ID: 1162666270

View in Genome Browser
Species Human (GRCh38)
Location 19:12215418-12215440
Sequence CAACCTACTGAGATTGAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162666270_1162666272 27 Left 1162666270 19:12215418-12215440 CCTGATTCAATCTCAGTAGGTTG No data
Right 1162666272 19:12215468-12215490 TTCTATTTTTTCCAATTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162666270 Original CRISPR CAACCTACTGAGATTGAATC AGG (reversed) Intergenic
No off target data available for this crispr