108010 AGAAGGCCAAATAGGGAGCTGGG - Intergenic
954189134 3:48943836-48943858 GGAATGCCAAATAACCAGCTAGG - Intronic
957445328 3:80308504-80308526 GGAAGAAAATATAGTCAGTTGGG + Intergenic
962731358 3:138286443-138286465 GGAGGAGGAAATAGTCAGCTGGG - Intronic
963810381 3:149771030-149771052 GGCAGGACAAACAGTCTTCTGGG + Intronic
964017407 3:151964395-151964417 GGAAGAACAAATAATCACCTGGG - Intergenic
964223114 3:154368629-154368651 GGAAGAAAATATAGTCAGTTGGG + Intronic
964917164 3:161852479-161852501 GGAAGAAAATATAGTCAGTTGGG - Intergenic
965064604 3:163829983-163830005 AGAAGGAAAAGTGGTCAGCTTGG - Intergenic
965428400 3:168556084-168556106 GGAAGCAGACATAGTGAGCTAGG + Intergenic
968317150 3:197734786-197734808 GGAAGAATAAATAGTCAAATAGG + Intronic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
968545237 4:1194777-1194799 GGAAGGAAAAACACTCAGCGGGG + Intronic
974644543 4:64674256-64674278 GGAAGGAGAAATGGCCAGATGGG - Intergenic
974828196 4:67155854-67155876 GGTAGGAGAAATTGACAGCTGGG + Intergenic
974968833 4:68801448-68801470 GGAAGAAAATATAGTCAGTTGGG + Intergenic
975001060 4:69223807-69223829 GGAAGAAAATATAGTCAGTTGGG - Intergenic
975004382 4:69268462-69268484 GGAAGAAAATATAGTCAGTTGGG + Intergenic
976102417 4:81580227-81580249 GGAAGGACAAATAGGCAATGAGG + Intronic
977086472 4:92605010-92605032 GGAAGGAGAAATACTAAGCAAGG - Intronic
978240881 4:106514913-106514935 GGAAGGACAGATGGGCAGATGGG + Intergenic
978405778 4:108377338-108377360 GGATGGACAAACAAGCAGCTGGG - Intergenic
980386037 4:132088996-132089018 GGAGGGAAAAATAGTTTGCTGGG + Intergenic
982342917 4:154323067-154323089 GCAAGGACAAATAGAGAGATGGG - Intronic
983900379 4:173127260-173127282 GGAAGGAAAAAAAATTAGCTGGG - Intergenic
984947600 4:184982298-184982320 GGAAGGACCAATAAGTAGCTTGG + Intergenic
986208147 5:5645589-5645611 GGCAGGGCAGAGAGTCAGCTCGG - Intergenic
990242216 5:53826860-53826882 GGAAGGACCCAAAGTTAGCTAGG + Intergenic
991270708 5:64776172-64776194 GGAAGGAAATAGAGTCAGGTAGG + Intronic
991507885 5:67343669-67343691 GGAGGGACAGATACTCTGCTGGG - Intergenic
992922047 5:81535543-81535565 GGAAGGAAAAATAGACAAATAGG + Intronic
994356836 5:98802229-98802251 GGCAGGAGAAAGAGTCAGCAGGG - Intergenic
997129453 5:131262921-131262943 GAAAGGAAAAATAGTAAGGTAGG + Intronic
997916885 5:137935651-137935673 GGCAGGGCAAAAAGTCAGCAGGG + Intronic
999563145 5:152827057-152827079 GGAAGGAGAAATCCTCAGCGGGG - Intergenic
1002355295 5:178623668-178623690 GCCAGGACAAATTCTCAGCTTGG + Intronic
1004217820 6:13718713-13718735 GCAAGGACAAAAAGTCTGTTCGG + Intergenic
1007426400 6:41748859-41748881 GGGAGGACTAGAAGTCAGCTGGG + Intronic
1014827350 6:126061625-126061647 TGAAGGAGAAATAGGCACCTGGG - Intergenic
1015083953 6:129264726-129264748 GGGAGGAAAAGGAGTCAGCTAGG + Intronic
1015531600 6:134226531-134226553 AAAAGTACAAATAGTTAGCTAGG + Intronic
1017095259 6:150799279-150799301 GGAAGGAAAATTTGTCAGATGGG - Intronic
1020603136 7:10302105-10302127 GTAAGGACAAAATGTCAGTTTGG - Intergenic
1026518125 7:71090565-71090587 TGGAGGAGAAATAGACAGCTAGG - Intergenic
1028372156 7:90104915-90104937 AGAAGCATAAATAGTCATCTAGG + Intergenic
1029474533 7:100775303-100775325 GGGAGGACAGAGAGACAGCTGGG - Intronic
1030309398 7:108054290-108054312 GGGAGGACAAATGGCCAGCCAGG - Intronic
1032910295 7:136420704-136420726 GGAAGGAGAAACAGGGAGCTGGG - Intergenic
1033212795 7:139472695-139472717 GAAAGGACAGATAGACAGCTGGG + Intronic
1034461067 7:151198344-151198366 GGAAGGATAGATAGACAGTTGGG + Intronic
1035441641 7:158906801-158906823 GGAAGGCCATATACTGAGCTAGG - Intronic
1036467058 8:9009060-9009082 GGAAGGACAAAAATTTTGCTCGG - Intronic
1039058420 8:33554793-33554815 GGAAGTACAAATAGGCAGGAAGG - Intronic
1040956456 8:52984525-52984547 GGAAGGGAAAATAATCATCTAGG - Intergenic
1042136630 8:65638860-65638882 TGTAGGATATATAGTCAGCTTGG - Intergenic
1045929511 8:107605569-107605591 GGAAGAAAATATAGTCAGTTGGG - Intergenic
1046299437 8:112267646-112267668 GCAAGGAGAAATAGCCAGCCTGG + Intronic
1046892858 8:119441999-119442021 GGTAGGAAAAATAGTCATTTAGG - Intergenic
1048486548 8:134853078-134853100 GGAAGGACAAAAAGTTAGTGTGG - Intergenic
1048780079 8:137990581-137990603 GGAAGAAAATATAGTCAGTTGGG + Intergenic
1048910008 8:139126188-139126210 GGAAGGAGAAATGGACAGATGGG - Intergenic
1054742053 9:68816487-68816509 TGAAGGAAAAACAGTCAGCATGG + Intronic
1057260829 9:93582357-93582379 GGAAGGCCACATACTGAGCTAGG + Intronic
1058867473 9:109174831-109174853 TGAATGACATATAGTCAGCCAGG - Intronic
1059615520 9:115946728-115946750 GGGAGGGCAAAGAGTGAGCTAGG + Intergenic
1060498621 9:124136081-124136103 GGATGGACAGATAGCCAGGTAGG - Intergenic
1060887498 9:127165637-127165659 AGATAGACAAATAGACAGCTGGG + Intronic
1185582686 X:1223147-1223169 GCATGGACAATGAGTCAGCTGGG + Intergenic
1186611631 X:11143680-11143702 GGAGGGAAAAAGAATCAGCTGGG + Intronic
1190036370 X:47028672-47028694 AGAATGACAAATAACCAGCTTGG - Intronic
1190256421 X:48766106-48766128 GGAAGTCCAAATATTCAGTTTGG - Intronic
1193106444 X:77679397-77679419 TGAAGGACAAATAGGCTGATGGG - Intronic
1193840730 X:86405083-86405105 GGAGGGAAAAATGGTCACCTGGG - Intronic
1194589356 X:95779002-95779024 CAAAGGACAAATAGTCAAATTGG - Intergenic
1196739702 X:119013987-119014009 GGAAGGAGAAAGGTTCAGCTGGG - Intronic
1197185662 X:123584233-123584255 GGCAGGACAAATAGTAAACTAGG - Intergenic
1197354372 X:125418672-125418694 AGAAGGTCAAATAGCAAGCTAGG + Intergenic
1197733985 X:129836442-129836464 AAAAGTACAAAAAGTCAGCTGGG - Intronic
1201325768 Y:12756129-12756151 AGAAGGCCAAGTAGTGAGCTGGG - Intronic
1201325774 Y:12756169-12756191 AGAAGGCCAACTAGTGAGCTGGG - Intronic
1201981960 Y:19917994-19918016 GGAAGAAAATATAGTCAGTTGGG - Intergenic