ID: 1162665509

View in Genome Browser
Species Human (GRCh38)
Location 19:12207437-12207459
Sequence TATAGGAACCTGGCTTCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162665504_1162665509 19 Left 1162665504 19:12207395-12207417 CCTTGGCAGAAAAAACTCTACAG 0: 1
1: 0
2: 1
3: 21
4: 224
Right 1162665509 19:12207437-12207459 TATAGGAACCTGGCTTCAGTAGG 0: 1
1: 0
2: 2
3: 19
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162665509 Original CRISPR TATAGGAACCTGGCTTCAGT AGG Intergenic
900299087 1:1967828-1967850 TGCAGGCAACTGGCTTCAGTTGG - Intronic
905750335 1:40457050-40457072 TATGGGAACCTGGTCTCAGTGGG + Exonic
909846807 1:80404326-80404348 TATATGAACCTGACTGCAGAGGG - Intergenic
910519581 1:88104662-88104684 TACAGCAACCTGGATTCACTTGG - Intergenic
911710779 1:101070088-101070110 TTTTGGAATCTGGCTTCAATAGG - Intergenic
912952033 1:114126869-114126891 TACAGGAAGCTGGCCTGAGTGGG + Intronic
914920060 1:151840265-151840287 GCTAGAAACCTGGCTTCAGCTGG - Exonic
920026636 1:203003271-203003293 TATACTAAACTGCCTTCAGTAGG + Intergenic
921491965 1:215788275-215788297 TGTTGAAACCTGGCTGCAGTAGG + Intronic
924766741 1:247039410-247039432 TTCAGGAACCTGGCTTCTGTAGG - Exonic
924773915 1:247101986-247102008 TGCAGGAACCTGGCTTCTGTAGG - Exonic
1063460846 10:6214150-6214172 GTTAGGAACCTGGCTGCAGGAGG + Intronic
1063753188 10:8975792-8975814 TATGGGAAACTGGCTGCAGGGGG - Intergenic
1070699734 10:78592786-78592808 TATAGGAAACTGTCTCCTGTTGG - Intergenic
1073101394 10:101008546-101008568 TGGAGGAGCCTGGCATCAGTGGG + Intronic
1073268944 10:102245406-102245428 TAAAGGAAATTGGCTTCAGGAGG - Intergenic
1076923440 10:133467438-133467460 CACAGGAGCCTGGCTTCAGAAGG + Intergenic
1078447020 11:11412108-11412130 TATAGTAACGTGGCTCCAGCTGG + Intronic
1082203497 11:49403324-49403346 TCTAGGAGCCTGGATTGAGTAGG + Intergenic
1084253111 11:67917888-67917910 CATAGGAACCTGGATGGAGTTGG - Intergenic
1084970150 11:72766985-72767007 TGGGGAAACCTGGCTTCAGTTGG + Intronic
1086651534 11:89296788-89296810 TCTAGGAGCCTGGATTGAGTAGG - Intergenic
1089807648 11:121105739-121105761 TGAAAGAAGCTGGCTTCAGTAGG + Intronic
1091797689 12:3306541-3306563 GAGAGGAACCAGGCTTCAGCAGG + Intergenic
1098533225 12:71565556-71565578 TAAAGGAGCCTGGATTCAGTTGG - Intronic
1098795601 12:74884848-74884870 TATTGGAAAAGGGCTTCAGTGGG + Intergenic
1099478268 12:83135160-83135182 TATAAGTTTCTGGCTTCAGTAGG + Intergenic
1100716499 12:97311824-97311846 TATTTGAACCTGGCTTGAATAGG + Intergenic
1101571320 12:105956551-105956573 CATGGAAACCTGGCTCCAGTCGG - Intergenic
1102567714 12:113807843-113807865 CATAGGAACCTGGCTATGGTTGG - Intergenic
1105061018 12:133151133-133151155 TATAAGAACCTGGTTTCCTTGGG + Exonic
1108874387 13:55026362-55026384 TGTAGGAGCCTAACTTCAGTAGG + Intergenic
1109422996 13:62137882-62137904 TCTAGGTACCTGTTTTCAGTGGG - Intergenic
1109969117 13:69741869-69741891 TATAGGAGCCTAATTTCAGTTGG + Intronic
1114583278 14:23784988-23785010 TATAGGATCCTGGGTGCAGGAGG + Intergenic
1117684406 14:58238665-58238687 TATAGGATCTTGGCTTTTGTTGG - Intronic
1119679535 14:76581834-76581856 TACAGGCACCTGGCTTCAAAAGG + Intergenic
1124840038 15:33233097-33233119 AATAGGAAGCTGGCTTCAGAAGG - Intergenic
1124953678 15:34345928-34345950 CAGAGTAACCTGGCTCCAGTAGG - Exonic
1127388774 15:58488565-58488587 TATATGAACCTGGAATCACTGGG + Intronic
1127556423 15:60091864-60091886 TATAGGTACCTGGCTCCGGACGG - Intergenic
1128297213 15:66533243-66533265 GATAGTACACTGGCTTCAGTAGG - Intronic
1128806615 15:70535914-70535936 AACAGGAAACTGGCTTCAGATGG - Intergenic
1135230720 16:20704802-20704824 TATGGTAACTTGGCTTTAGTTGG - Intronic
1142296067 16:89223262-89223284 TACGAGAACCTGGCCTCAGTAGG + Exonic
1142635227 17:1253029-1253051 TTTAGGATGCTGGATTCAGTGGG - Intergenic
1143530368 17:7499504-7499526 AATGGAAACCTGGCTTAAGTGGG + Intronic
1144487303 17:15677574-15677596 TATAGGAACCTGGTCTCCTTGGG - Intronic
1144913730 17:18704744-18704766 TATAGGAACCTGGTCTCCTTGGG + Intronic
1150011742 17:61511115-61511137 TCTAGGAAGCTGCCTCCAGTTGG + Intergenic
1152198902 17:78933920-78933942 TATAGGAACCAGTCTACAGGAGG - Intergenic
1158322717 18:56280994-56281016 TAAAGGAGTCAGGCTTCAGTAGG - Intergenic
1159762443 18:72444982-72445004 CATAGGAACCTAACTTCAGTGGG + Intergenic
1161177113 19:2850692-2850714 TTTCAGAACCTGGCCTCAGTAGG + Exonic
1161185431 19:2915627-2915649 TTCCGGAACCTGGCCTCAGTAGG + Exonic
1161200715 19:3013222-3013244 TATAGGAACAAGTTTTCAGTTGG - Intronic
1161895517 19:7076486-7076508 TGCAGGAACCTGGCCTCACTGGG + Exonic
1162174455 19:8821179-8821201 TGCAGGAACCTGGCCTCACTAGG - Exonic
1162197803 19:8999082-8999104 TTGAGAAACCTCGCTTCAGTGGG + Intergenic
1162243537 19:9379067-9379089 TTTAGGAACCTGGCCTCAGTAGG + Exonic
1162253757 19:9470391-9470413 TACAAGAACCTGTCCTCAGTAGG - Exonic
1162260970 19:9533839-9533861 TACAAGAACCTGGCCACAGTAGG - Exonic
1162271206 19:9617044-9617066 TACATGAACCTGGCCTCTGTGGG - Exonic
1162276305 19:9658008-9658030 TACATGAACCTGGCCTCTGTGGG - Exonic
1162280555 19:9693693-9693715 TATGTGAACCTGGCCTCTGTGGG - Exonic
1162594230 19:11614632-11614654 TTCAGGAACCTGGCTTCTGTAGG + Exonic
1162658121 19:12147675-12147697 TTCAGGAACCTGGCTTCTGTAGG - Exonic
1162665509 19:12207437-12207459 TATAGGAACCTGGCTTCAGTAGG + Intergenic
1163055738 19:14716217-14716239 TACAGGAACCTGGCCTCTGTGGG + Exonic
1163853139 19:19677969-19677991 TTCAGGAACCTGGCCTCGGTCGG + Exonic
1165538809 19:36473331-36473353 TACAGCAACCTGGTTTCAATGGG - Exonic
1165585115 19:36908332-36908354 TTCAGCAACCTGGTTTCAGTGGG - Exonic
1165655966 19:37532461-37532483 TATAGCAACCTCGTCTCAGTGGG + Exonic
1165680619 19:37771563-37771585 TATAGAAACCTGGTATCACTGGG - Exonic
1166104237 19:40589603-40589625 TGTAGGAGCCTTGCTTCAGCTGG + Intronic
1166609017 19:44172193-44172215 TTTAGGAACCTGCTGTCAGTGGG + Exonic
1166620941 19:44299605-44299627 TTTAGGAACCTGGTTTCAGTGGG - Exonic
1167819848 19:51917576-51917598 TATAGCAACCTGGTATCACTGGG - Intronic
1167822368 19:51940314-51940336 TATAGCAACCTCGTGTCAGTGGG + Exonic
1167875145 19:52406012-52406034 TATAGGAACCTGGTCTCCCTGGG + Exonic
1167895305 19:52576000-52576022 TATAGGAACCTGGTCTCCCTGGG + Exonic
1167900598 19:52618935-52618957 TATAGGAACCTGGTCTCCCTGGG - Intronic
1167905294 19:52655560-52655582 TACAGGAACCTGGAGTCTGTGGG - Intronic
1167923918 19:52808006-52808028 TATAGGAACCTGGTCTCCCTGGG - Exonic
1167930935 19:52864032-52864054 TACAGGAACCTGGAGTCTGTGGG - Intronic
1167931089 19:52865360-52865382 TACAGGAACCTGGAGTCTGTGGG - Intronic
1167933547 19:52888126-52888148 TATAGGAACCTGGTCTCCCTGGG - Exonic
1167936768 19:52915195-52915217 TATAGGAACCTGGTCTCCCTGGG - Intergenic
1167966182 19:53149240-53149262 TATAGGAACCTGGCCTCCCTGGG - Exonic
1167969118 19:53175444-53175466 TATAGGAACCTGGTCTCCCTGGG - Exonic
1167989440 19:53345611-53345633 TATAGGAACCTGGTCTCCCTGGG + Exonic
1167992915 19:53375875-53375897 TATAGGAACCTGGTCTCCCTGGG + Exonic
1167995916 19:53402170-53402192 TATAGGAACCTGGTCTCCCTGGG + Exonic
1168001456 19:53449617-53449639 TATAGGAACCTGGTCTCCCTGGG + Exonic
1168005882 19:53486737-53486759 TATAGGAACCTGGTCTCCCTGGG + Exonic
1168460110 19:56547613-56547635 TACAGGAACCTGGCATCGCTGGG + Exonic
1168462824 19:56574499-56574521 TACAGGAACCTAGTTTCAGTGGG + Exonic
1168467362 19:56613917-56613939 TACAGGAACCTGGTCTCACTGGG + Intronic
1168663625 19:58185817-58185839 TACAGGAACCTGGTCTCAGTGGG + Intronic
925409097 2:3628524-3628546 CATGGGGACCTGGCTGCAGTGGG + Intronic
927442102 2:23126299-23126321 TAGAGACACCTGGCTGCAGTGGG - Intergenic
930046654 2:47178270-47178292 TCTAGGGAGCTGTCTTCAGTAGG - Intergenic
940341522 2:152586867-152586889 TTTAGGCTCCTGGCTTCTGTGGG + Intronic
942596918 2:177600286-177600308 GACAGGAACCTAACTTCAGTGGG - Intergenic
942683089 2:178499415-178499437 TATAAGGGCCTGGCCTCAGTAGG + Intronic
944878356 2:203985852-203985874 TATACAAACTTGGCCTCAGTTGG + Intergenic
948305525 2:236944402-236944424 TACAGGGCCCTGGCTCCAGTGGG + Intergenic
948562943 2:238866103-238866125 TAAAGGAACCTACATTCAGTGGG - Intronic
1172965481 20:38831329-38831351 CATTGGAACCTGGCTGCCGTGGG + Intronic
1177643127 21:23869649-23869671 TAGAGGAGCCTGGCTACAGCTGG - Intergenic
1177643266 21:23871241-23871263 TAGAGGAGCCTGGCTACAGCTGG - Intergenic
1180597637 22:16989112-16989134 TCTATGTACCTGGCTTCTGTTGG - Intronic
1180979647 22:19872563-19872585 GGTTGGCACCTGGCTTCAGTGGG - Intergenic
1185134228 22:49059939-49059961 TAAAGGATCCTGGCTTCATGGGG + Intergenic
1185183262 22:49376330-49376352 TGGAGGAACATGGGTTCAGTTGG - Intergenic
949100941 3:144681-144703 TCTAGGAACATGCTTTCAGTAGG - Intergenic
953611400 3:44450446-44450468 TATAGGAACATGGCTTCCCTGGG - Exonic
956917412 3:73886964-73886986 TATAGCAAACTGGCTTCAACTGG + Intergenic
962482329 3:135808455-135808477 TGTAGGAACCTGGCCTCACAAGG + Intergenic
962801883 3:138897630-138897652 TATAGGACCCTGGGTTGAATTGG - Intergenic
963509676 3:146231163-146231185 TATAGCAACATGGATGCAGTTGG - Intronic
967526591 3:190502389-190502411 TAAAGGGTCCTGGCTTCAGTTGG + Intergenic
969413994 4:7047012-7047034 TAAAGGACCTTGGCTACAGTGGG + Intronic
972384812 4:38554638-38554660 TATAGGAACCTGAATGGAGTTGG - Intergenic
972749353 4:41973152-41973174 TCTTGGACCTTGGCTTCAGTTGG + Intergenic
979488615 4:121298063-121298085 TAAGAGAACCTGGCTGCAGTGGG - Intergenic
988251433 5:28763211-28763233 TGTAGGAGCCTAACTTCAGTGGG - Intergenic
988724640 5:33914129-33914151 TGTAGCAACCTGGATTAAGTTGG - Intergenic
990834181 5:59996951-59996973 TATAGGAAATTGGCTTTAGAAGG - Intronic
991066870 5:62433392-62433414 TATACGAACGTGCCTACAGTTGG - Intronic
994625791 5:102216819-102216841 AATAGGAGCCTAACTTCAGTGGG + Intergenic
996020468 5:118585909-118585931 TGTAGAACCCTGGCTTCAGGAGG + Intergenic
996595375 5:125195801-125195823 TAAAGGCACCTAGATTCAGTGGG - Intergenic
997152996 5:131519371-131519393 TATAAGAACCTGGTATCACTGGG - Intronic
999185885 5:149708399-149708421 TATAGAAGACTGGCTTCAATTGG + Intergenic
999694320 5:154175309-154175331 TATATGAACATGCATTCAGTAGG + Intronic
1001332742 5:170773591-170773613 TAGAGACACCTGGCTTCAGGTGG - Intronic
1001675266 5:173507187-173507209 TATAGGATCCTGGCCTCAGCTGG + Intergenic
1002367820 5:178726998-178727020 TATAGGAACCTGGTCTCACTGGG - Exonic
1002385826 5:178866349-178866371 TATAGGAACCTGGTCTCACTGGG + Exonic
1003043247 6:2708888-2708910 TATAGGTACATGGCTTGAGAAGG - Intronic
1005132199 6:22522223-22522245 TATGGGAATCTGGCTTGAGCAGG + Intergenic
1008797911 6:55327410-55327432 TATAGGAAGCTGACTTGAATTGG + Intergenic
1011825253 6:91298638-91298660 ATTAGGAACCTAACTTCAGTGGG - Intergenic
1014306131 6:119744681-119744703 TATATGAAACTTCCTTCAGTGGG + Intergenic
1021990076 7:26132624-26132646 TATAGGAACCCTACTGCAGTAGG + Intergenic
1022972443 7:35530294-35530316 TACAGGACCCTCGCATCAGTGGG - Intergenic
1023689600 7:42772481-42772503 TAGAGTAACATGGGTTCAGTTGG - Intergenic
1027451466 7:78336246-78336268 TCTAGAAACCTGGAATCAGTAGG + Intronic
1029299426 7:99567763-99567785 TATAAGTACCTGGCTTGTGTCGG + Intronic
1030038029 7:105424674-105424696 TATAGGTACAAGACTTCAGTGGG - Intergenic
1030158996 7:106488395-106488417 TCTAGAAACCTAGCTTCACTGGG + Intergenic
1032466292 7:132147728-132147750 AAGAGGACCCTGGTTTCAGTCGG - Intronic
1035177929 7:157065710-157065732 TATAAGAAGCTGGCTTCAACTGG + Intergenic
1037119146 8:15262301-15262323 TAAAAGACCCTGGCTTCAGCAGG + Intergenic
1044844320 8:96365448-96365470 AATAGCAACATGGCTTCAGTTGG - Intergenic
1047327985 8:123858137-123858159 TAAAGGAACCTGGTTAAAGTAGG - Intronic
1048080268 8:131119178-131119200 CACAAGAAGCTGGCTTCAGTTGG + Intergenic
1048328980 8:133459541-133459563 TCTTGGAACCTGTCTTGAGTGGG - Exonic
1049846352 8:144803746-144803768 TATGGGAACCTGGCCTCACTAGG + Exonic
1055364914 9:75533082-75533104 TATAGCACCATGGCTTCACTGGG + Intergenic
1055826050 9:80326035-80326057 TATATGAACCTGAGTTCTGTAGG - Intergenic
1058097084 9:100874762-100874784 TATAGGCATCTGTTTTCAGTTGG - Intergenic
1186363504 X:8867863-8867885 TATAGGGGCCAGGCTTCACTTGG - Intergenic
1190087740 X:47410381-47410403 TACAGCAACCTGGCATCTGTGGG + Exonic
1196378587 X:115064461-115064483 TCCAGGAACTTGGCTTCTGTAGG - Intergenic
1198704413 X:139432946-139432968 TATAGGAGCCTAGCTTAAGGAGG - Intergenic