ID: 1162665731

View in Genome Browser
Species Human (GRCh38)
Location 19:12210217-12210239
Sequence AAGGAGAATCGCTTGAACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 533144
Summary {0: 342, 1: 25313, 2: 113246, 3: 192084, 4: 202159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162665731_1162665737 17 Left 1162665731 19:12210217-12210239 CCCAGGTTCAAGCGATTCTCCTT 0: 342
1: 25313
2: 113246
3: 192084
4: 202159
Right 1162665737 19:12210257-12210279 CAGGTGCCCGCCACCACGCCCGG 0: 3715
1: 23283
2: 55735
3: 78440
4: 119144
1162665731_1162665734 -2 Left 1162665731 19:12210217-12210239 CCCAGGTTCAAGCGATTCTCCTT 0: 342
1: 25313
2: 113246
3: 192084
4: 202159
Right 1162665734 19:12210238-12210260 TTGCCTCAGCCTGAGATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162665731 Original CRISPR AAGGAGAATCGCTTGAACCT GGG (reversed) Intergenic
Too many off-targets to display for this crispr