ID: 1162665728

View in Genome Browser
Species Human (GRCh38)
Location 19:12210208-12210230
Sequence CGCTTGAACCTGGGAGGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 421309
Summary {0: 7068, 1: 42616, 2: 101715, 3: 137443, 4: 132467}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162665728_1162665734 7 Left 1162665728 19:12210208-12210230 CCTCCGCCTCCCAGGTTCAAGCG 0: 7068
1: 42616
2: 101715
3: 137443
4: 132467
Right 1162665734 19:12210238-12210260 TTGCCTCAGCCTGAGATTACAGG No data
1162665728_1162665737 26 Left 1162665728 19:12210208-12210230 CCTCCGCCTCCCAGGTTCAAGCG 0: 7068
1: 42616
2: 101715
3: 137443
4: 132467
Right 1162665737 19:12210257-12210279 CAGGTGCCCGCCACCACGCCCGG 0: 3715
1: 23283
2: 55735
3: 78440
4: 119144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162665728 Original CRISPR CGCTTGAACCTGGGAGGCGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr