ID: 1162665730

View in Genome Browser
Species Human (GRCh38)
Location 19:12210214-12210236
Sequence GAGAATCGCTTGAACCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 584640
Summary {0: 23056, 1: 86015, 2: 148378, 3: 189355, 4: 137836}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162665730_1162665737 20 Left 1162665730 19:12210214-12210236 CCTCCCAGGTTCAAGCGATTCTC 0: 23056
1: 86015
2: 148378
3: 189355
4: 137836
Right 1162665737 19:12210257-12210279 CAGGTGCCCGCCACCACGCCCGG 0: 3715
1: 23283
2: 55735
3: 78440
4: 119144
1162665730_1162665734 1 Left 1162665730 19:12210214-12210236 CCTCCCAGGTTCAAGCGATTCTC 0: 23056
1: 86015
2: 148378
3: 189355
4: 137836
Right 1162665734 19:12210238-12210260 TTGCCTCAGCCTGAGATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162665730 Original CRISPR GAGAATCGCTTGAACCTGGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr