ID: 1162672123

View in Genome Browser
Species Human (GRCh38)
Location 19:12266234-12266256
Sequence GGTCCCGACACGCGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 61}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162672123_1162672136 14 Left 1162672123 19:12266234-12266256 CCCTCCTCCCGCGTGTCGGGACC 0: 1
1: 0
2: 1
3: 1
4: 61
Right 1162672136 19:12266271-12266293 TCACCATTTCCTGGACTCCAGGG 0: 1
1: 0
2: 3
3: 22
4: 315
1162672123_1162672135 13 Left 1162672123 19:12266234-12266256 CCCTCCTCCCGCGTGTCGGGACC 0: 1
1: 0
2: 1
3: 1
4: 61
Right 1162672135 19:12266270-12266292 CTCACCATTTCCTGGACTCCAGG No data
1162672123_1162672134 5 Left 1162672123 19:12266234-12266256 CCCTCCTCCCGCGTGTCGGGACC 0: 1
1: 0
2: 1
3: 1
4: 61
Right 1162672134 19:12266262-12266284 CCGGCACACTCACCATTTCCTGG 0: 2
1: 5
2: 23
3: 40
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162672123 Original CRISPR GGTCCCGACACGCGGGAGGA GGG (reversed) Intronic
900532646 1:3162266-3162288 AGTCCCGGGACTCGGGAGGAGGG - Intronic
905971258 1:42144183-42144205 GATCCCCACACCCGTGAGGAGGG + Intergenic
907391306 1:54160228-54160250 GGTCCCTACATGATGGAGGAGGG + Intronic
907910820 1:58824682-58824704 GGTCCCAACACCAGGGTGGATGG - Intergenic
915367211 1:155323137-155323159 GGTCGCAAGAAGCGGGAGGAGGG + Intronic
916497062 1:165356004-165356026 GGTCCAGGCACGCGGGACGATGG + Intronic
920068687 1:203287388-203287410 GGTCCCCACAGGGAGGAGGAGGG + Intergenic
1067056938 10:43058024-43058046 GGTCCTGGAACTCGGGAGGATGG - Intergenic
1077386133 11:2270360-2270382 GGTCCCGGCGCGCCGCAGGAAGG + Exonic
1077466465 11:2735967-2735989 GCTCCAGACACACTGGAGGAAGG - Intronic
1077533783 11:3109410-3109432 GGTCACGTCAGGTGGGAGGATGG + Intronic
1080269299 11:30434052-30434074 GGTCCCCACAACCGGGAGGCTGG - Intronic
1083945449 11:65920401-65920423 GTTCCCGACATGCAGGGGGACGG + Exonic
1084030868 11:66479981-66480003 GGTCCCGAGTCCCGAGAGGAAGG + Intergenic
1085278084 11:75312689-75312711 GGTCCTGACAAGAGGGAGGCAGG + Intronic
1089496982 11:118912934-118912956 GGTCCTGACACCCAGGAGAAAGG - Intronic
1092204573 12:6607201-6607223 GGTCCGGAGACGCCTGAGGAAGG + Intronic
1129746264 15:78023618-78023640 GGTCCTGACACTCAGTAGGAAGG - Intronic
1130040965 15:80404760-80404782 GGTCCGGACCCGCGGGCGGCCGG + Intronic
1130622190 15:85475290-85475312 GGTCCAGACACAGGAGAGGAAGG - Intronic
1130994596 15:88896852-88896874 GTTCCCGACAGGGGAGAGGATGG + Intergenic
1132105408 15:99059334-99059356 GGGCCGGGCCCGCGGGAGGAGGG - Intergenic
1132969951 16:2682389-2682411 GGTCCCGAAAAGCAGGAGGCTGG - Intergenic
1133303991 16:4798777-4798799 GGTCCCGAAACCCGGCAGCAGGG + Intronic
1139403057 16:66696985-66697007 GATCCCGGCACGCGGGGCGATGG + Intergenic
1142283011 16:89159394-89159416 GGTCCCCACAGGCGGGTGCACGG + Intergenic
1147927073 17:43952810-43952832 GGCACCGAGACGCGGGCGGAGGG + Exonic
1148480732 17:47958012-47958034 GGGACCGCCACGCAGGAGGAGGG + Intergenic
1152680683 17:81666405-81666427 CGTCCCCACATGCGGGTGGAGGG + Exonic
1153480707 18:5543712-5543734 GGTCCCGGCGAGCGGGAGGGCGG + Intronic
1160126366 18:76176113-76176135 GGACCTGAAACGCGGGAAGAAGG - Intergenic
1160785522 19:898719-898741 GGTCCTGACACGGAAGAGGAGGG - Intronic
1161217099 19:3099978-3100000 GGTCCCCACGTGCGGCAGGATGG - Intronic
1162672123 19:12266234-12266256 GGTCCCGACACGCGGGAGGAGGG - Intronic
1163589389 19:18183148-18183170 GTTCCAGACACTCGGGAGGCTGG - Intergenic
1167368106 19:49065133-49065155 GGTCCCGGCACGCGAGTGCAAGG - Intergenic
1168581559 19:57559585-57559607 GGGCCCGACGAGCGGAAGGACGG - Intronic
942729582 2:179049395-179049417 GGTCCCGACAGACAGGGGGAGGG - Intronic
947729226 2:232418950-232418972 GGTCCCTGCGCGTGGGAGGAGGG - Intergenic
947741203 2:232485780-232485802 GGTCCCTGCGCGCGGGAGGCGGG - Intronic
948118077 2:235508616-235508638 GGTCCCGAAGTCCGGGAGGAGGG + Intronic
1169046642 20:2538446-2538468 TGGCCCGACCCCCGGGAGGAAGG - Intronic
1171407041 20:24918383-24918405 GGTCCCGGCACAGGGGAGGGGGG + Intergenic
1175676212 20:60948874-60948896 GTCCCAGACAGGCGGGAGGATGG + Intergenic
1180201054 21:46224484-46224506 GGTCCCTACACCCTGGAAGAAGG + Intronic
952919543 3:38275394-38275416 GCTCCTGACCCGTGGGAGGATGG + Exonic
954706669 3:52484644-52484666 GGTCCCCAGAAGCGGGAAGAGGG - Intronic
969250592 4:5965791-5965813 GGTCCAGACACTCCAGAGGAAGG + Intronic
978165632 4:105603364-105603386 GCTCCTGACCCTCGGGAGGATGG + Intronic
981781478 4:148435758-148435780 AGTCCAGACACGCAGGAGAAAGG - Exonic
985419076 4:189765215-189765237 GATCCCGACACGTGGGAGGAAGG - Intergenic
1018997245 6:168719273-168719295 GGTCCCGACACCCGTGCGGCAGG + Intergenic
1020083270 7:5297645-5297667 CGTCCCGACTCTAGGGAGGAAGG - Intronic
1028121406 7:87059688-87059710 GCTCCCGTCACGCCGGAGGGAGG + Exonic
1036664487 8:10730078-10730100 AGACCCGGCACGCGGGACGAGGG - Intronic
1039981322 8:42411657-42411679 GGTCCAGTCACGTGGAAGGAAGG + Intergenic
1053323475 9:37120646-37120668 GGTCCCGAGCCGCGGGCGGCGGG - Exonic
1053850692 9:42287777-42287799 CGTCAGGACAGGCGGGAGGATGG - Intergenic
1059405964 9:114098508-114098530 GGGCGGGGCACGCGGGAGGAGGG + Intronic
1059426723 9:114225810-114225832 GGTCCCTGCAGCCGGGAGGAAGG + Intronic
1061592727 9:131608479-131608501 GGTCCAGACACTGGGGAGGGAGG + Intronic
1061613771 9:131765872-131765894 GGTGCAGACACCCAGGAGGAAGG - Intergenic
1061824872 9:133251932-133251954 AGTGCGGCCACGCGGGAGGATGG + Intronic
1061882931 9:133577041-133577063 GGCCTGGACACCCGGGAGGACGG + Intergenic