ID: 1162665734

View in Genome Browser
Species Human (GRCh38)
Location 19:12210238-12210260
Sequence TTGCCTCAGCCTGAGATTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162665732_1162665734 -3 Left 1162665732 19:12210218-12210240 CCAGGTTCAAGCGATTCTCCTTG 0: 79
1: 1105
2: 49270
3: 125166
4: 151998
Right 1162665734 19:12210238-12210260 TTGCCTCAGCCTGAGATTACAGG No data
1162665729_1162665734 4 Left 1162665729 19:12210211-12210233 CCGCCTCCCAGGTTCAAGCGATT 0: 15142
1: 57124
2: 96047
3: 123550
4: 85015
Right 1162665734 19:12210238-12210260 TTGCCTCAGCCTGAGATTACAGG No data
1162665730_1162665734 1 Left 1162665730 19:12210214-12210236 CCTCCCAGGTTCAAGCGATTCTC 0: 23056
1: 86015
2: 148378
3: 189355
4: 137836
Right 1162665734 19:12210238-12210260 TTGCCTCAGCCTGAGATTACAGG No data
1162665728_1162665734 7 Left 1162665728 19:12210208-12210230 CCTCCGCCTCCCAGGTTCAAGCG 0: 7068
1: 42616
2: 101715
3: 137443
4: 132467
Right 1162665734 19:12210238-12210260 TTGCCTCAGCCTGAGATTACAGG No data
1162665731_1162665734 -2 Left 1162665731 19:12210217-12210239 CCCAGGTTCAAGCGATTCTCCTT 0: 342
1: 25313
2: 113246
3: 192084
4: 202159
Right 1162665734 19:12210238-12210260 TTGCCTCAGCCTGAGATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162665734 Original CRISPR TTGCCTCAGCCTGAGATTAC AGG Intergenic
No off target data available for this crispr