ID: 1162665893

View in Genome Browser
Species Human (GRCh38)
Location 19:12211381-12211403
Sequence TGAGATTCCCTGTGAATTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162665886_1162665893 25 Left 1162665886 19:12211333-12211355 CCAGCCTGTTGTTCTTTTTCAAG No data
Right 1162665893 19:12211381-12211403 TGAGATTCCCTGTGAATTTTAGG No data
1162665887_1162665893 21 Left 1162665887 19:12211337-12211359 CCTGTTGTTCTTTTTCAAGATTG No data
Right 1162665893 19:12211381-12211403 TGAGATTCCCTGTGAATTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162665893 Original CRISPR TGAGATTCCCTGTGAATTTT AGG Intergenic
No off target data available for this crispr