ID: 1162673177

View in Genome Browser
Species Human (GRCh38)
Location 19:12275871-12275893
Sequence CTGTTCAGTGATTTGAAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 2, 2: 3, 3: 23, 4: 282}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162673177 Original CRISPR CTGTTCAGTGATTTGAAATA TGG (reversed) Intronic
902486711 1:16751210-16751232 ATGTTCAATGATTTAAAAGATGG - Intronic
903395280 1:22997214-22997236 ATTTTTAGTGATTTCAAATAAGG - Intergenic
906232262 1:44173957-44173979 GTTTTCAGTGATTTCAAATTAGG + Intergenic
908359690 1:63356983-63357005 CTGTTCTGTGGTTTGAAACAAGG - Intergenic
908670922 1:66546708-66546730 CAGTTGAGTGACTTTAAATAAGG + Intronic
908862836 1:68508945-68508967 ATGTTCAGTGATTTCAAATCAGG + Intergenic
909797968 1:79767469-79767491 TTATTCAGTTATTTGAAAGATGG - Intergenic
911449046 1:98041578-98041600 CAGTTCAAAGATTTTAAATAAGG - Intergenic
912759523 1:112354659-112354681 GTGTTCAGTGATTTGGCCTACGG + Intergenic
913302405 1:117386304-117386326 CTGTTCAGGGGTTTAAAGTAGGG + Intronic
915846300 1:159269181-159269203 ATGATGAGTGATTTGACATAGGG + Intergenic
916126526 1:161576396-161576418 CTGCTGAGTGCTTTGAACTAAGG + Intergenic
916136445 1:161658236-161658258 CTGCTGAGTGCTTTGAACTAAGG + Intronic
916428548 1:164705396-164705418 CTGTTGACTGCTTTTAAATAAGG + Intronic
916923709 1:169495545-169495567 ATGTTGAATGATCTGAAATAAGG + Intergenic
916929296 1:169558466-169558488 AAGTTTAGTGTTTTGAAATATGG + Intronic
918820781 1:189251311-189251333 CTGTCCAGTGTTTTGATCTATGG - Intergenic
920614910 1:207482168-207482190 TTTTTCAGTGATTTTAAATAGGG - Intronic
920776702 1:208945231-208945253 TTGTTCAGAGAGTTGAAGTAAGG - Intergenic
921926755 1:220716992-220717014 GTTTTCAGTGATTTCAAATTAGG - Intergenic
923329759 1:232911867-232911889 CTGTTCACTGTTTTGGAACAGGG - Intergenic
923341928 1:233015031-233015053 CTTTTCTGGGATTTGAAATATGG + Intronic
923550918 1:234962441-234962463 TTTTTCAGTGAATTGAAAGAAGG - Intergenic
1062797680 10:357057-357079 CTGTACCCTGATGTGAAATAAGG - Intronic
1064974382 10:21098398-21098420 ATGCTCATTGAATTGAAATATGG + Intronic
1065340697 10:24702051-24702073 CTAATCAGTGTTTAGAAATAGGG - Intronic
1068935129 10:62628295-62628317 CTGTTTAGTTATTTGAAGTAAGG - Intronic
1069118866 10:64543302-64543324 CAGTTCAGTGATGTGAATCATGG - Intergenic
1072687086 10:97543947-97543969 CTGTTAAGTTAGTTGAAACAAGG + Intronic
1073361279 10:102901151-102901173 TTTTTCAGTGATTTGGAATATGG - Exonic
1073547594 10:104364816-104364838 CTGTTCAGTGGTCTGAGCTAGGG - Exonic
1073820259 10:107253902-107253924 CTGAGAAGTGATGTGAAATATGG - Intergenic
1074413279 10:113245942-113245964 CTGCTCTGTGATTTGGAAAATGG + Intergenic
1074608860 10:115002048-115002070 CAGTTCAGGGATTTGGAATTGGG - Intergenic
1075702822 10:124480128-124480150 ATTTTCAGTAATTTAAAATAAGG + Intronic
1076638144 10:131896286-131896308 CTCTACAGTGATTTTAAAAATGG - Intergenic
1078051560 11:7969455-7969477 ATCTTCAGTGATTTCAAATCAGG + Intergenic
1078246586 11:9578323-9578345 TTGTTCACTGTTTTTAAATATGG - Intronic
1078752726 11:14180222-14180244 CTGTTGAGAGATTTTAACTAAGG - Intronic
1079912267 11:26325455-26325477 CTATTCAGTGATATTAAATATGG + Intronic
1080375864 11:31710321-31710343 GTGTTCATAGATATGAAATAAGG + Intronic
1080747956 11:35126158-35126180 CTGTTCATTGAATTGCAATGAGG - Intergenic
1081296778 11:41400129-41400151 CTGTCCAAAGATTTGAACTAGGG - Intronic
1082064483 11:47888389-47888411 CTCTGAAGTGCTTTGAAATAAGG + Intergenic
1086047349 11:82548490-82548512 CTGTTTAGGGAGTTGAAATTGGG - Intergenic
1086403383 11:86479469-86479491 ATGTTCAGTGATTTTAAATAAGG - Intronic
1087468514 11:98541825-98541847 CTGTTCTGTGAAATGAAACATGG - Intergenic
1087777558 11:102270189-102270211 CTGTTCACTGGGTTTAAATAGGG - Intergenic
1088125973 11:106423857-106423879 GTTTTCAGTGATTTGGGATAAGG - Intergenic
1089083687 11:115798914-115798936 CTGAACAGTGACTCGAAATATGG - Intergenic
1089466850 11:118691029-118691051 CTGTTCAGGGATTGGGAAGAAGG - Intergenic
1091876410 12:3937553-3937575 CTCATCAGTGATTTAAAAAATGG + Intergenic
1093749959 12:22786819-22786841 CTCTTCAGAGATTTAAACTAGGG - Intergenic
1094858915 12:34436858-34436880 CTGTTCTGTGACTTGACATTTGG - Intergenic
1096904538 12:54922389-54922411 AGGTTTAGTGATTTGAAACAAGG + Intergenic
1099002235 12:77192329-77192351 TTGTTAACTGAGTTGAAATATGG - Intergenic
1099187292 12:79529476-79529498 CTGTTAATTGCTTTAAAATAGGG - Intergenic
1100316327 12:93448142-93448164 CTGCTCACTGATTTTAAAAAAGG + Intergenic
1101481932 12:105106975-105106997 CTCTTCAGTGATTCGTAGTATGG + Intergenic
1101703224 12:107194891-107194913 CTGTTGAGTCATTTTAAAAAAGG + Intergenic
1102736206 12:115162601-115162623 CTGTCCAGTGGATTGGAATAAGG - Intergenic
1104241610 12:126995096-126995118 CTGCTTAGTGATTAGAAATCAGG - Intergenic
1106327690 13:28709987-28710009 GTGGTCAGTTATTTGAAATCTGG + Intronic
1106541865 13:30697550-30697572 CTGCTCAGTGCTTTGGAGTATGG + Intergenic
1107257477 13:38445701-38445723 CTGCTCTGAGCTTTGAAATAGGG + Intergenic
1107539564 13:41374656-41374678 CTGGCCAGTGACTTCAAATATGG - Intronic
1108486136 13:50927698-50927720 CTGTTCAGCCATCAGAAATACGG + Intronic
1109357990 13:61257108-61257130 CTGTTTAGTGATTCAAATTAGGG - Intergenic
1109423113 13:62138891-62138913 GTTTTCAGTGATTTCAAATTAGG - Intergenic
1109940120 13:69350818-69350840 CTGTTAACTGATGTGAAGTAGGG + Intergenic
1110428307 13:75394046-75394068 ATGTTAATTGCTTTGAAATATGG + Intronic
1111320600 13:86623352-86623374 GTCTTCAGTCATTTCAAATAGGG - Intergenic
1111578578 13:90191697-90191719 ATGTTAAGAGATTTGAAATCAGG + Intergenic
1112655907 13:101452496-101452518 CTGTTCACAGATTTCAAGTACGG - Intergenic
1114380258 14:22195871-22195893 ATTTTAAGTGCTTTGAAATATGG - Intergenic
1116595451 14:46837731-46837753 CTGATTAGTGATTTGAAAGATGG - Intergenic
1116709778 14:48353203-48353225 CCATTAAGTGATTTTAAATAGGG - Intergenic
1116867978 14:50046758-50046780 CTGTTCAGAGAATCGAAACAGGG + Intergenic
1118263958 14:64275910-64275932 TTTTTCATTGATTTAAAATATGG - Intronic
1118874653 14:69773429-69773451 CTTTTCAGGGATTTGGAAGAAGG + Intergenic
1122186464 14:100001239-100001261 GTTTTCAGTGATTTCAAATTAGG + Intronic
1122433653 14:101676496-101676518 GTTTTCAGTGATTTTAAATTAGG + Intergenic
1123124157 14:105933099-105933121 CTGTGCAGTGATTGGGAAAATGG - Intergenic
1202836129 14_GL000009v2_random:78663-78685 CTGTACAGTGATGTGCAACAGGG - Intergenic
1202927141 14_KI270724v1_random:37000-37022 CTGTTCTTTGAGTTGAAGTAAGG - Intergenic
1123776786 15:23588558-23588580 CTGGCCAGTGAATTGAAAGAAGG + Intronic
1126434893 15:48626480-48626502 CTGTTGACTGCTATGAAATATGG - Intronic
1126445948 15:48744477-48744499 CTATACAGTTATTTAAAATAGGG + Intronic
1126607841 15:50497254-50497276 CTGTTCAGTGAAATTAAATGAGG + Intronic
1128503198 15:68244000-68244022 CTTTGCAGTGAGTTGAGATAGGG + Intronic
1130007400 15:80112977-80112999 TTTTCCAGTGATTTGAAAAAAGG + Intronic
1130509129 15:84573828-84573850 TTATTCATTGATTTGAGATAGGG - Intergenic
1131913746 15:97238390-97238412 CTGTTCAGTTCTTTAAAAAATGG - Intergenic
1133761162 16:8799276-8799298 GGGTTCAGTGATATGAAAAAGGG - Intronic
1134397661 16:13880146-13880168 GTCTTCAGTGTTTTCAAATAAGG - Intergenic
1135258507 16:20961236-20961258 CTGTTCAGTAGTTGGAGATAGGG + Intronic
1137365634 16:47857044-47857066 CTGTTCCGTCACTTGAAAAATGG + Intergenic
1138747485 16:59380498-59380520 CTGTGCAGTGATTTTATAAAGGG + Intergenic
1138964241 16:62064785-62064807 CTGATCAGTGGTTTTAAATGGGG + Intergenic
1139242597 16:65409406-65409428 CAGTGCAGAGATTTGAACTAAGG + Intergenic
1140419929 16:74810851-74810873 GTTTTCAGTGATTTCAAATTAGG - Intergenic
1140788431 16:78366126-78366148 ATGGTCAGTAAATTGAAATAGGG - Intronic
1142023294 16:87797752-87797774 ATGTTCTGTGATGTGAAAAAAGG - Intergenic
1142583478 17:956082-956104 TTGTTCAATATTTTGAAATAAGG + Intronic
1143639453 17:8187742-8187764 CTGTTCTGGGATTGGAAATGTGG - Intergenic
1144615693 17:16769639-16769661 CTGTTCTGCGGTTTGAAAAATGG + Intronic
1144897012 17:18546028-18546050 CTGTTCTGCGGTTTGAAAAATGG - Intergenic
1145135206 17:20398179-20398201 CTGTTCTGCGTTTTGAAAAATGG + Intergenic
1147859029 17:43505695-43505717 CTGTTCAGTAATTAAAAATGAGG + Intronic
1148478288 17:47943373-47943395 CTGTTCAGTGTCCTGACATAGGG + Exonic
1149762955 17:59249516-59249538 CTGTTTAATCATTTAAAATATGG - Intronic
1150411497 17:64946673-64946695 CTCTTCAGTGATTCTAAACAGGG - Intergenic
1152512192 17:80798018-80798040 ATGTTCAGTGAAGGGAAATAAGG - Intronic
1154013239 18:10593500-10593522 ATTTTCAATGATTTGAACTATGG - Intergenic
1154152406 18:11916763-11916785 ATTTTCAATGATTTGAACTATGG - Intergenic
1155736839 18:29234919-29234941 CTGTTCAATGATTTCAAGGAAGG + Intergenic
1155832524 18:30535667-30535689 CTGGTAAGTGCTTTGAAACAGGG + Intergenic
1155845844 18:30705575-30705597 CGGTTCAGTTTTTTGAAATCAGG - Intergenic
1155863409 18:30933074-30933096 GTGTTCAGTGATGACAAATAAGG - Intergenic
1156712375 18:39962649-39962671 CTTTTCATTAAATTGAAATAAGG + Intergenic
1157912892 18:51635913-51635935 GTTTTCAGTGATTTCAAATTAGG - Intergenic
1157928559 18:51793379-51793401 CTGTTGAATTATTTGCAATAGGG + Intergenic
1158401559 18:57126039-57126061 TTGTTCAGTGATCTGCATTAAGG + Intergenic
1159426907 18:68300911-68300933 ATGATCAGTGATTTGAAAAGAGG - Intergenic
1159986515 18:74848279-74848301 TTTATCAATGATTTGAAATAAGG + Intronic
1162598510 19:11648548-11648570 CTGCTCAATGATTTGAAACATGG + Intergenic
1162613692 19:11777800-11777822 CTGTTCAATTATTTGAAATATGG + Intronic
1162616457 19:11804731-11804753 CTATTCAGGGATTTGGAATATGG + Intronic
1162637678 19:11983141-11983163 CTGTTCAGTGATTTGGAATATGG + Intergenic
1162641984 19:12018056-12018078 CTGTTGAGTGATTTACAATGTGG - Intronic
1162645447 19:12046548-12046570 CTGTTGAGTGATTTGGAATATGG - Intronic
1162649338 19:12074218-12074240 CTATTCCTTGATTTGGAATATGG + Intronic
1162653554 19:12110491-12110513 CTGTTGAGTAATTTGGAATATGG + Intronic
1162656555 19:12135685-12135707 CTGTTCATTGATTTGGAACATGG - Intronic
1162673177 19:12275871-12275893 CTGTTCAGTGATTTGAAATATGG - Intronic
1162678813 19:12322500-12322522 CTGTTCAATGATTTGAAATATGG - Intronic
1162686772 19:12393212-12393234 CTGTTCAAAGATTTGGAATATGG - Intronic
1162691124 19:12432986-12433008 CTGTTCAAAGATTTGGAATATGG - Intronic
1162711682 19:12599588-12599610 CTGGTAAGTGATTTTAATTATGG - Intronic
1164208850 19:23080167-23080189 TTATTCAGTCTTTTGAAATAGGG - Intronic
1202636507 1_KI270706v1_random:48699-48721 CTGTACAGTGATGTGCAACAAGG + Intergenic
926857176 2:17269802-17269824 TTGTTCAGTGATTTGACCAATGG - Intergenic
926938178 2:18107099-18107121 CTGTTAAGTGATTTGCATAAAGG + Intronic
928870186 2:35966554-35966576 CAGTTCAGTGGTTTTAAATTAGG + Intergenic
929134496 2:38610154-38610176 CTATGCAGTTATTTGAAAAATGG - Intergenic
930980568 2:57521337-57521359 CTGTTGTGTAATTTGAAATCAGG + Intergenic
931604037 2:64033846-64033868 CTGTTCATTTATTTGGAATAAGG + Intergenic
933451575 2:82459586-82459608 CATTTCAGTGATTATAAATAAGG + Intergenic
933567591 2:83969974-83969996 GTGTTCAGTTACTTGAAAGATGG + Intergenic
936698842 2:114985322-114985344 CTGATCAGTTATTTAAAACAGGG + Intronic
940101690 2:150047295-150047317 CTGTCCACTGAAATGAAATACGG - Intergenic
942193256 2:173492508-173492530 CTGTTCACTGAAATGAAATCCGG + Intergenic
942364015 2:175203731-175203753 CTGTGAAGTGATTTTAAAGATGG - Intergenic
943286397 2:186006850-186006872 ATGTTCAGTGATTTTAGAGAGGG - Intergenic
943949895 2:194120179-194120201 ATGTTGAGTGATTTTAACTAAGG - Intergenic
946753035 2:222912623-222912645 AAGTTCATTAATTTGAAATAAGG - Intronic
946972887 2:225115367-225115389 CTCTTCAGTGGCTAGAAATAAGG + Intergenic
947152967 2:227133196-227133218 CTTGTCAGTGATTTGCAACAGGG - Intronic
1169379144 20:5091639-5091661 TTGTTCAGTTATTTCAAATATGG + Intronic
1169727691 20:8753727-8753749 CTTTTCAGTGATTGGAAACTGGG + Intronic
1169808654 20:9585643-9585665 CTGTTCTCTTATTTGTAATAGGG + Intronic
1171049375 20:21840925-21840947 CAGTTCTGTGATATGAAATTAGG - Intergenic
1171506256 20:25636591-25636613 GTTTTCAGTGATTTCAAATTAGG + Intergenic
1172258840 20:33543791-33543813 GTTATCAGTGCTTTGAAATATGG - Intronic
1176953351 21:15071558-15071580 CTGTTCAGTGTATGGAAACAAGG - Intergenic
1177037156 21:16058797-16058819 CTGTTCAGGAATATGAACTAGGG + Intergenic
1177140044 21:17348186-17348208 CTGTTCAGCCATTAAAAATAAGG - Intergenic
1178662485 21:34519256-34519278 CTGGGCAGGGATCTGAAATAGGG + Intronic
1178967049 21:37130688-37130710 CTGTACAGTATTTTGTAATATGG + Intronic
1180364362 22:11925615-11925637 CTGTACAGTGATGTGCAACAGGG - Intergenic
1183015965 22:34986997-34987019 CTGTTATTTCATTTGAAATAAGG + Intergenic
1183617157 22:38952938-38952960 CTGTGCAGAAATTTCAAATATGG - Intronic
1184917843 22:47585004-47585026 GTTTTCAGTGATTTCAAATTAGG - Intergenic
950825577 3:15816396-15816418 CTTTTCCCTGATTTGTAATATGG + Intronic
951494016 3:23305459-23305481 CATTGCGGTGATTTGAAATAAGG + Intronic
952563265 3:34621279-34621301 CTTTGCAGTAATTTGAAATTGGG + Intergenic
953497718 3:43402792-43402814 CTGTTCAGTTGTTTTTAATAGGG - Intronic
953897678 3:46814671-46814693 CAGCTCAGTGAGTTAAAATAAGG - Intergenic
955761812 3:62293102-62293124 CAGTTTAGTGATTTCACATAAGG - Intronic
956597108 3:70979583-70979605 ATGGTAAGTGATTTGAAATCTGG - Intronic
957330721 3:78759716-78759738 CAGTTCATTGCTTTGAAATAAGG + Intronic
957342702 3:78921437-78921459 CTGTTCATTTATCTGACATAAGG - Intronic
959194573 3:103163301-103163323 CTGTTCTTTAATTTGAAAAAAGG + Intergenic
959404667 3:105945909-105945931 CTGTATAGTGATTAAAAATATGG + Intergenic
961619515 3:128212667-128212689 CTGTTCAATGTTTTTAAAAATGG + Intronic
963807853 3:149744235-149744257 CTTTTCAGTGCCTTGAGATATGG - Intronic
966714587 3:183002228-183002250 GTGTTCAGTTATTTGATAAAGGG + Intergenic
967244873 3:187476560-187476582 GTTTTCAGTGATTTCAAATTAGG - Intergenic
967602923 3:191410872-191410894 CTTTGCAGTGTTTTCAAATAAGG + Intergenic
967709036 3:192684641-192684663 CTTTTCAGTGATTCAAAATCAGG + Intronic
967799291 3:193638124-193638146 CTGTTCATTGTGTTGAAATGAGG + Intronic
968015347 3:195327020-195327042 CTGTGAAATGATTTGGAATATGG - Intronic
970265637 4:14281318-14281340 CAATGCAGTGATTTGAAATGTGG + Intergenic
970890006 4:21032851-21032873 CTGTTCAGAGATTTCACATCAGG + Intronic
971926397 4:33014650-33014672 CTGTAAAGTGAGTTGAAATGGGG + Intergenic
972256960 4:37367024-37367046 ATGTTCTGTGAATTGAAAAAAGG - Intronic
973676166 4:53265170-53265192 CTCTTCAGTGATTTTATAGAGGG + Intronic
974241304 4:59251726-59251748 ATTTTCAGTGATTAGAAAAAGGG - Intergenic
976831156 4:89315936-89315958 CTCTGCAGTCATTTAAAATAAGG + Intergenic
977236457 4:94513136-94513158 CTGTAGTGTAATTTGAAATAAGG + Intronic
977622789 4:99155937-99155959 CTGGTCAGTGATTTGATGGAAGG + Intronic
978828422 4:113052829-113052851 CAGTTGAGTAATTTGAAAGAGGG + Intronic
978950215 4:114549064-114549086 GTGTTCAGTGATTCAAAATTAGG + Intergenic
979003818 4:115262223-115262245 AAGTACAGTGATTTCAAATAGGG - Intergenic
979594373 4:122517850-122517872 TTTTTCATTGATTTAAAATATGG + Intergenic
979928194 4:126594505-126594527 CTGCTCTGTGACTTGAAATGGGG + Intergenic
980338567 4:131509609-131509631 CTCTTCAGTGCTTTGCAATAGGG + Intergenic
980842051 4:138275523-138275545 GTGTTCAGATATTTAAAATAGGG - Intergenic
981399242 4:144293718-144293740 CTGTTCATTCATTTGTAAGATGG - Intergenic
983566254 4:169155346-169155368 CTGTCCAGTGATCTGTAACAGGG + Intronic
983606195 4:169588125-169588147 CAGTGCTGTGATTAGAAATATGG + Intronic
984231547 4:177106664-177106686 CTGCTCTGTCATTTGAAATCTGG + Intergenic
984848929 4:184135706-184135728 CTGTTCAGTGAATTGTTAAAAGG + Intronic
985384665 4:189433179-189433201 CTGTTGTGTGCTTTGAATTAGGG - Intergenic
986053377 5:4111397-4111419 CTGACAAGTGATTTGAACTAAGG - Intergenic
986703558 5:10435459-10435481 CTTTTCTCTCATTTGAAATAAGG + Exonic
987189654 5:15463085-15463107 CTGTTCAGGGATTTTGCATAGGG + Intergenic
987363858 5:17130778-17130800 CTGATCAGTGCTTTGTAAAATGG - Intronic
987644208 5:20648195-20648217 CTGTTCAGTGAGGTGAAGTGAGG - Intergenic
987644220 5:20648257-20648279 CTGTTCAGTGAGGTGAAGTGAGG - Intergenic
987768446 5:22267456-22267478 CTATTCAGGGACATGAAATAAGG - Intronic
988773830 5:34457416-34457438 GTTTTCAGTGATTTCAAATTAGG + Intergenic
989118649 5:37981441-37981463 ATCTACAGTGATTTGAAACATGG + Intergenic
989497146 5:42122715-42122737 CTGCTGAGTGATTTAATATATGG + Intergenic
989575902 5:42987922-42987944 GTTTTCAGTGATTTAAAATTAGG + Intergenic
989997788 5:50856079-50856101 CTCTGCAGTGCTTTTAAATAAGG + Intergenic
990254235 5:53948502-53948524 CTGTTCAGTGAATAAGAATAGGG - Intronic
990397373 5:55396087-55396109 CTAATTAGTGAATTGAAATAAGG + Intronic
990402519 5:55453348-55453370 CCTTTCAGTGATTAGAAATTTGG + Intronic
990539372 5:56757135-56757157 CTGGGAAGTGATTTGAGATAGGG - Intergenic
992699086 5:79321990-79322012 CTTTTCAGTGCATTGAAAGATGG - Exonic
993872557 5:93269202-93269224 TTATTCACTGATTTGATATAAGG - Intergenic
993997442 5:94739624-94739646 ATGTTCCTTGATTTGGAATAAGG + Intronic
994003262 5:94806369-94806391 CTTTTCAGTCATATGAAACAAGG + Intronic
995170467 5:109105153-109105175 TTGTCCAGTGATTTCTAATAAGG + Intronic
996277348 5:121682966-121682988 CTTTACAGTGTTTTGAAAAATGG - Intergenic
997725113 5:136113819-136113841 CTGTTGAGTGATTTTAACTCAGG + Intergenic
997728762 5:136147516-136147538 CTGTACAGTGGTTTGGAATATGG + Intronic
998052375 5:139046656-139046678 CTGTTCCCTGAATTGAAATAAGG + Intronic
998280450 5:140802181-140802203 CTGTGCAGTGATCTGACATTGGG - Exonic
999631731 5:153578396-153578418 TTGTGCAATGATTTGAAAAATGG + Intronic
1001129701 5:169053789-169053811 CTGTTCCCTATTTTGAAATAAGG - Intronic
1004050727 6:12076294-12076316 ATGTTTATTGATTTGAAGTAGGG + Intronic
1004954893 6:20718487-20718509 CTGTTTAGGGTTTTGATATATGG + Intronic
1005479958 6:26246412-26246434 GTGTTCAGAGATTAGAAATCTGG - Intergenic
1007243054 6:40440906-40440928 TGGAACAGTGATTTGAAATAAGG - Intronic
1009577058 6:65478726-65478748 CTCTTCAGTGATTCTAAACAGGG - Intronic
1010134116 6:72530216-72530238 CTTTTCCTTCATTTGAAATAGGG - Intergenic
1010711459 6:79180139-79180161 CTCTTCTGTAATTTGAAACAGGG - Intergenic
1011913271 6:92468732-92468754 CTGGTCAGTGTTTTAAAAAATGG + Intergenic
1012654684 6:101801311-101801333 GTGTTCACTGGTTTGGAATAAGG - Intronic
1013594865 6:111651375-111651397 TTGTTCAGAAATTTGAAATTTGG + Intergenic
1014455729 6:121632627-121632649 ATTTTCAGTGATTTCAAATTAGG + Intergenic
1015035472 6:128648681-128648703 ATATTCAGTGATTTGAATGATGG + Intergenic
1015654690 6:135504386-135504408 CTGATCAGTGATTAAAAACACGG - Intergenic
1016792757 6:148083136-148083158 CTGAAGAGTGATTAGAAATAAGG + Intergenic
1020639416 7:10736961-10736983 CTGTTCTGTGATTACAAATGTGG - Intergenic
1021817885 7:24465955-24465977 CAGTTCAGTTATTTAAAAAATGG + Intergenic
1021885192 7:25130939-25130961 CTGTTCAGTGGTTTGGAGCAGGG + Intergenic
1022732498 7:33043162-33043184 CTGTGCAGTGATCTGAAACATGG - Intronic
1022769945 7:33459086-33459108 CTCTTCAGTAATTGGCAATAAGG - Intronic
1023100862 7:36717067-36717089 CTGTTCAGTGCTAACAAATATGG + Intronic
1025526950 7:61826008-61826030 CTGTTCAGTGAATGGACATTTGG - Intergenic
1027974953 7:85141336-85141358 CTGTGCAGTTAGTTGACATATGG - Intronic
1028221293 7:88200159-88200181 TTTTTCAGTGTTTTAAAATAAGG + Intronic
1030534637 7:110750527-110750549 CTTTCCATTGCTTTGAAATAAGG - Intronic
1030782451 7:113618253-113618275 GTTTTCAGTGATTTCAAATTAGG + Intergenic
1031435335 7:121725747-121725769 ATTTCCAGTGATTTGAGATAAGG + Intergenic
1032285492 7:130535976-130535998 CTGGTCAGTGATATGAAAAGAGG + Intronic
1033808809 7:144985677-144985699 CTGTCCAGTGAAAGGAAATAAGG + Intergenic
1037008534 8:13811157-13811179 CTGTCCAGCAATTTGAAATATGG - Intergenic
1037449942 8:19006690-19006712 GTGTCCAGTGGTTAGAAATAAGG - Intronic
1037752037 8:21688938-21688960 CTGTGAAGTGAGTTGAAATTGGG - Intergenic
1040371020 8:46774537-46774559 CTGTTCAATCTTTTCAAATAAGG - Intergenic
1040392794 8:46963946-46963968 CTGTTCACTGTTTTGAACTTTGG + Intergenic
1040656503 8:49516316-49516338 CTATTTATTGATTTGACATAAGG + Intergenic
1040756863 8:50786581-50786603 CTTTGTAGTGTTTTGAAATATGG - Intronic
1041285539 8:56257563-56257585 ATGTTCAATGATTTGGTATAAGG + Intergenic
1041664219 8:60426938-60426960 TTGTTGAATGATTGGAAATATGG - Intergenic
1042272393 8:66968076-66968098 CTGTTCAATTTTTTAAAATATGG - Intronic
1044046903 8:87447437-87447459 GTGTTCAGTGAAGTGAGATAAGG - Intronic
1044304388 8:90620807-90620829 CAGTAAAGTGATTTGAAACATGG - Intergenic
1045623758 8:104016652-104016674 CTCTTCAGTGTTTTTAAAGATGG + Intronic
1045782721 8:105886633-105886655 CTTTTCAGGGCTTTGAAGTATGG + Intergenic
1046222532 8:111234865-111234887 GTTTTCAGTGATTTCAAATCAGG - Intergenic
1046307553 8:112389914-112389936 CTGTCCTGTTATTTGAATTATGG - Intronic
1046348256 8:112966525-112966547 CCTTTCAGGGATTTGAAACATGG + Intronic
1046504799 8:115123725-115123747 CTGTCCAGTAGTTTGAAATGTGG + Intergenic
1046586055 8:116149764-116149786 TTGCTCAGTTATCTGAAATATGG - Intergenic
1047837094 8:128705877-128705899 TTGTTCATTCGTTTGAAATAGGG - Intergenic
1049185120 8:141246435-141246457 CTGCTCAGTTATTTGCCATATGG + Intronic
1050141898 9:2524835-2524857 CTGTTCAGTGATGAGAAATGAGG - Intergenic
1055356003 9:75437672-75437694 CTATTGAGTACTTTGAAATATGG + Intergenic
1055731999 9:79287904-79287926 GTGCACAGTGATTTGACATAGGG - Intergenic
1056278783 9:85019370-85019392 CTGTTCATGGGTTTGAAATCGGG + Intronic
1059377436 9:113895575-113895597 CTTTCCAGTGATCTGAAACATGG + Intronic
1060773847 9:126354068-126354090 CAGTTCTGTGATTAGCAATAAGG + Intronic
1203544576 Un_KI270743v1:119442-119464 CTGTACAGTGATGTGCAACAGGG + Intergenic
1186561518 X:10618510-10618532 CTGTTCAGAACTTTGAAAGAGGG - Intronic
1187692592 X:21884944-21884966 CTGTAGAGTGATTGGAAAAATGG + Exonic
1188520041 X:31028826-31028848 CAATTCATTTATTTGAAATATGG + Intergenic
1189621268 X:42841259-42841281 GTGTTCAGTGATTCTCAATAAGG - Intergenic
1189741649 X:44123518-44123540 CTGTTCAGTGTCTTGAATAACGG + Intergenic
1190951679 X:55151852-55151874 ATTTTTAGTGATTTCAAATAAGG - Intronic
1192639764 X:72850577-72850599 CTGTTCATAGATTTAAAACATGG + Intergenic
1192641947 X:72870228-72870250 CTGTTCATAGATTTAAAACATGG - Intergenic
1195463327 X:105152553-105152575 CTTTTAAGTGATTTTGAATAAGG - Intronic
1196130309 X:112148215-112148237 CTGTACAGTGATGTGAACTTGGG + Intergenic
1196343639 X:114626151-114626173 CTGTTAAGTGCTTAGACATATGG + Intronic
1199355631 X:146860216-146860238 ATTTTCAGTGATTTCAAATTAGG + Intergenic
1199402699 X:147417835-147417857 CTGTTTCATTATTTGAAATAGGG - Intergenic