ID: 1162666802

View in Genome Browser
Species Human (GRCh38)
Location 19:12220420-12220442
Sequence AGGGAACCTACCGCCTTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162666802_1162666814 29 Left 1162666802 19:12220420-12220442 CCCTTCAAGGCGGTAGGTTCCCT No data
Right 1162666814 19:12220472-12220494 GCGAGCTAGGCCCTGGAACAGGG No data
1162666802_1162666815 30 Left 1162666802 19:12220420-12220442 CCCTTCAAGGCGGTAGGTTCCCT No data
Right 1162666815 19:12220473-12220495 CGAGCTAGGCCCTGGAACAGGGG No data
1162666802_1162666810 16 Left 1162666802 19:12220420-12220442 CCCTTCAAGGCGGTAGGTTCCCT No data
Right 1162666810 19:12220459-12220481 TCTAGAAATGTCCGCGAGCTAGG No data
1162666802_1162666811 22 Left 1162666802 19:12220420-12220442 CCCTTCAAGGCGGTAGGTTCCCT No data
Right 1162666811 19:12220465-12220487 AATGTCCGCGAGCTAGGCCCTGG No data
1162666802_1162666813 28 Left 1162666802 19:12220420-12220442 CCCTTCAAGGCGGTAGGTTCCCT No data
Right 1162666813 19:12220471-12220493 CGCGAGCTAGGCCCTGGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162666802 Original CRISPR AGGGAACCTACCGCCTTGAA GGG (reversed) Intergenic
No off target data available for this crispr