ID: 1162665729

View in Genome Browser
Species Human (GRCh38)
Location 19:12210211-12210233
Sequence AATCGCTTGAACCTGGGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 376878
Summary {0: 15142, 1: 57124, 2: 96047, 3: 123550, 4: 85015}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162665729_1162665737 23 Left 1162665729 19:12210211-12210233 CCGCCTCCCAGGTTCAAGCGATT 0: 15142
1: 57124
2: 96047
3: 123550
4: 85015
Right 1162665737 19:12210257-12210279 CAGGTGCCCGCCACCACGCCCGG 0: 3715
1: 23283
2: 55735
3: 78440
4: 119144
1162665729_1162665734 4 Left 1162665729 19:12210211-12210233 CCGCCTCCCAGGTTCAAGCGATT 0: 15142
1: 57124
2: 96047
3: 123550
4: 85015
Right 1162665734 19:12210238-12210260 TTGCCTCAGCCTGAGATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162665729 Original CRISPR AATCGCTTGAACCTGGGAGG CGG (reversed) Intergenic
Too many off-targets to display for this crispr