ID: 1162665732

View in Genome Browser
Species Human (GRCh38)
Location 19:12210218-12210240
Sequence CAAGGAGAATCGCTTGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 327618
Summary {0: 79, 1: 1105, 2: 49270, 3: 125166, 4: 151998}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162665732_1162665737 16 Left 1162665732 19:12210218-12210240 CCAGGTTCAAGCGATTCTCCTTG 0: 79
1: 1105
2: 49270
3: 125166
4: 151998
Right 1162665737 19:12210257-12210279 CAGGTGCCCGCCACCACGCCCGG 0: 3715
1: 23283
2: 55735
3: 78440
4: 119144
1162665732_1162665734 -3 Left 1162665732 19:12210218-12210240 CCAGGTTCAAGCGATTCTCCTTG 0: 79
1: 1105
2: 49270
3: 125166
4: 151998
Right 1162665734 19:12210238-12210260 TTGCCTCAGCCTGAGATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162665732 Original CRISPR CAAGGAGAATCGCTTGAACC TGG (reversed) Intergenic
Too many off-targets to display for this crispr