ID: 1162679493

View in Genome Browser
Species Human (GRCh38)
Location 19:12329874-12329896
Sequence TCCAGAAAACAGAAGTAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 5, 3: 28, 4: 324}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162679491_1162679493 -4 Left 1162679491 19:12329855-12329877 CCAATTCTCTACAATATCTTCCA 0: 3
1: 24
2: 96
3: 265
4: 714
Right 1162679493 19:12329874-12329896 TCCAGAAAACAGAAGTAGGTAGG 0: 1
1: 0
2: 5
3: 28
4: 324
1162679490_1162679493 -3 Left 1162679490 19:12329854-12329876 CCCAATTCTCTACAATATCTTCC 0: 1
1: 0
2: 9
3: 43
4: 288
Right 1162679493 19:12329874-12329896 TCCAGAAAACAGAAGTAGGTAGG 0: 1
1: 0
2: 5
3: 28
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162679493 Original CRISPR TCCAGAAAACAGAAGTAGGT AGG Intronic
900404856 1:2488209-2488231 TTTAGGAAACAGAAGTAGATGGG + Intronic
902139776 1:14343206-14343228 ATCAGAAAACAGCACTAGGTGGG - Intergenic
902544497 1:17181015-17181037 TCCAGAAAACAGAAGAGGAGAGG + Intergenic
906911395 1:49955350-49955372 TACAGAAAACAGAATTACATTGG + Intronic
907138800 1:52165116-52165138 TCCAGAAAATAAGAGTAGGCTGG + Intronic
907379130 1:54071054-54071076 TCCAGAAACTAAAAGTAGTTTGG + Intronic
907591289 1:55674270-55674292 TCCAGAAAATAAAAATATGTGGG + Intergenic
907874665 1:58473879-58473901 TCCAGAACACAGAAATCTGTCGG - Intronic
909470945 1:76027660-76027682 TCCAGAAAACCCAAGATGGTAGG - Intergenic
910357860 1:86380356-86380378 CCCATAAAACATAAGTAGCTGGG + Intronic
910772384 1:90843122-90843144 TCAGGAAATCAGAGGTAGGTTGG + Intergenic
910918533 1:92318080-92318102 TCAAGAAAACAAAAGTAAGAGGG - Intronic
911317520 1:96373184-96373206 TCCTGAAAATGGAAGAAGGTAGG + Intergenic
911389895 1:97228775-97228797 ACCAGAGAACAGAATTCGGTTGG + Intronic
911984500 1:104603470-104603492 TTCAGAAAGAATAAGTAGGTGGG + Intergenic
913152660 1:116060658-116060680 TCCAGGAAACAGAATGAGTTGGG - Intronic
913497155 1:119438950-119438972 TCCAGGAAACAGAAGATGCTGGG - Intergenic
913515408 1:119601289-119601311 TCCAGGAAACAGAAGATGCTGGG - Intergenic
917077085 1:171216905-171216927 TCCAGAAAAGAGAAGTAAACAGG - Intergenic
918320400 1:183358793-183358815 TCCAGAAAGGAGAGGAAGGTGGG - Intronic
919762902 1:201109557-201109579 TCCATAAAACAGAATGAGGTGGG + Intronic
921191192 1:212710195-212710217 TGCCAAAAACAGAAGTAAGTGGG - Intergenic
921397705 1:214686414-214686436 TCCAGAAAAAGGGAGGAGGTGGG + Intergenic
924466679 1:244304649-244304671 AAAAGAAAACACAAGTAGGTGGG - Intergenic
924557170 1:245128433-245128455 TCCAGAAGACAGAAGCAGCGTGG - Intergenic
1063202489 10:3797304-3797326 TCTAGAAAACAGAAGGTGGGTGG - Intergenic
1063236270 10:4119762-4119784 TCTAGAAAACTGAAGTAGAATGG + Intergenic
1063715228 10:8520359-8520381 CCCAGAAGACAGCAGCAGGTTGG - Intergenic
1064120871 10:12617604-12617626 GCCAGAAAACAGATGCAGGTGGG - Intronic
1065428817 10:25632823-25632845 TCCAGAAAAAAAAAATATGTAGG - Intergenic
1065655924 10:27949797-27949819 TCCAGAGAATAGAAGTAACTTGG + Intronic
1065780286 10:29160737-29160759 TCCAGAAACCAGAAGAAGTGAGG - Intergenic
1067295963 10:44975327-44975349 CCCAGAAAACAGATGTTCGTGGG - Intronic
1067436211 10:46280642-46280664 CACAGAAAACAAAAATAGGTGGG - Intergenic
1069672064 10:70215410-70215432 TTCCCAAAACAGAAGTAGATAGG + Intronic
1070205458 10:74255097-74255119 TATAGAAAACAATAGTAGGTTGG + Intronic
1073204509 10:101761813-101761835 GCCAGAAATCAGAAGTGGCTTGG - Intergenic
1074204310 10:111269205-111269227 ACCAGAAGACAGAAGAAGATGGG - Intergenic
1075196571 10:120364599-120364621 TCCAGGGAACAGAAGTAGTAGGG + Intergenic
1075232059 10:120688900-120688922 TCCAGAAAAGTGAAGTAAATTGG - Intergenic
1076115087 10:127889891-127889913 TCCAGAACCGAGAAGGAGGTGGG + Intronic
1076126431 10:127977875-127977897 TCCAGGGAACAGAAGCAGGGAGG - Intronic
1078060038 11:8037361-8037383 TCCAGAAAACAGAAGAATCACGG - Intronic
1078671707 11:13371514-13371536 AGTAGAAAACAGAAGTAGGAAGG - Intronic
1078806618 11:14712062-14712084 AACAGAAAACAGAAGTAGACAGG - Intronic
1079141450 11:17812861-17812883 CCCATAAACCAGAAGGAGGTTGG - Intronic
1079932130 11:26577400-26577422 TACAGAAAAAAGAGGTAGCTGGG + Intronic
1080123275 11:28701868-28701890 TCCAGAAACCATTTGTAGGTTGG - Intergenic
1080462359 11:32466387-32466409 CCCAGGAATCAGAAGTGGGTAGG + Intergenic
1081035918 11:38146454-38146476 TCTTGAAAACAGAAGATGGTTGG + Intergenic
1081743325 11:45456117-45456139 TCCAGGAAACACAGGGAGGTGGG + Intergenic
1082109257 11:48256071-48256093 TGCACAGAACAGAAGCAGGTGGG + Intergenic
1083071190 11:59983899-59983921 TTCAGAAAAGAGAACTGGGTTGG - Intergenic
1084514970 11:69632479-69632501 ACCATAAAAGAGAAGTGGGTTGG + Intergenic
1084951441 11:72668341-72668363 TCCAGAAAACAGCAGTCTCTTGG + Intronic
1085238243 11:75031671-75031693 CCCTGAACACAGTAGTAGGTGGG + Intergenic
1086218437 11:84411378-84411400 TCTAGTAACCAGAAGTAGGAAGG - Intronic
1088543819 11:110940112-110940134 TCCAAAAAACAGACCTGGGTTGG + Intergenic
1090041765 11:123298442-123298464 TCCAGATAATAGAACTAGGGTGG - Intergenic
1091078023 11:132639518-132639540 TCCATAGAACACAAGGAGGTGGG - Intronic
1091106666 11:132926303-132926325 TCCAGAAACCAAAAGCAGCTTGG + Intronic
1091561208 12:1615026-1615048 TTCAGAAAACAGAAGAGGGAAGG - Intronic
1092464311 12:8715517-8715539 TCAAGAGAACAAGAGTAGGTGGG - Intronic
1093040038 12:14367611-14367633 TCCAGAAAAATGAAATAGTTTGG + Intronic
1093150507 12:15615724-15615746 TCTTGAAAACAGAAGACGGTTGG + Intergenic
1093815822 12:23545486-23545508 TACAGAAAACAGAAGTCTGAAGG + Intronic
1095556774 12:43516047-43516069 GCCAGAAAACTGAAGGCGGTGGG - Intronic
1095582025 12:43811273-43811295 AACAGAAAACAGGAGGAGGTGGG - Intergenic
1095741048 12:45607546-45607568 TCCAGCACTCAGAAGAAGGTAGG - Intergenic
1096025592 12:48358402-48358424 TGGAGAAAACAGAACTAGGCTGG - Intergenic
1096279733 12:50242471-50242493 TCCAGGAAACAGGAGGAGGCCGG - Intronic
1096865939 12:54562851-54562873 TCCAGACACCAGAAGGAGGCAGG - Intronic
1096866062 12:54564036-54564058 TCCAGACACCAGAAGGAGGTGGG + Intronic
1096984472 12:55747165-55747187 TTCAGAGATCAGAAGTAGCTGGG - Intronic
1097500039 12:60390595-60390617 TCCAGAAAACAGAGGTAAACAGG - Intergenic
1099011382 12:77295326-77295348 TGGAGAAATCAGAAGTAGGCAGG + Intergenic
1100083775 12:90882604-90882626 CCCACAAATAAGAAGTAGGTGGG + Intergenic
1100649010 12:96564165-96564187 TAAAGTCAACAGAAGTAGGTTGG + Intronic
1100768099 12:97890767-97890789 TCCAGAAAACAGAAGAGGTGGGG - Intergenic
1101925729 12:108969803-108969825 TCCAGAAACAGGAAGTGGGTGGG + Intronic
1102559587 12:113752813-113752835 TCCCGAAAACAAAAGTGGATTGG + Intergenic
1102880809 12:116483028-116483050 TCCAAAAAACTAAAGTACGTGGG + Intergenic
1103124571 12:118410329-118410351 ACCAGAACACTGAAGAAGGTTGG - Intronic
1103233364 12:119350992-119351014 TCCAGAGAACAGACGCAGGCTGG - Intronic
1104383110 12:128325423-128325445 TCCAGAAAACAAAAATACATGGG + Intronic
1106074647 13:26447835-26447857 GCCAGGAAACAGAAGAAGGTTGG - Intergenic
1106925083 13:34605437-34605459 TTGAGAAAACAGAAGCAGGAAGG + Intergenic
1108392656 13:49962345-49962367 TCCAGAAGACAGAAGCAGAGGGG + Intergenic
1108649144 13:52458564-52458586 TTCAGAAAACAGATGTTGGCTGG + Intronic
1108899696 13:55386006-55386028 TCCAGATAACAGAATTCTGTTGG - Intergenic
1109012766 13:56972161-56972183 TCCAGAAAAAGGAAGTAAGCAGG + Intergenic
1110460485 13:75739547-75739569 TCCAGAAAATAGCAGTAAGAAGG - Intronic
1110543604 13:76732776-76732798 TCCAGAAGACAGAAGAGGGGAGG - Intergenic
1112289421 13:98131978-98132000 TCCATAAAAAAGAAGTACATAGG + Intergenic
1112610281 13:100948636-100948658 AACAGCAAACAGAGGTAGGTGGG - Intergenic
1113858904 13:113468334-113468356 TCCAGAGACCAGAAGTAGAATGG + Intronic
1114185785 14:20401111-20401133 TCGAGAAAAGAGCTGTAGGTTGG + Exonic
1114351024 14:21851378-21851400 TCCATAAGACAAAAGTAGATGGG - Intergenic
1114809265 14:25877251-25877273 TTCAGAAAAAAGAAGAATGTTGG - Intergenic
1116115291 14:40641144-40641166 TGCAGAAAAAAAAAGTAGTTTGG + Intergenic
1116259312 14:42602507-42602529 TCTAGAAAACAGCTGTAGGATGG - Intergenic
1116941807 14:50798188-50798210 TCCAGGAGAGAGAAGTAGTTGGG - Intronic
1119812448 14:77533725-77533747 TCAAGAAAGGGGAAGTAGGTTGG + Intronic
1121911740 14:97798025-97798047 CACAGAAAACTGAAGTAGGGGGG - Intergenic
1124933312 15:34144865-34144887 TCCAGAAAACATTGGTAGTTAGG - Intronic
1125645535 15:41269283-41269305 TCCAGAGAAAGGAAGTAGCTAGG - Intronic
1126165128 15:45648491-45648513 TCCAGAAGACAGGATTTGGTAGG - Intronic
1126771165 15:52057431-52057453 CCCAGAAGACAGAGGCAGGTTGG - Intronic
1127106162 15:55618670-55618692 TCAAGAAAACACAAGTAGGGTGG + Exonic
1127695212 15:61440112-61440134 TCAGGAAAAGAAAAGTAGGTAGG - Intergenic
1128368787 15:67024095-67024117 TCCAGGAAACAGACCCAGGTAGG + Intergenic
1132630024 16:912767-912789 CAAAGAAAACAGAAGCAGGTGGG - Intronic
1133413087 16:5584559-5584581 TCCAGAAAACAGAAGCTGAAGGG - Intergenic
1134267718 16:12706293-12706315 TCCAGGAAACAGAAGCAGAGAGG + Intronic
1135474496 16:22762372-22762394 CCCAGAAAACAGATGGAGTTTGG + Intergenic
1135733499 16:24913287-24913309 TCCAAATAGCAGTAGTAGGTTGG + Intergenic
1135817146 16:25644893-25644915 CCCAGAAAGAAGAAGAAGGTGGG - Intergenic
1136181615 16:28556641-28556663 TAAAAAAAACATAAGTAGGTTGG - Intronic
1136249247 16:28993104-28993126 TACAGAAAATACAATTAGGTGGG - Intergenic
1137345752 16:47657383-47657405 AACAGAAAACAAAGGTAGGTTGG + Intronic
1137482476 16:48864204-48864226 ACCAGAACCCAGAAGTGGGTGGG + Intergenic
1138285932 16:55810272-55810294 CCCAGATAACAGCAGTAGGGAGG - Intronic
1138999107 16:62487390-62487412 TCCAGAAAACAGAAGCAGAGTGG + Intergenic
1139679903 16:68553417-68553439 TCCAGGAATCAGAAGGAGGGTGG + Intronic
1139962290 16:70724944-70724966 TCTAGCAAACAGACTTAGGTTGG + Intronic
1141513560 16:84528010-84528032 CCAAGAAAAGAGAAGTGGGTTGG + Intronic
1141750425 16:85954626-85954648 TCCAGCAAACACATGGAGGTGGG + Intergenic
1144385665 17:14747011-14747033 TCCAGAAAGCAGAAGGCGGGTGG - Intergenic
1144465231 17:15491835-15491857 TACAGAAAACAGAAACAGCTAGG + Intronic
1144473614 17:15565354-15565376 ATAAGAAAACAGAAGGAGGTTGG - Intergenic
1144922907 17:18779457-18779479 ATAAGAAAACAGAAGGAGGTTGG + Intergenic
1146058961 17:29594493-29594515 TCCAGAAAACAGGGGAAGGGGGG + Intronic
1147212580 17:38880485-38880507 TCCAGCCAAAAGAAGCAGGTTGG + Intronic
1147293028 17:39459033-39459055 TCAAGAAAAAAGAAGTGGCTGGG - Intergenic
1148572482 17:48681224-48681246 CTCAGAAAACAGAAGTAGCATGG - Intergenic
1149312591 17:55409369-55409391 TCTAGAAAACAGAATTAGAAAGG - Intronic
1149571081 17:57672762-57672784 TCAGGAAAACAGAAGAAGCTTGG - Intronic
1150087616 17:62286992-62287014 TCCAAAAAAGAGAAGTATTTTGG + Intergenic
1150180543 17:63115221-63115243 TCCAGGAAACAGAATGAGATAGG + Intronic
1152097411 17:78280042-78280064 TCCAGAAACCATAAGGAGGCTGG + Intergenic
1154957141 18:21269854-21269876 TCTAGAGATCAGAAATAGGTAGG + Intronic
1155044160 18:22088972-22088994 ACCAGAAAGCAGTAGTAGGAGGG + Intronic
1155678866 18:28464966-28464988 TTCAGAATATAGAAGTAGGGAGG - Intergenic
1156698711 18:39798189-39798211 TCCAGAAAAGAGAGGTACATAGG - Intergenic
1157557854 18:48624374-48624396 GCAGGAAACCAGAAGTAGGTGGG - Intronic
1157756141 18:50219269-50219291 TCCAGGAAGCAGAGGTAGGGAGG - Intergenic
1158718935 18:59906194-59906216 TCCAGAAAACAGAAATTTGGGGG - Intergenic
1159298254 18:66524458-66524480 TCCACAAAAAACAAGTATGTAGG + Intronic
1161261486 19:3340256-3340278 CCCAGAAAACAGAAGCAGCTTGG + Intergenic
1162601515 19:11673750-11673772 TCCAGGAAAAAGAAGCAGGAAGG + Intergenic
1162679493 19:12329874-12329896 TCCAGAAAACAGAAGTAGGTAGG + Intronic
1162820609 19:13221180-13221202 ACCAGAAAAAAGGAGTGGGTGGG - Intronic
1163348795 19:16762236-16762258 TGCGGAAAGGAGAAGTAGGTCGG - Intronic
1164141100 19:22464474-22464496 TTCTGAACACAGAAGTAGGTTGG + Intronic
1168668458 19:58222595-58222617 TCCTGAAATCACAAGTAGCTAGG + Intergenic
925511110 2:4626275-4626297 TCCAGAGAACAGAAGCAAGAGGG + Intergenic
927398072 2:22678442-22678464 GCCAGAAAACAGAAGTAGGCTGG + Intergenic
927880525 2:26687081-26687103 TCCAGAAGACAGAAGAAGAGGGG + Intergenic
928706607 2:33956291-33956313 TCCAGACAACAGCAAGAGGTTGG - Intergenic
929858360 2:45654199-45654221 TCCATAGAACAGATGTTGGTTGG + Intronic
931789278 2:65649144-65649166 TCCAGATAAAAGAAGGAGGTAGG - Intergenic
931866773 2:66421343-66421365 CCAAGAAGACAGAAGTAGGATGG + Intergenic
932967121 2:76489498-76489520 TCAAGAAACCAAAAGAAGGTTGG - Intergenic
933577263 2:84083353-84083375 TGCAGAAAACAGAATTGTGTTGG + Intergenic
934311315 2:91868168-91868190 TCCAAATAACAGAAGCAGTTTGG - Intergenic
936726053 2:115317224-115317246 TTCAGAGAACAGAAGTAGATTGG - Intronic
937511740 2:122603236-122603258 TACAGAATACAGAAGTAGAGGGG + Intergenic
939970585 2:148654727-148654749 GCCAGAAAACAGAAGGAAGGAGG - Intronic
940020177 2:149147989-149148011 TCCTGAAAACAGAAGAAGAATGG - Intronic
941524446 2:166589171-166589193 TCAAGAAAAGAGAAATAGTTTGG - Intergenic
941959853 2:171242823-171242845 TTCAAATAACATAAGTAGGTTGG + Intergenic
944472460 2:200069074-200069096 TCCAGAAAACTAAAGGAGGAGGG + Intergenic
944534749 2:200697563-200697585 TCAAGAAAATAGAAGGAGATTGG + Intergenic
945043891 2:205765064-205765086 CTCAGAAGACACAAGTAGGTGGG - Intronic
946509673 2:220341396-220341418 ACCAGGAAACAGAAGTTGGCTGG + Intergenic
946609022 2:221438174-221438196 TGCAGAAAAAAAAAATAGGTAGG - Intronic
946910646 2:224457356-224457378 TCCAGAAGCCAGATGCAGGTAGG + Intergenic
947101084 2:226621882-226621904 ACCAGAACACAGGAATAGGTAGG - Intergenic
947301524 2:228692983-228693005 TTAAGAATACAGAAGTAGCTTGG + Intergenic
948753157 2:240144040-240144062 TCCAGGAAACAGAGGTGGGCTGG - Intronic
1168837656 20:888444-888466 CCCAGCAAGCAGAAGCAGGTAGG + Intronic
1168981055 20:2004030-2004052 TGCAGAGAATAGAAGTAGCTCGG + Intergenic
1169454609 20:5741233-5741255 TCCAGAAAGCAGGATTGGGTGGG - Intergenic
1169976940 20:11339878-11339900 TCCAGGAAACAAATCTAGGTGGG - Intergenic
1170246238 20:14224474-14224496 TGCAGAAGACTGAAGTAGGCTGG - Intronic
1171298720 20:24040930-24040952 AGGAGAAAACAGGAGTAGGTTGG - Intergenic
1171482257 20:25462813-25462835 ACCAAAAAACAAAACTAGGTGGG - Intronic
1172655608 20:36535460-36535482 ACAAGAAAACAGAAGTGGGCCGG + Intergenic
1173028977 20:39336853-39336875 TCCAGAAATGGGAAGAAGGTGGG + Intergenic
1173058486 20:39639078-39639100 TGCAGAAAACAAAAGTATGGTGG + Intergenic
1173671891 20:44804771-44804793 CCCACCAAACAGAACTAGGTGGG + Intronic
1174540937 20:51288672-51288694 TCCAGAAAGCAGCAGAAGGCAGG - Intergenic
1176165970 20:63673866-63673888 TCCAGAAAGCAGAAATGGGGTGG - Intronic
1176852508 21:13933666-13933688 TCCAGAAAAGAGAAATATATAGG - Intergenic
1177063786 21:16403624-16403646 TCAAGATAACAGAAGAAGGCTGG - Intergenic
1178479842 21:32970322-32970344 TTCTGAAAACACAAGAAGGTAGG + Intergenic
1178619803 21:34164066-34164088 TCCAGAAAAGAGAAGTAAACAGG - Intergenic
1179666482 21:42916277-42916299 TCAAGAAAACAAAACTAGGCTGG - Intergenic
1180013155 21:45064670-45064692 TCTAGAAAACAAAAATAGGTGGG + Intergenic
1180223119 21:46372466-46372488 CCCAGAACACAGAAGCAGGAGGG - Intronic
1183068015 22:35377012-35377034 TTCAGGAAACAGAAGTGGTTTGG - Intergenic
1184266836 22:43352035-43352057 TGCAGAGAACTGAAGTAGGCTGG + Intergenic
1184880548 22:47301813-47301835 TCCAGAAAGCAGTAGTGGGGCGG + Intergenic
1185033453 22:48458195-48458217 TCCATAAAACAGAAGTAGATGGG + Intergenic
949164858 3:927504-927526 ACCAGAAAACAGGAGTATTTGGG - Intergenic
950220425 3:11191272-11191294 TGCAGTGAACAGAAGTGGGTGGG + Intronic
951072827 3:18352132-18352154 TCCAGAAAACAGAACCCTGTGGG - Exonic
953179323 3:40581808-40581830 CCCAGAAGAGAGAAGTAGATGGG - Intergenic
953346031 3:42176484-42176506 TTCAGCAAACTGAAGTAGGTGGG - Intronic
953771562 3:45781819-45781841 TCCAGAGAAGAGAAGGAGGGTGG + Intronic
954491380 3:50909816-50909838 TGGAGAGAACAGAACTAGGTTGG - Intronic
954628718 3:52036784-52036806 TCCAAAAAAAAAAAGTAGCTAGG - Intergenic
954629567 3:52040613-52040635 GCCAGAGAAGAGAAGTGGGTGGG + Intergenic
955008713 3:54993663-54993685 TCCAGAAATCACAAGTATGTTGG - Intronic
955074074 3:55596416-55596438 TACAGAAAACAAAATTAGCTTGG + Intronic
957452549 3:80398638-80398660 TTCAGAAAAGAGAAGTAACTTGG - Intergenic
958812415 3:98876873-98876895 TCCAGAAAACACTGATAGGTAGG + Intronic
961342860 3:126240792-126240814 TCCAGAAAACAGAAGAAATAAGG + Intergenic
962513363 3:136125426-136125448 TCCAGAAAATAATAGTAGGAGGG + Intronic
963564861 3:146916536-146916558 ACCAGATAACAGAAGTATATAGG + Intergenic
965382606 3:168008537-168008559 TACAGAAAACAGAAGCAGGTGGG + Intergenic
966337294 3:178882731-178882753 TCCAGATAACAGAAGGACTTGGG - Intergenic
966371938 3:179259955-179259977 TGCAGAGTACAGAAGCAGGTAGG - Intronic
966523363 3:180896357-180896379 TCCAGAAAAGAGAGGTAAATGGG + Intronic
967763885 3:193256270-193256292 TACAGAAAAAATAAGAAGGTAGG + Intronic
970583804 4:17496066-17496088 TTCAGAAAAGAGCAATAGGTGGG + Intronic
970840038 4:20457674-20457696 TCCAGAAAGGAAAAGTAGATAGG - Intronic
970887339 4:21001524-21001546 CCCAGGAAACAGGAGGAGGTAGG - Intronic
971498071 4:27288936-27288958 TACAGAAAAGAGAAGCAGCTGGG - Intergenic
972909113 4:43791962-43791984 TCCAGAAATGAGAAGTGTGTTGG - Intergenic
973162774 4:47038955-47038977 TACTGAAAACAGAAGTATTTTGG - Intronic
974368499 4:60984462-60984484 TGAAGCAAACAAAAGTAGGTGGG + Intergenic
975370265 4:73577973-73577995 TCTGGAAAACAGAGATAGGTGGG - Intronic
976818157 4:89174447-89174469 TCCTGAACACAGAAGCAGCTAGG + Intergenic
977618826 4:99113763-99113785 TCCAGAGAGCAGAACTAGGAAGG + Intergenic
977750605 4:100605497-100605519 TCCTGAATTCAGAACTAGGTTGG + Intronic
978382372 4:108143206-108143228 CCCAGTAAACTGAAGTAGGCAGG - Intronic
978599074 4:110409676-110409698 TCCAGAAAACAAAAAAAGGCAGG - Intronic
979399482 4:120231063-120231085 TTAAGAAGAGAGAAGTAGGTTGG + Intergenic
979839291 4:125417894-125417916 TACAGAAAACAGAAGTTGTGAGG + Intronic
980939484 4:139260208-139260230 TCTAAAAAACAGAAGAAGGAAGG + Intergenic
982861498 4:160456600-160456622 TCCAGAAAACAGAAACAGAGGGG - Intergenic
984251735 4:177344163-177344185 TGTAGAAAACAGAATCAGGTCGG - Intronic
985358905 4:189151247-189151269 TGCAGAACACAGCAGTAGGGAGG + Intergenic
985483811 5:137639-137661 TCCAGAAAACAGAAATGGGAGGG - Intergenic
985860930 5:2470219-2470241 TCAAGAAAACCGAGGCAGGTGGG - Intergenic
986079024 5:4369790-4369812 GCCAGAAAAAAGAAGCAGGCTGG + Intergenic
986159319 5:5211118-5211140 TCCAGAAAACAGAAGAGGAAGGG - Intronic
986854848 5:11856545-11856567 TCCAGAAAAGAGAGGTGGGAGGG + Intronic
986947360 5:13039283-13039305 GAGAGAAAAAAGAAGTAGGTAGG + Intergenic
987294257 5:16536183-16536205 GCCAGAGAAGTGAAGTAGGTGGG - Intronic
988309812 5:29542364-29542386 TCTTGAAGACAGAAGAAGGTTGG + Intergenic
989473946 5:41852901-41852923 TACAGAAAACAAAAGTAGCTGGG + Intronic
989507946 5:42249032-42249054 TAAAGAAAAAAAAAGTAGGTGGG + Intergenic
989667825 5:43876748-43876770 TCTAGAGAACATAAGTAGGGTGG + Intergenic
990399274 5:55421222-55421244 TACAGAGAACTGTAGTAGGTAGG + Intronic
991014105 5:61913077-61913099 TCCAGAAAACAGACGTAAACAGG + Intergenic
993542826 5:89173376-89173398 TCCAGCAAAAAGATGTAGGCTGG - Intergenic
994177195 5:96723838-96723860 GACAGAAAACAAAAGTAGGTTGG - Intronic
994900115 5:105760444-105760466 TCCACACAACAGCAGTAGGCAGG + Intergenic
995349776 5:111161769-111161791 TCATGAAAACAGAAGTATGGGGG - Intergenic
995783321 5:115801198-115801220 TTTAGAAAACAAAAGTATGTGGG - Intergenic
996574304 5:124964771-124964793 TCCAGAAAAGAGAGGTAAATGGG + Intergenic
998033997 5:138897949-138897971 TCCAGAAAAGAGATGCAGTTTGG + Intronic
999130720 5:149281208-149281230 TCCAGAAAAAAGAATTTAGTGGG - Intronic
999848304 5:155509448-155509470 CACAGATAAAAGAAGTAGGTCGG + Intergenic
1000745722 5:165031087-165031109 TACAGAGAACAGAAGTAGCTGGG - Intergenic
1001019769 5:168173084-168173106 TCCAGGAAACTGAAGGAGGTGGG - Intronic
1003158981 6:3619276-3619298 TCCAGAAATCAGAATTAAGGGGG - Intergenic
1004791665 6:19033496-19033518 TCCTGAAAAGAGACGTAAGTTGG - Intergenic
1007434640 6:41800299-41800321 AACAGAAAACAGAAATAGCTTGG + Intronic
1009669761 6:66731771-66731793 TGGAGAAAACAGAATTAGATTGG - Intergenic
1011754142 6:90482194-90482216 TTAAGAAAACAGAAGCAGGAAGG - Intergenic
1011771469 6:90678225-90678247 TCCAGAAAACAGTAGAGGGAAGG + Intergenic
1012257624 6:97051872-97051894 TCCAGAAAACAGGATAAGGCTGG - Intronic
1013024174 6:106253273-106253295 TCATGAACACAGAAGTAGGTGGG + Intronic
1014515752 6:122376429-122376451 TCCAGACAAAAGAACCAGGTGGG + Intergenic
1015221195 6:130805422-130805444 TCCAGAAAACTTTATTAGGTTGG - Intergenic
1015282688 6:131450797-131450819 CCAAGAAAACAGAAGGAGGTTGG - Intergenic
1018245392 6:161817863-161817885 TCCAGAAAACACAAATAAGGAGG + Intronic
1019675955 7:2312794-2312816 GCCAGAGAAGAGATGTAGGTGGG - Intronic
1020000082 7:4750601-4750623 TACAGAAAACAAAATTAGCTGGG - Intronic
1021910728 7:25383810-25383832 TCCAGAAATGAGAAGAATGTGGG - Intergenic
1022038856 7:26560174-26560196 TACAGAAAACAGAGGTAGGATGG - Intergenic
1022895387 7:34745677-34745699 TCCAGAAAAAAAAATTAGCTGGG - Intronic
1025207036 7:56999923-56999945 ACCAGCAAACAGAAGGAGGGGGG - Intergenic
1025664903 7:63576979-63577001 ACCAGCAAACAGAAGGAGGGGGG + Intergenic
1026131836 7:67627380-67627402 TTGAGAAAACAGAAGTATGGAGG + Intergenic
1027750323 7:82136300-82136322 GCCAGGATACAGAAGTAGATGGG + Intronic
1028035303 7:85973859-85973881 TACAGGACACAGAAGTAGGTAGG + Intergenic
1028603538 7:92629495-92629517 TTCAGAAATCTGAAGTAGTTTGG - Intronic
1030799562 7:113832897-113832919 TCCAGAAAACAGAAATAGTTAGG - Intergenic
1031124816 7:117761418-117761440 TCATGAGAACAGAAGTAGATGGG - Intronic
1032711224 7:134462121-134462143 GCCAGAAAACAGAAGTGAATGGG + Intergenic
1032935829 7:136730203-136730225 TCCTGAAAACAGCAGAAGCTTGG - Intergenic
1033417762 7:141179223-141179245 TCCAGAAAACTAAACTAGGCTGG - Intronic
1034076020 7:148231871-148231893 TCCAGAAAAAGGAAGGAGATAGG + Intronic
1038323809 8:26554728-26554750 TCCAGAAAACAGAAGCAGTGGGG + Intronic
1039235407 8:35497395-35497417 TTGAGAAAACAGCAGTAGGGAGG - Intronic
1039363597 8:36906472-36906494 TCCAGAAAATTACAGTAGGTGGG - Intronic
1040428096 8:47309657-47309679 ATCAGAAAACAGAAGTATTTGGG - Intronic
1040509825 8:48084181-48084203 TGCAGAAAACTGAAGATGGTTGG + Intergenic
1040518365 8:48153201-48153223 TCCTGGAAACAGAAGTCCGTGGG - Intergenic
1040672831 8:49713084-49713106 TCCTTTAACCAGAAGTAGGTAGG - Intergenic
1040757907 8:50803061-50803083 TCCAGAGAAGACAAATAGGTAGG - Intergenic
1040769073 8:50951023-50951045 GACAGAAAACAGAAGGAGGCAGG + Intergenic
1041385531 8:57298107-57298129 TCCAAAAAAAGCAAGTAGGTAGG + Intergenic
1042515209 8:69652103-69652125 CCCAGAAAACAGAGGAAGGTGGG - Intronic
1044398175 8:91738571-91738593 TTCAGAAAGCAGTAGTAGGCAGG - Intergenic
1044550023 8:93501562-93501584 GCAAGAAAACAGAAGGAGGAAGG - Intergenic
1045876195 8:106983587-106983609 TGCAGAAAACAGAAGTGGGTTGG - Intergenic
1045956653 8:107915872-107915894 TCCATAAAACAGAAAAGGGTGGG + Intronic
1046068178 8:109220385-109220407 TCCAGAAAAGAGATGTAGACAGG + Intergenic
1046194460 8:110841052-110841074 TCTAGAAAACAGAAGTTTCTAGG - Intergenic
1046667048 8:117015642-117015664 TCCAGAAAAAAAAGGTGGGTGGG - Intronic
1047857990 8:128933471-128933493 TCCAGTAAACAAAAAAAGGTAGG - Intergenic
1048049389 8:130803036-130803058 CCCAGTAAACACAAGTAGCTTGG - Intronic
1048175850 8:132151810-132151832 TCCAGAAAAGAGAAGTAAATAGG + Intronic
1048184934 8:132231124-132231146 GCCAGAAAACAGCAGAAGCTGGG + Intronic
1048357280 8:133663932-133663954 TCCTGAAATCAGAAGGAGCTTGG + Intergenic
1050565751 9:6880903-6880925 TCCAGAAAGAAGATGTAGGCTGG + Intronic
1052766620 9:32647974-32647996 GCCAGAAGACAGAAGCAGGCAGG - Intergenic
1053442172 9:38125600-38125622 GCCAGAGATCAGAGGTAGGTGGG - Intergenic
1055139325 9:72857873-72857895 TCCAGACAACAGAAGCAGCTGGG - Intergenic
1055215766 9:73860217-73860239 TCCAGTGAACAGAAGTAGAAAGG + Intergenic
1055584461 9:77743391-77743413 TCCAGAGAATGGAAATAGGTGGG + Intronic
1056871143 9:90280600-90280622 TCCATAAAATAGAAGTAGAGAGG + Intergenic
1057006010 9:91560552-91560574 TTCAGAAAACAGAAGAATGCTGG - Intergenic
1057006122 9:91561879-91561901 TTAAGAAAACAGAAGTGGGATGG + Intergenic
1057937881 9:99256274-99256296 TCCAGAGGACAGAGGTAGGAGGG - Intergenic
1058136028 9:101308464-101308486 TCCAGAATACAGAAGTCTGAAGG + Intronic
1058838890 9:108886281-108886303 TCCAGAAAACAGAAGTGTAAAGG + Intronic
1059057076 9:110995069-110995091 TCCTGGAAACAGAAGTACTTAGG - Intronic
1059099862 9:111459883-111459905 TCCAGAGAAGAGAAAAAGGTGGG + Intronic
1059242151 9:112815840-112815862 TCAAAAAAACAAAAGCAGGTTGG - Intronic
1060105646 9:120871273-120871295 TACAGGAAGGAGAAGTAGGTGGG - Intronic
1060377490 9:123129997-123130019 TCCAGAAAACAGAAGCTGTTTGG + Intronic
1185547478 X:956977-956999 TCAAGAAACCAGAAAAAGGTAGG - Intergenic
1186383460 X:9085587-9085609 CCCAGAAAACAAAAGAAGGGAGG - Intronic
1186474333 X:9845526-9845548 TCCAGAAAAAACAAAAAGGTGGG - Intronic
1186586446 X:10878893-10878915 TCCAGACAACACCATTAGGTAGG + Intergenic
1186786519 X:12961044-12961066 TCTAGAAAAAATAAGTAAGTAGG + Intergenic
1186811183 X:13190366-13190388 CCCAGAAATCCAAAGTAGGTTGG - Intergenic
1188862629 X:35275007-35275029 TCCAGAAAACAGAGGTAAACAGG - Intergenic
1189253307 X:39618256-39618278 TAAAGAAAACAAAAGTAGGGAGG + Intergenic
1189749515 X:44205436-44205458 TCTTGAAAACAGGAGAAGGTTGG - Intronic
1189810451 X:44776431-44776453 TCCATAAAATAGGAGTAGGCCGG + Intergenic
1190410085 X:50128272-50128294 GCAAGAAGACAGAAGCAGGTTGG + Intergenic
1191131705 X:57020283-57020305 AACAGAAAACAGAAATAAGTCGG - Intergenic
1192103613 X:68291664-68291686 TTCAGAACACAGAAGGATGTGGG - Intronic
1192192341 X:68998926-68998948 TCCTGAAAACAGACGGAAGTGGG + Intergenic
1192201908 X:69071519-69071541 TCCAGGCAACAGAGGGAGGTTGG + Intergenic
1193087313 X:77458357-77458379 TCCAGAAAACAAAAGTAGAGTGG + Intergenic
1193673775 X:84421524-84421546 ACCAGAAAACAGTAGTAGTGTGG + Intronic
1195202950 X:102567052-102567074 CCCAGAGAGCTGAAGTAGGTAGG + Intergenic
1196132271 X:112169832-112169854 TCCAAAAAAGAGGAGTGGGTGGG + Intergenic
1199813930 X:151380040-151380062 TCCAGAAAACAGAAGGTGAGAGG + Intergenic
1200925400 Y:8649809-8649831 TCCAGAACTAAGAGGTAGGTAGG - Intergenic